Previous Article | Next Article ![]()
Journal of Bacteriology, April 2000, p. 2311-2313, Vol. 182, No. 8
Department of Biology, University of
California at San Diego, La Jolla, California 92093-0116
Received 9 November 1999/Accepted 31 January 2000
The Bacillus subtilis genome encodes seven homologues
of the small multidrug resistance (SMR) family of drug efflux pumps. Six of these homologues are paired in three distinct operons, and
coexpression in Escherichia coli of one such operon,
ykkCD, but not expression of either ykkC or
ykkD alone, gives rise to a broad specificity,
multidrug-resistant phenotype including resistance to cationic,
anionic, and neutral drugs.
Five currently recognized ubiquitous
families of transport proteins are known to include members that are
capable of functioning in multidrug resistance (MDR) (1,
8; D. L. Jack and M. H. Saier, Jr., unpublished
observations). Of these, the small multidrug resistance (SMR) family is
unusual in that it consists of proteins with only 100 to 120 aminoacyl
residues and four transmembrane Analysis of the Bacillus subtilis genome has revealed that
this gram-positive bacterium encodes seven SMR homologues
(6) (Table 1). The
Escherichia coli genome encodes four such homologues (plus a
plasmid-encoded homologue), and distant SMR homologues have been
detected in a variety of other bacteria as well as in archaea and
eukaryotes (D. L. Jack and M. H. Saier, Jr., unpublished observations). Surprisingly, six of the B. subtilis
homologues and two of the E. coli homologues are encoded
from gene pairs in four distinct operons. These gene pairs are
ebrA and ebrB, yvdR and
yvdS, and ykkC and ykkD in B. subtilis as well as b1599 and b1600 in E. coli (Table
1).
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
A Broad-Specificity Multidrug Efflux Pump Requiring
a Pair of Homologous SMR-Type Proteins
![]()
ABSTRACT
Top
Abstract
Text
References
![]()
TEXT
Top
Abstract
Text
References
-helical spanners (see references
5 and 7 for reviews). Although
the subunit stoichiometry has not been defined for any member of this
family, previously characterized SMR-type drug efflux pumps are thought
to exist in the membrane as homo-oligomers (9, 11). Some SMR
family members have not been shown to exhibit an MDR phenotype in spite
of extensive effort in this direction (5). Those that have
been shown to export drugs from the bacterial cell are specific for
cationic drugs and are believed to translocate their substrates via a
fairly hydrophobic transmembrane pathway (4).
TABLE 1.
SMR family members identified in B. subtilis
and E. colia
One member of each B. subtilis protein pair is short (105 to 106 aminoacyl residues), while the other is longer (111 to 117 residues) (Table 1). This difference proved to be due to a partially conserved C-terminal hydrophilic extension present in the latter proteins but lacking in the former proteins. The short SMR family homologues could also be distinguished from the longer homologues of each of these protein pairs on the basis of topological features revealed by hydropathy plots (data not shown). Similar features are observed for the E. coli b1599-b1600 pair, and possibly also for the E. coli SugE-Ebr pair (Table 1). Interestingly, sugE and ebr of E. coli are chromosomally and plasmid encoded, respectively. These differences between the two members of each protein pair may provide the molecular basis for a requirement for the functional heterodimeric structure proposed here.
We initially cloned each of the seven B. subtilis genes and
expressed them individually in E. coli strain DH5
. A drug
resistance phenotype was not observed for any of them. We therefore
initiated studies to determine if both genes in any one operon needed
to be simultaneously expressed in order to observe an MDR phenotype. Results of the experiments with the ykkCD gene pair are
reported below.
The B. subtilis genes ykkC and ykkD
and the gene pair ykkCD were cloned into the expression
vector pBAD24 (2). The procedure was as follows. (i) The
targeted gene (or genes) was were amplified by PCR with
Pyrococcus woesei (Pwo) polymerase. For
ykkC, the primers (5' to 3') were
CATGCCATGGAATGGGGATTGGTCGTG (sense) and AAACTGCAGTTATGCCTCGCCTCCTTTTTCC (antisense); for
ykkD, the primers were CATGCCATGGTGCACTGGATCAGTTTATTGTG
(sense) and ACGCGTCGACACCAACTGCTGAGC (antisense); for
ykkCD, the ykkC sense and ykkD
antisense primers were used. (ii) The DNA was digested with the
NcoI and SalI (ykkD; ykkCD)
or NcoI and PstI (ykkC) restriction
enzymes with restriction sites flanking the target gene created during
the PCR. (iii) The included genes were then cloned into the pBAD24
polylinker region. (iv) The pBAD24 ligation mixture was heat shocked or
electroporated into E. coli DH5
. (v) Finally,
transformants were selected on the basis of ampicillin (50 µg/ml)
resistance. Recombinant plasmids were checked by restriction
enzyme digestion and direct sequencing. Expression of the
cloned gene(s) was induced by the addition of 0.2% arabinose.
A twofold dilution series of the drugs listed in Table
2 was analyzed. Drug assay plates were
prepared with Luria-Bertani (LB) agar, 50 µg of ampicillin per ml,
0.2% arabinose, and a twofold series of drug concentrations (1,
3) (Table 2). E. coli strain DH5
bearing the pBAD24
vector or bearing this plasmid with the gene(s) ykkC,
ykkD, or ykkCD was grown overnight in LB broth
with 50 µg of ampicillin per ml at 37°C with shaking (250 rpm).
Subcultures were grown to an A600 of 0.06 optical density unit in LB broth with 50 µg of ampicillin per ml and
0.2% arabinose at 37°C with shaking. These cultures were diluted
10
1, 10
2, and 10
3 in LB
broth, and 5-µl samples of each transformant at each dilution were
plated on the above-mentioned assay plates. The plates were incubated
overnight at 37°C, and drug resistance was scored after 12, 18, and
24 h of growth. The results presented in Table 2 are those
performed with 0.2% arabinose present in the plates.
|
When both the ykkC and ykkD genes were expressed
together in E. coli strain DH5
, a broad-spectrum MDR
phenotype was observed (Table 2). We observed resistance to a broader
range of toxic compounds than was observed for any previously studied
SMR pump (5, 7). These compounds included representative
cationic dyes and neutral and anionic antimicrobials (Table 2). The
effects were at least 1 order of magnitude greater than the additive
effect of the two individual genes, which were essentially inactive
when present alone (Table 2). It seems unlikely that the effects of YkkC and YkkD are due to the activation of an endogenous E. coli MDR pump, since each protein when synthesized alone had no
effect. Coexpression of the ykkC and ykkD genes
led to greater than 20-times-higher MICs of many of the compounds
tested and as great as 100-times-higher MICs of pyronin Y and
phosphonomycin. Transport studies (not shown) revealed that expression
of the ykkCD operon greatly inhibited ethidium bromide
accumulation, and this effect was abolished by the addition of
carbonylcyanide m-chlorophenylhydrazone (20 µM).
This report provides the first demonstration that a naturally occurring, proton motive force-dependent, secondary carrier consists of a hetero-oligomer of two or more dissimilar but homologous subunits. A heterodimer is proposed to be the actual structure. The YkkCD permease contrasts with other characterized members of the SMR family which are believed to be homo-oligomeric (7, 10). The results reported lead to a number of interesting questions. (i) Can each subunit function with just one subunit partner, or can it pair with multiple partners? (ii) Does just one of these subunits comprise the channel and determine the substrate specificity of the permease, or do both subunits participate in channel formation and substrate recognition? (iii) If multiple partners when paired are active, do the different possible combinations give rise to novel substrate specificities, or do these specificities merely reflect the specificities of the constituent subunits? (iv) Are the Sug proteins (5, 7), which have never been shown to exhibit a transport function, active only as hetero-oligomers? (v) What are the molecular determinants that allow an SMR polypeptide chain to function as a homo- or hetero-oligomer? These and other questions concerning the functionality of SMR superfamily members are currently under study in our laboratory.
Work in our laboratory was supported by NIH grants 2R01 AI14176 from the National Institute of Allergy and Infectious Diseases and 9RO1 GM55434 from the National Institute of General Medical Sciences, as well as by the M. H. Saier, Sr., Memorial Research Fund.
We thank Milda Simonaitis for her assistance in the preparation of the manuscript.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biology, University of California at San Diego, La Jolla, CA 92093-0116. Phone: (858) 534-4084. Fax: (858) 534-7108. E-mail: msaier{at}ucsd.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Brown, M. H., I. T. Paulsen, and R. A. Skurray. 1999. The multidrug efflux protein NorM is a prototype of a new family of transporters. Mol. Microbiol. 31:394-395[CrossRef][Medline]. |
| 2. |
Guzman, L.-M.,
D. Belin,
M. J. Carson, and J. Beckwith.
1995.
Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter.
J. Bacteriol.
177:4121-4130 |
| 3. |
Mitchell, B. A.,
I. T. Paulsen,
M. H. Brown, and R. A. Skurray.
1999.
Bioenergetics of the staphylococcal multidrug export protein QacA. Identification of distinct binding sites for monovalent and divalent cations.
J. Biol. Chem.
274:3541-3548 |
| 4. |
Mordoch, S. S.,
D. Granot,
M. Lebendiker, and S. Schuldiner.
1999.
Scanning cysteine accessibility of EmrE, an H+-coupled multidrug transporter from Escherichia coli, reveals a hydrophobic pathway for solutes.
J. Biol. Chem.
274:19480-19486 |
| 5. | Paulsen, I. T., R. A. Skurray, R. Tam, M. H. Saier, Jr., R. J. Turner, J. H. Weiner, E. B. Goldberg, and L. L. Grinius. 1996. The SMR family: a novel family of multidrug efflux proteins involved with the efflux of lipophilic drugs. Mol. Microbiol. 19:1167-1175[Medline]. |
| 6. | Paulsen, I. T., M. K. Sliwinski, and M. H. Saier, Jr. 1998. Microbial genome analyses: global comparisons of transport capabilities based on phylogenies, bioenergetics and substrate specificities. J. Mol. Biol. 277:573-592[CrossRef][Medline]. |
| 7. | Saier, M. H., Jr., I. T. Paulsen, and A. Matin. 1997. A bacterial model system for understanding multidrug resistance. Microb. Drug Resist. 3:289-295[Medline]. |
| 8. |
Saier, M. H., Jr.,
I. T. Paulsen,
M. K. Sliwinski,
S. S. Pao,
R. A. Skurray, and H. Nikaido.
1998.
Evolutionary origins of multidrug and drug-specific efflux pumps in bacteria.
FASEB J.
12:265-274 |
| 9. | Schwaiger, M., M. Lebendiker, H. Yerushalmi, M. Coles, A. Gröger, C. Schwarz, S. Schuldiner, and H. Kessler. 1998. NMR investigation of the multidrug transporter EmrE, an integral membrane protein. Eur. J. Biochem. 254:610-619[Medline]. |
| 10. |
Yerushalmi, H.,
M. Lebendiker, and S. Schuldiner.
1995.
EmrE, an Escherichia coli 12-kDa multidrug transporter, exchanges toxic cations and H+ and is soluble in organic solvents.
J. Biol. Chem.
270:6856-6863 |
| 11. |
Yerushalmi, H.,
M. Lebendiker, and S. Schuldiner.
1996.
Negative dominance studies demonstrate the oligomeric structure of EmrE, a multidrug antiporter from Escherichia coli.
J. Biol. Chem.
271:31044-31048 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»