Previous Article | Next Article ![]()
Journal of Bacteriology, April 2000, p. 2336-2340, Vol. 182, No. 8
Department of Molecular Genetics & Microbiology, University of Massachusetts Medical School,
Worcester, Massachusetts 01655
Received 15 October 1999/Accepted 21 January 2000
Recombination between short linear double-stranded DNA molecules
and Escherichia coli chromosomes bearing the
red genes of bacteriophage Efficient recombination involving
the Escherichia coli chromosome takes place only when the
recombining partner DNA is large and contains Chi sites to activate the
recombination-promoting activities of RecBCD (for a review, see
reference 20). Short linear DNA molecules in the
cell generally are destroyed by RecBCD. Recombination between short
linear DNA molecules and the host chromosome at a frequency high enough
to be of practical use in making gene replacements has been observed
with recD and recBC sbcBC mutant strains
(12, 24). Still-higher frequency recombination is seen with
E. coli strains in which the recBCD gene cluster is replaced by the red genes (gam,
bet, and exo) of phage In addition to proceeding at high efficiency, Red-mediated
recombination between a short linear DNA molecule and a circular homologue may represent a simpler recombination pathway than any of the
previously characterized pathways for conjugational or transductional
recombination. These properties of efficiency and (relative) simplicity
recommend the hybrid phage-bacterial recombination system for research
on general recombination mechanisms. In previous studies, we have shown
that such recombination events require the activities of RecA, Exo, and
Bet, as well as double-strand breaks (22). Murphy
(19) found that the frequency is decreased by mutation of
recA and recF and increased by mutation of
recJ. The frequency of Red-mediated recombination is also
elevated in a recG mutant strain. In the case of an event
involving the insertion of substantial nonhomology (as in gene
replacement), recombination in the recG host is apparently
constrained to proceed through a pathway requiring RuvC resolvase
(23).
In this study, we examined the dependence of Red-mediated gene
replacement on several additional known E. coli
recombination genes. Functional complementation between some of these
genes and other phage Strains.
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Genetic Requirements of Phage
Red-Mediated Gene
Replacement in Escherichia coli K-12
![]()
ABSTRACT
Top
Abstract
Text
References
in place of
recBCD was tested in strains bearing mutations in genes
known to affect recombination in other cellular pathways. The linear
DNA was a 4-kb fragment containing the cat gene, with
flanking lac sequences, released from an infecting phage
chromosome by restriction enzyme cleavage in the cell; formation of
Lac
chloramphenicol-resistant bacterial progeny was
measured. Recombinant formation was found to be reduced in
ruvAB and recQ strains. In this genetic
background, mutations in recF, recO, and
recR had large effects on both cell viability and on
recombination. In these cases, deletion of the sulA gene
improved viability and strain stability, without improving
recombination ability. Expression of a gene(s) from the nin
region of phage
partially complemented both the viability and
recombination defects of the recF, recO, and
recR mutants and the recombination defect of
ruvC but not of ruvAB or recQ mutants.
![]()
TEXT
Top
Abstract
Text
References
(19).
genes was tested as well.
lac::cat819 nin5
has been described previously (23). Bacterial strains
employed in this study are described in Table
1. A number of them contain in
vitro-assembled substitutions in which most of the coding sequence of a
gene is replaced with a genetic element conferring resistance to either
tetracycline or kanamycin or else with a short synthetic sequence that
preserves the original reading frame. Details of these constructions
will be described elsewhere (K. C. Murphy, K. Campellone, and
A. R. Poteete, unpublished data).
TABLE 1.
Bacterial strains used in
this studya
chromosome, fused to the promoter Ptac,
along with a kanamycin resistance-conferring determinant derived from
Tn903. The Ptac-nin fusion was
constructed in four steps. (i) The EcoRI fragment of the
chromosome of
cI857 S7 bearing the nin region (bp 39168 to 44972) was ligated into the EcoRI site of pBR322, in the
orientation in which the direction of transcription of the
genes
would be clockwise in the conventional map of pBR322. (ii) Sequences of the resulting plasmid between the PstI and SmaI
sites, containing the N-terminal half of bla, were replaced
by sequences between the PstI and PvuII sites of
ptac12 (1) containing Ptac, with an
XhoI linker (CCCTCGAGGG) inserted between the
PvuII and SmaI ends. (iii) Sequences of the
resulting plasmid, containing the transcriptional terminator
tR2, were deleted by digestion with XhoI and StuI, filling in with DNA polymerase I
large fragment, and ligation with BglII linkers
(CAGATCTG). (iv) Sequences between the filled-in
HindIII sites of the resulting plasmid were replaced with EcoRI linkers (GGAATTCC). An
EcoRI fragment from the resulting plasmid, bearing the
Ptac-nin fusion, was then ligated into the EcoRI site of a galK insertion vector. In the
resulting plasmid, pTP878, the
sequences are transcribed in the
galK antisense direction. The galK insertion
vector was constructed from pTP838 (Murphy et al., unpublished data) by
digestion with ApaI and SacI, blunting the ends,
and ligating EcoRI linkers between the flanking gal and kan sequences. The
galK::Ptac-nin kan
insertion of pTP878 was crossed into TP507 and TP554 (Table 1) by
electroporation with PvuII-digested plasmid DNA, as
described previously (19); kanamycin-resistant recombinants
were selected.
The presence of Tn10, Tn5, and
mini-Tn10-9(Kan) in various genes in strains described in
Table 1 was confirmed by production of appropriate-size DNA products in
PCR with transposon- and chromosomal gene-specific primers. Cells from
liquid cultures were pelleted, resuspended in water, and used directly
as template. Primer tn5out (CCATGTTAGGAGGTCACATGGAAG)
directs DNA synthesis from both ends of Tn5 outward;
primer mtn10 (GATCATATGACAAGATGTGTATCCACCTT) does the same
for Tn10 and mini-Tn10. Primers used for specific
genes were as follows: edamU (CGCGGCCGGTATTCAGATTAACTG),
recfU (ATCATCGAGCTCGAGATGGAAATGGTGGCACGTGTT), recfD
(TC ATCAGAGCTCCGATTTCACCTCAGAAGAAACCAG), recjU
(ATCATCGAGCTCAATTGACGTGTTGTTTCCCAGCCA), recjD
(ATCATCGAGCTCTCCATCGCCTGTTTCTCGGCATTT), recoU
(ATCATCGAGCTCCGCCGAACAGGCGTTGAAAAAACT), recoD
(TCATCAGAGCTCGCTTTTGCTGCGGCTTCTTTCACA), recrU
(ATCATCGAGCTCAAAGACTGGCTTCGGTCACCGAT), and recrD (TCATCAGAGCTCCTGGTGTACTCCTGCTTACCTTCA).
Methods.
Crosses between
lac::cat819 nin5 and bacterial strains
were carried out as described previously (23). UV
sensitivity was measured by plating bacteria on Luria-Bertani (LB)
agar, exposing the plates to variable doses of UV (0, 10, 20, or 30 J/m2, measured with a Spectronics DM-254N shortwave UV
meter), and incubating them at 37°C in the dark. Fractional survival
was determined by colony counts relative to the unexposed control.
Experimental system.
Experiments to measure recombination
between a linear DNA fragment and the E. coli chromosome
employed bacterial strains bearing a
(recC-ptr-recB-recD)
::Ptac-gam-red-pae-cI
substitution. In these strains, the E. coli recC,
ptr, recB, and recD genes are replaced
by the recombination genes of phage
, the PaeR7
restriction-modification system, and the phage
cI gene.
Log-phase cultures of these bacteria are infected with
lac::cat819 nin5. The injected phage
chromosome circularizes but does not proceed through the lytic or
lysogenic cycle because of the cI repressor present in the cell. The
chromosomally encoded PaeR7 restriction endonuclease cuts
the (unmodified) phage DNA at two sites, releasing a 4-kb linear DNA
fragment consisting of the cat gene flanked by 1.5-kb
lac sequences. Recombination between this fragment and the
chromosome frequently results in gene replacement; recombinants are
detected as white colonies on LB agar plates supplemented with
chloramphenicol, IPTG
(isopropyl-
-D-thiogalactopyranoside), and X-Gal
(23).
lac::cat819 nin5, therefore,
presumably reflect recombination reactions that took place between the
bacterial chromosome and phages that were cut only once by the
PaeR7 endonuclease. The Lac+ recombinants are
the subject of ongoing investigation. Only Lac
recombinant production is considered below.
In the experiments reported below, defects in the production of
recombinants are due to defects in the process of recombination, not in
any of the steps involved in the delivery of the linear double-stranded
DNA recombination substrate into the cell. All the strains that formed
recombinants at reduced efficiency were found to plate
Pae-modified
imm22 and
h80
imm22 at high efficiency (data not shown). This observation
demonstrates that adsorption and injection of phage DNA are not
impaired in these mutants. (It also demonstrates that these strains,
many of which have poor viability, are as capable as the wild type of
becoming infective centers.) In addition, all were found to plate
unmodified
h80 imm22 with an efficiency of less than
0.001 (data not shown). This observation indicates that
PaeR7 cutting is efficient in all of them.
Dependence on recombination genes.
Mutant alleles of genes
recA, recF, recJ, recO,
recQ, recR, ruvA and ruvB,
and ruvC were introduced into TP507 (AB1157
recBCD
::Ptac-gam-red-pae-cI822 [23]) and a derivative, TP554, in which the
recG gene had been deleted (Table 1). Measurements of the
recombination proficiencies of most of these strains are indicated in
Table 2.
|
background, the recombination rate was
elevated and it was reduced more by mutation of ruvC than it
was in the recG+ strains, as previously reported
(23). In the recG
background, loss of
ruvAB function led to a slightly greater loss of
recombination proficiency than in the recG+
strain, but it is not clear that the difference is significant. As in
the recG+ strain, recombination was strongly
dependent upon recA, reduced 5-fold by
recQ::Tn3 and 20-fold by
recQ
. In comparing the recG+ and
recG
strains, the biggest difference in the dependence of recombination on specific E. coli genes was seen in the case
of recJ. Loss of recJ function, while increasing
recombination in the recG+ strain, decreased it
10-fold in the recG
strain. While this observation might
seem to indicate an interesting mechanistic relationship between RecG
and RecJ proteins, it is unclear that the effect of the double mutant
is specific. The recG
recJ strain is only marginally
viable (data not shown), and its recombination deficiency might be
secondary to other defects.
The recF, recO, and recR mutants in
both recG+ and recG
backgrounds
exhibited even lower viability than did the recG
recJ strain, on the order of 1 CFU per 1,000 countable cells in log-phase culture (data not shown). Cultures of these mutants exhibited low, but
highly variable, rates of recombination, possibly reflecting the
outgrowth of revertants or pseudorevertants. We found that the
viability of recF, recO, and recR
mutants could be improved by deletion of sulA (an
SOS-inducible gene, formerly known as sfiA, whose product is
a cell division inhibitor; see reference 7) and so
conducted tests in this background (Table 2). The sulA
mutation itself has no effect on recombination frequency. Mutation of
recF, recO, or recR substantially
decreased recombination in both the sulA
recG+ and sulA
recG
backgrounds.
We used the sulA
strain to test whether induction of the
SOS regulon would increase Red-mediated recombination activity by increasing the intracellular levels of recombination functions. Introduction of the lexA71::Tn5
mutation, however, slightly reduced recombination, in both the
recG+ and recG
backgrounds (Table
2).
The sensitivity of the bacterial strains to UV radiation was tested.
Results are shown in Table 2. Mutations in all of the recombination
genes tested significantly increased UV sensitivity, whether they
decreased or increased the efficiency of recombination.
Proteins encoded by the recombination genes tested in this study have
been extensively characterized. The RecF, RecO, and RecR proteins of
E. coli form a complex that is thought to function in
recombination by modulating the DNA binding of RecA (10, 32,
33). RecQ protein is a helicase which can cooperate with RecA and
SSB proteins to initiate recombination-like events in vitro (9,
30). The RuvA and RuvB proteins form a complex that catalyzes the
branch migration of crossover structures in DNA (17, 18).
The complex of RuvAB with DNA is thought to direct the action of RuvC,
which resolves Holliday junctions by making strand-specific cuts
(31).
Complementation by
functions.
Two genes in the
nin region of phage
, orf and rap,
function in homologous recombination. The orf gene can
substitute for recF, recO, and recR in
phage recombination mediated by the host system in recBC
sbcBC cells in the absence of the
Red system (26).
The rap gene encodes an endonuclease which specifically cleaves branched DNA structures, including Holliday junctions, that are
thought to be generated during recombination and which hypothetically
might substitute for RuvC (11, 28). We tested whether
nin genes could functionally replace any of the E. coli genes needed for Red-mediated gene replacement, by inserting
a Ptac fusion of orf and other
genes downstream of it into the galK gene. Details of the
construction are given above.
backgrounds but
more strongly in the recG
strain. As shown in Table 2, in
the nin+ recG
background, loss of
recF, recO, or recR function reduced recombination, but less than in the recG
strain lacking
nin functions. The smaller effects of recF,
recO, and recR mutations in this background
occurred in spite of the fact that the alleles used in this case were
deletions. Partial complementation of the defects of recF,
recO, and recR mutants by nin was also
evident in the viability of these mutant strains, which was better than
that of their nin-less counterparts (data not shown). The
nin genes also were seen to compensate for loss of
ruvC in gene replacement recombination. In contrast,
nin did nothing to remedy the recombination defects of
recA, recQ, or ruvAB mutants. The
nin genes did not compensate for loss of any of the
recombination genes in providing resistance to the lethal effects of UV
radiation (Table 2).
Red mechanism.
A hypothetical mechanism for Red-mediated
recombination leading to gene replacement in E. coli
recG
, based on an earlier scheme (23), on results
shown in Table 2, and on the research on recombination proteins cited
above, is shown in Fig. 1. Results presented above do not distinguish which
proteins encoded by nin genes contribute to complementation of the recombination
defects of mutant strains lacking RecFOR or RuvC. However, research by others on orf and rap strongly suggests that
these are the relevant functions (11, 26, 28). The mechanism
shown in Fig. 1 accounts for the main pathway to recombinant formation
in a recG mutant cell. In a recG+
cell, other pathways, frequently not leading to recombinant formation, are apparently more prevalent (23).
|
Relationship to other pathways.
Results described above and in
previous work (19, 23) indicate the importance of
recA, recF, recO, recR,
recQ, ruvAB, and ruvC, and the
inhibitory influence of recJ and recG, in
Red-mediated gene replacement in E. coli lacking RecBCD
function. These observations distinguish the hybrid phage-bacterial
recombination pathway from the classical RecF and RecE pathways for
conjugational and transductional recombination, in that the latter are
partially dependent upon both recJ and recG (for
a review, see reference 13). However, strains of
E. coli bearing chromosomal substitutions of the
red genes for the recC-ptr-recB-recD cluster are
particularly analogous to recB recC sbcA strains, in which
RecBCD is functionally replaced by the induced recombination functions
recE and recT of the cryptic lambdoid prophage
Rac (3-6, 8). A more direct comparison would be needed to
determine whether the Red pathway (with or without expression of other
recombination genes) is mechanistically different from the RecE pathway.
| |
ACKNOWLEDGMENTS |
|---|
We thank Steven Sandler, Kenan Murphy, and Kenneth Campellone for strains, helpful advice, and discussions.
This work was supported by Public Health Service grant GM51609 from the National Institutes of Health.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Molecular Genetics & Microbiology, University of Massachusetts Medical School, 55 Lake Ave. North, Worcester, MA 01655. Phone: (508) 856-3708. Fax: (508) 856-5920. E-mail: anthony.poteete{at}umassmed.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Amman, E., J. Brosius, and M. Ptashne. 1983. Vectors bearing a hybrid trp-lac promoter useful for regulated expression of cloned genes in Escherichia coli. Gene 25:167-178[CrossRef][Medline]. |
| 2. | Bachmann, B. J. 1996. Derivations and genotypes of some mutant derivatives of Escherichia coli K-12, p. 2460-2488. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. ASM Press, Washington, D.C. |
| 3. |
Barbour, S. D., and A. J. Clark.
1970.
Biochemical and genetic studies of recombinational proficiency in Escherichia coli. I. Enzymatic activity associated with the recB+ and recC+ genes.
Proc. Natl. Acad. Sci. USA
65:955-961 |
| 4. |
Barbour, S. D.,
H. Nagaishi,
A. Templin, and A. J. Clark.
1970.
Biochemical and genetic studies of recombinational proficiency in Escherichia coli. II. Rec+ revertants due to indirect suppression of Rec mutants.
Proc. Natl. Acad. Sci. USA
67:128-135 |
| 5. |
Clark, A. J.,
V. Sharma,
S. Brenowitz,
C. C. Chu,
S. Sandler,
L. Satin,
A. Templin,
I. Berger, and A. Cohen.
1993.
Genetic and molecular analyses of the C-terminal region of the recE gene from the Rac prophage of Escherichia coli K-12 reveal the recT gene.
J. Bacteriol.
175:7673-7682 |
| 6. |
Gillen, J. R.,
D. K. Willis, and A. J. Clark.
1981.
Genetic analysis of the RecE pathway of genetic recombination in Escherichia coli K-12.
J. Bacteriol.
145:521-535 |
| 7. |
Gottesman, S., and M. R. Maurizi.
1992.
Regulation by proteolysis: energy-dependent proteases and their targets.
Microbiol. Rev.
56:592-621 |
| 8. |
Hall, S. D.,
M. F. Kane, and R. D. Kolodner.
1993.
Identification and characterization of the Escherichia coli RecT protein, a protein encoded by the recE region that promotes renaturation of homologous single-stranded DNA.
J. Bacteriol.
175:277-287 |
| 9. |
Harmon, F. G., and S. C. Kowalczykowski.
1998.
RecQ helicase, in concert with RecA and SSB proteins, initiates and disrupts DNA recombination.
Genes Dev.
12:1134-1144 |
| 10. |
Hegde, S. P.,
M. H. Qin,
X. H. Li,
M. A. L. Atkinson,
A. J. Clark,
M. Rajagopalan, and M. V. V. S. Madiraju.
1996.
Interactions of RecF protein with RecO, RecR, and single-stranded DNA binding proteins reveal roles for the RecF-RecO-RecR complex in DNA repair and recombination.
Proc. Natl. Acad. Sci. USA
93:14468-14473 |
| 11. | Hollifield, W., E. Kaplan, and H. Huang. 1987. Efficient RecABC-dependent, homologous recombination between coliphage lambda and plasmids requires a phage ninR region gene. Mol. Gen. Genet. 210:248-255[CrossRef][Medline]. |
| 12. |
Jasin, M., and P. Schimmel.
1984.
Deletions of an essential gene in Escherichia coli by site-specific recombination with linear DNA fragments.
J. Bacteriol.
159:783-786 |
| 13. |
Kowalczykowski, S. C.,
D. A. Dixon,
A. K. Eggleston,
S. D. Lauder, and W. M. Rehrauer.
1994.
Biochemistry of homologous recombination in Escherichia coli.
Microbiol. Rev.
58:401-465 |
| 14. |
Krueger, J. H.,
S. J. Elledge, and G. C. Walker.
1983.
Isolation and characterization of Tn5 insertion mutations in the lexA gene of Escherichia coli.
J. Bacteriol.
153:1368-1378 |
| 15. |
Lovett, S. T., and A. J. Clark.
1984.
Genetic analysis of the recJ gene of Escherichia coli K-12.
J. Bacteriol.
157:190-196 |
| 16. | Mahdi, A. A., and R. G. Lloyd. 1989. Identification of the recR locus of Escherichia coli K-12 and analysis of its role in recombination and DNA repair. Mol. Gen. Genet. 216:503-510[CrossRef][Medline]. |
| 17. |
Muller, B.,
I. R. Tsaneva, and S. C. West.
1993.
Branch migration of Holliday junctions promoted by the Escherichia coli RuvA and RuvB proteins. I. Comparison of RuvAB and RuvB-mediated reactions.
J. Biol. Chem.
268:17179-17184 |
| 18. |
Muller, B.,
I. R. Tsaneva, and S. C. West.
1993.
Branch migration of Holliday junctions promoted by the Escherichia coli RuvA and RuvB proteins. II. Interaction of RuvB with DNA.
J. Biol. Chem.
268:17185-17189 |
| 19. |
Murphy, K. C.
1998.
Use of bacteriophage recombination functions to promote gene replacement in Escherichia coli.
J. Bacteriol.
180:2063-2071 |
| 20. | Myers, R. S., and F. W. Stahl. 1994. Chi and the RecBCD enzyme of Escherichia coli. Annu. Rev. Genet. 28:49-70[Medline]. |
| 21. | Nakayama, K., N. Irino, and H. Nakayama. 1988. The recQ gene of Escherichia coli K-12: molecular cloning and isolation of insertion mutants. Mol. Gen. Genet. 200:266-271. |
| 22. |
Poteete, A. R., and A. C. Fenton.
1993.
Efficient double-strand break-stimulated recombination promoted by the general recombination systems of phages and P22.
Genetics
134:1013-1021[Abstract].
|
| 23. |
Poteete, A. R.,
A. C. Fenton, and K. C. Murphy.
1999.
Roles of RuvC and RecG in phage Red-mediated recombination.
J. Bacteriol.
181:5402-5408 |
| 24. |
Russell, C. B.,
D. S. Thaler, and F. W. Dahlquist.
1989.
Chromosomal transformation of Escherichia coli recD strains with linearized plasmids.
J. Bacteriol.
171:2609-2613 |
| 25. |
Sandler, S. J., and A. J. Clark.
1994.
RecOR suppression of recF mutant phenotypes in Escherichia coli K-12.
J. Bacteriol.
176:3661-3672 |
| 26. |
Sawitzke, J. A., and F. W. Stahl.
1994.
The phage orf gene encodes a trans-acting factor that suppresses Escherichia coli recO, recR, and recF mutations for recombination of but not of E. coli.
J. Bacteriol.
176:6730-6737 |
| 27. | Sharples, G. J., F. E. Benson, G. T. Illing, and R. G. Lloyd. 1990. Molecular and functional analysis of the ruv region of Escherichia coli K-12 reveals three genes involved in DNA repair and recombination. Mol. Gen. Genet. 221:219-226[Medline]. |
| 28. |
Sharples, G. J.,
L. M. Corbett, and I. R. Graham.
1998.
Rap protein is a structure-specific endonuclease involved in phage recombination.
Proc. Natl. Acad. Sci. USA
95:13507-13512 |
| 29. |
Thoms, B., and W. Wackernagel.
1988.
Suppression of the UV-sensitive phenotype of Escherichia coli recF mutants by recA(Srf) and recA(Tif) mutations requires recJ+.
J. Bacteriol.
170:3675-3681 |
| 30. |
Umezu, K.,
K. Nakayama, and H. Nakayama.
1990.
Escherichia coli RecQ protein is a DNA helicase.
Proc. Natl. Acad. Sci. USA
87:5363-5367 |
| 31. |
van Gool, A. J.,
N. M. Hajibagheri,
A. Stasiak, and S. C. West.
1999.
Assembly of the Escherichia coli RuvABC resolvasome directs the orientation of Holliday junction resolution.
Genes Dev.
13:1861-1870 |
| 32. |
Volkert, M. R., and M. A. Hartke.
1984.
Suppression of Escherichia coli recF mutations by recA-linked srfA mutations.
J. Bacteriol.
157:498-506 |
| 33. | Webb, B. L., M. M. Cox, and R. B. Inman. 1997. Recombinational DNA repair: the RecF and RecR proteins limit the extension of RecA filaments beyond single-strand DNA gaps. Cell 91:347-356[CrossRef][Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Appl. Environ. Microbiol. | Infect. Immun. | Eukaryot. Cell |
|---|---|---|
| Mol. Cell. Biol. | J. Virol. | Microbiol. Mol. Biol. Rev. |
| ALL ASM JOURNALS |