Previous Article | Next Article 
Journal of Bacteriology, May 2000, p. 2422-2427, Vol. 182, No. 9
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Action of RNase II and Polynucleotide Phosphorylase
against RNAs Containing Stem-Loops of Defined Structure
Catherine
Spickler and
George A.
Mackie*
Department of Biochemistry and Molecular
Biology, University of British Columbia, Vancouver, British
Columbia, Canada V6T 1Z3
Received 11 January 2000/Accepted 16 February 2000
 |
ABSTRACT |
The 3'
5' exoribonucleases, RNase II and polynucleotide
phosphorylase (PNPase), play an essential role in degrading fragments of mRNA generated by prior cleavages by endonucleases. We have assessed
the ability of small RNA substrates containing defined stem-loop
structures and variable 3' extensions to impede the exonucleolytic
activity of these enzymes. We find that stem-loops containing five G-C
base pairs do not block either enzyme; in contrast, more stable
stem-loops of 7, 9, or 11 bp block the processive action of both
enzymes. Under conditions where enzyme activity is limiting, both
enzymes stall and dissociate from their substrates six to nine
residues, on average, from the base of a stable stem-loop structure.
Our data provide a clear mechanistic explanation for the
previous observation that RNase II and PNPase behave as functionally redundant.
 |
INTRODUCTION |
In the bacterium Escherichia
coli, degradation of mRNA is almost always initiated by an
endoribonuclease, usually RNase E (1, 26). At least two 3'
exoribonucleases subsequently attack the newly created 3' termini
generated by RNase E. One of these, RNase II, a monomer with a
molecular mass of 72.5 kDa, is hydrolytic (31) and accounts
for up to 90% of the exoribonucleolytic activity in crude extracts
(12). The other, polynucleotide phosphorylase (PNPase), a
trimer with 78-kDa subunits, is phosphorolytic and accounts for the
remaining 10% of the exoribonuclease activity in E. coli
extracts (12). Although strains singly mutated in the genes
encoding RNase II (rnb) or PNPase (pnp) exhibit a
mild phenotype, double mutants deficient in both PNPase and RNase II are inviable (13). This finding has been interpreted to
indicate that these exonucleases are functionally redundant but
collectively essential. Other data, however, suggest that RNase II and
PNPase are not functionally equivalent but are differentially sensitive to RNA secondary structure (3, 7, 8, 16, 19, 24, 28). In
such cases, PNPase is required for the degradation of highly structured
RNAs and RNase II cannot substitute (7, 8, 19). Moreover,
RNase II, but not PNPase, may actually stabilize some RNAs (3,
28). In addition, while RNase II behaves as a soluble monomeric
enzyme (31), PNPase can be assembled into a multienzyme
complex, the degradosome (5, 27, 29). In the complex, PNPase
can degrade extensively structured RNA substrates in concert with RhlB,
a putative DEAD-box RNA helicase (10, 29). Alternatively,
the action of PNPase against folded RNAs can be stimulated by prior 3'
polyadenylation of such substrates (2, 33). RNase II can
also be stimulated by polyadenylation in vitro, but to a more limited
extent (7).
In order to resolve the paradoxical properties of RNase II and PNPase,
we compared their abilities to degrade short synthetic RNA substrates
containing a single stem-loop of defined size and thermal stability.
This would permit us to test directly whether both enzymes are
functionally equivalent. In addition, we could measure the minimum size
of base-paired stems which would stall each enzyme and consequently
predict which natural secondary structures are intrinsically sensitive
to RNase II and which would require PNPase and/or RNA helicases for
their degradation.
 |
MATERIALS AND METHODS |
Synthesis of RNA in vitro.
Both strands of the DNA templates
for the stem-loop structures shown in Fig.
1a containing KpnI and
BamHI cohesive termini at their 5' and 3' ends,
respectively, were synthesized at the NAPS Unit, University of British
Columbia, annealed, and ligated into the vector pTZ18U (25)
by using standard methods (30). Appropriate recombinants,
verified by DNA sequence analysis, were modified further by ligation of
annealed oligonucleotides GC-10 (5'-GATCC[A]30T)
and GC-11 (5'-CTAGA[T]30G) between the
BamHI and XbaI sites to generate templates for
the SLxA RNAs. For internally labeled RNAs, transcription was performed
essentially as previously described (11) by using 1.5 pmol
of DNA template linearized with either BamHI (SLx RNAs),
XbaI (SLxA RNAs), or HindIII (SLxR RNAs), 25 µCi of [
-32P]CTP, and 20 U of T7 RNA polymerase
(Promega) but with the inclusion of 0.18 U of pyrophosphatase (Sigma)
to enhance yields. For 5'-labeled RNAs, the GTP concentration was
reduced to 125 µM and 25 µCi of [
-32P]GTP was
substituted for [
-32P]CTP. RNA structure mapping
was performed by using 5' [
-32P]-labeled substrates as
described previously (21, 22).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic diagram of the structures of RNA substrates.
(a) Three different classes of 3' extensions, denoted as SLx, where x
is the number of base pairs in the stem-loop. The common 5' end of all
substrates is 5' pppGGGAAUUCGAGCUCGGUAC. An imperfect inverted repeat
in the SLxR RNAs (see the text) is shown by arrows. (b) Primary and
predicted secondary structures of the four stem-loops examined in this
work.
|
|
Exonuclease assays.
RNase II (6) and PNPase
(8) were purified to at least 90% homogeneity as described
previously. Assays of RNase II were performed essentially as previously
described (6) in a buffer containing 17 mM HEPES-KOH (pH
7.5), 100 mM KCl, 1 mM MgCl2, 2 mM dithiothreitol, and 5%
glycerol with 2 pmol of RNA and 0.1 ng of purified RNase II (0.4 milli-units; 1.4 fmol) in 25 µl at 37°C for the times noted in the
figures. Assays of PNPase (0.2 ng [0.9 fmol]; 8 × 10
6 U) were performed similarly in a buffer containing 20 mM Tris-HCl (pH 7.5), 20 mM KCl, 1 mM MgCl2, and 1.5 mM
dithiothreitol supplemented with 10 mM Na-phosphate (neutralized). In
either case, aliquots were withdrawn at the appropriate times, quenched
in 3 volumes of a buffer containing 90% deionized formamide, denatured
by boiling, and separated on an 8% sequencing gel. Data were
quantified by measuring the recoveries of substrate and partially
digested (stalled) intermediates by using a phosphorimager.
 |
RESULTS |
RNA substrates of defined structure.
Figure 1 illustrates the
structure of the RNA substrates used in this investigation. Three
different classes of 3' extensions were created. The first, denoted SLx
(where x denotes the number of base pairs in the stem-loop structure),
contains a six-residue 3' extension, GGGAUC (Fig. 1a, top).
The second, SLx-A, contains a 41-residue 3' extension,
GGGAUCC[A]30UCUAG (Fig. 1a, middle), which
mimics a typical bacterial poly(A) tail. The third class of
substrate, SLx-R, contains a 36-residue extension corresponding to the
polylinker of the vector 3' to the BamHI site
(5'-GGG AUCCUCUAGAGUCGACCUGCAGGCAUGCAAGCU). This
extension is essentially random and duplicates the 3' extension of a
model substrate, t40B, used previously (6). Four different stem-loop structures, shown in Fig. 1b, were combined with each class
of extension. Each stem-loop contains a four-residue loop (a GNRA
tetraloop in one case) and a stem of 5, 7, 9, or 11 G-C base pairs
(Fig. 1b).
The SLx and SLxA RNAs were predicted to fold as shown in Fig.
1 by
using the program RNAdraw (
23;
http://rnadraw.base8.se/).
RNAs SL5 and SL5A could also form
weak alternative structures
(not shown). RNAs in the SLxR class were
also predicted to fold
as designed but could form an additional
imperfect stem-loop 3'
to the designed stem-loop (shown by the arrows
in Fig.
1a). Some
other structures could also be formed involving base
pairing between
the 5' and 3' extensions of the SLxR RNAs (not shown).
Accordingly,
structure mapping of SL11R RNA was employed to assess the
extent
to which alternative structures could form under conditions for
exonuclease digestion. All C and G residues in the 3' extension
were
accessible to RNase CL3 or T1, respectively, suggesting that
the major
fraction of SL11R exists in the form shown in Fig.
1a
(data not
shown).
Exonuclease digestion of SLx and SLxA RNAs.
RNAs in the SLx
class mimic the products obtained after RNase E digestion of a typical
mRNA substrate inasmuch as this endonuclease cleaves in single-stranded
regions, often between stem-loop structures, thus leaving a short 3'
extension beyond the base of the stem-loop (9, 14, 20). Each
of the RNA substrates (the multiple bands are due to 3'-terminal
heterogeneity) was digested with RNase II (Fig.
2a) or PNPase (Fig. 2b), and the fraction
of full-length substrate or intermediate products remaining was
measured (Table 1). The three most stable
substrates, SL11, SL9, and SL7, are almost completely resistant to
either RNase II or PNPase although the same dilution of either enzyme
was fully active against other substrates (see below). In contrast, SL5
RNA does undergo limited digestion by PNPase (12% of the substrate
disappears in 10 min) but not by RNase II (Fig. 2 and Table 1). The
relative resistance of SL5 RNA could be overcome by increasing the
amount of either exonuclease in the assay by 10-fold, with the result
that 61 and 72% of the SL5 RNA was digested by RNase II and PNPase,
respectively, after 10 min of digestion (data not shown). We presume
that this reflects the ability of the added enzyme to "capture"
RNAs which have spontaneously melted (see the Discussion).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 2.
Digestion of SLx RNAs with 3' exonucleases. Digestions
were performed as described in Materials and Methods. Aliquots were
removed at 0, 2.5, 5, and 10 min of digestion and denatured. RNAs were
separated by electrophoresis under denaturing conditions, and the
products were visualized by autoradiography or by phosphorimaging (see
Materials and Methods). Shown are digestions with RNase II (a) and
PNPase (b). Each panel is a separate gel. The schematic in the central
margin illustrates the structure of the substrates.
|
|
RNAs of the SLxA class containing a poly(A) tail were significantly
more susceptible to exonuclease digestion than those of
the SLx class
(Fig.
3 and Table
1). These substrates
were degraded
in a two-step process: an initial rapid shortening from
the 3'
end to yield a set of stalled intermediates was followed by a
varied rate of disappearance of these intermediates. Each of the
RNA
substrates was shortened by either exonuclease, and approximately
the
same fraction of the full-length starting material, 50 to
70%, was
attacked during the time of measurement in each case.
RNAs SL11A, SL9A,
and SL7A were converted quickly into relatively
stable shorter
intermediates denoted by the brackets in the center
margin in Fig.
3.
The intermediates from RNAs SL11A, SL9A, and
SL7A accumulated almost
quantitatively during the assay and displayed
limited further
susceptibility to either RNase II (Fig.
3a) or
PNPase (Fig.
3b).
Intermediates from SL7A RNA were largely resistant
to RNase II but
fourfold more susceptible to PNPase (Table
1).
SL5A was susceptible to
both enzymes, as from 30 to 45% of the
starting material was converted
to mononucleotides and limit oligonucleotides
by RNase II or by PNPase,
respectively, with the accumulation
of only a faint ladder of
intermediates (Fig.
3a, lanes 16 to
20).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 3.
Digestion of SLxA RNAs with 3' exonucleases. Digestions
were performed as described in Materials and Methods. Aliquots were
removed after 0, 2.5, 5, 7.5 (a only), and 10 min of digestion,
denatured, and resolved as described in the legend to Fig. 2. Shown are
digestions with RNase II (a) and PNPase (b). Brackets in the margins
point to intermediates which accumulate during digestion (see the
text). Each panel is a different gel; therefore, the relative
mobilities of products cannot be compared directly between panels.
Lanes with sequence ladders are not shown. The schematic diagrams in
the margin denote the structures of the substrate and intermediates.
Lane M, undigested SL11A RNA.
|
|
The sizes of the various intermediates obtained from digestion of SLxA
RNAs were determined by comparison to a ladder generated
by partial
alkaline hydrolysis or partial (random) T
1 RNase digestion
of a 5'-end-labeled substrate. In general, each enzyme produced
a
distribution of three to five favored end points 3' to a stem-loop
(Table
2). The most prominent
intermediate produced by RNase
II from SL11A maps eight residues 3' to
the base of the stem-loop;
others map between six and nine residues
from its base (Fig.
3a,
lanes 1 to 5; Table
2). A faster-moving doublet
at the bottom
of lanes 4 and 5 and a similarly sized band in lanes
17 to 20
of Fig.
3a map to the residue(s) 3' to the base of the
stem-loop.
These bands could not be recovered reproducibly, however.
The
most prominent intermediate from PNPase digestion of SL11A also
maps eight residues to the 3' side of the stem-loop, with others
at
seven or nine residues (Fig.
3b, lanes 1 to 5; Table
2). A
similar
distribution of stalled intermediates was measured with
the other SLxA
substrates (Table
2), although faint shorter and
longer intermediates
were also observed (i.e., 5 or 10 residues
3' to the base of the
stem-loop).
Exonuclease digestion of the SLxR series of substrates.
Although we recognized that members of the SLxR series of substrates,
designed as a control for the SLxA series, might prove problematic in
view of their potential to engage in intra- and intermolecular base
pairing through 5' extensions, we examined their susceptibility to
digestion under conditions identical to those used above. SL5R RNA was
relatively susceptible to both RNase II and PNPase. At least 35% of
the substrate disappeared totally within 10 min, and most of the
starting material was converted to shorter intermediates (see Fig.
4a, lanes 16 to 20, and Table 1). In
contrast, although full-length SL11R RNA was digestible by either
exonuclease, as a significant fraction of the initial substrate
disappeared during the assay, it was converted to relatively stable
shorter intermediate products, much like SL11A. A minor RNase II
product from digestion of SL11R RNA (arrowhead in Fig. 4a) represents
removal of about three or four residues from the extreme 3' end. This
may represent stalling of RNase II 3' to an imperfect 7-bp stem-loop
formed by pairing between the sequence 5'-CCUCUAG
and 5'-CUGCAGG (G-U and C-C mismatches are
underlined; see also Fig. 1b). A similar minor product was also
observed with SL9R in other experiments (not visible in Fig. 4a, lanes
6 to 10). A further set of major products shown by brackets in Fig. 4a,
lanes 1 to 5, represents stalling 3' to the 11-bp stem. In the assays
of digestion by PNPase, small amounts of an intermediate shortened by
just three or four residues, similar to that obtained with RNase II,
appeared transiently (Fig. 4b, lanes 1 to 5) but did not accumulate.
Rather, over 80% of the initial substrate was converted further to
stable intermediates corresponding to stalling 8 to 11 residues 3' to
the 11-bp stem-loop. Increasing the concentration of RNase II by up to
10-fold or that of PNPase by up to 5-fold enhanced the initial rate of
shortening of SL11R RNA, as would be expected. Neither increase altered
the extent of conversion of SL11R RNA to stalled intermediates or the
size of the latter (data not shown). This differs from the response of
SL5 RNA and presumably reflects the high stability of the stem-loop in
SL11R. SL7R and SL9R RNAs exhibited behavior between that of SL5R and
SL11R.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 4.
Digestion of SLxR RNAs with 3' exonucleases. Digestions
were performed as described in Materials and Methods. Aliquots were
removed at 0, 2.5, 5, 7.5, and 10 min of digestion, denatured, and
resolved as described in the legend to Fig. 2. Shown are digestions
with RNase II (a) and PNPase (b). Each panel is a separate gel. Lanes
with sequence ladders are not shown. Brackets in the margins mark the
positions of intermediates presumed to be the result of stalling of the
enzyme. The arrowheads show the position of a transient intermediate
(see the text). The schematic diagrams in the central margin denote the
structures of the substrate and intermediates (see the text).
|
|
 |
DISCUSSION |
Functional similarities between RNase II and PNPase.
To our
knowledge, this is the first systematic comparison of the properties of
RNase II and PNPase in vitro, although we and other investigators have
examined these enzymes' activities against a single or limited number
of substrates (6-8, 17, 18, 24). We chose conditions in
which each enzyme exhibited comparable exoribonuclease activity and in
which the activity was limiting. To a large extent, the determinants of
these enzymes' abilities to attack different substrates are quite
similar. Neither enzyme is able to attack RNA stem-loops containing a
3'-terminal extension of six residues, in agreement with previous data
in vitro (6) and in vivo (3, 28). However,
comparably stable RNAs in the SLxA or SLxR class are readily shortened
by both enzymes. The partial removal of the 3' extension on these
substrates by both enzymes shows that there is no initial barrier to
initiation of exonucleolytic attack; rather, the barrier to continued
digestion is the internal stem-loop itself. These observations are best explained by a model in which either exonuclease requires a
single-stranded RNA target larger than six residues for initial
binding. PNPase is very inefficient against short oligomers
(Km values from 50 to 250 mM), but becomes
highly efficient (Km of 10 nM) for oligomers greater than 10 residues (16). Likewise, RNase II loses
processivity on poly(A) containing fewer than 10 to 15 residues
(4). Whether stalling (and subsequent dissociation) or
complete digestion occurs will depend on the balance between the rate
of enzyme dissociation and the rate of transient melting of weaker
stem-loop barriers, such as in SL5A and SL7A. The ability of increased
concentrations of RNase II or PNPase to overcome the resistance of SL5
to decay may simply reflect the greater likelihood of either enzyme
binding to a partially or fully melted substrate molecule before the
latter refolds ("substrate capture").
The ability of either exonuclease, but especially of RNase II, the
major 3' exonuclease in crude extracts (
12), to remove
poly(A) extensions would indirectly impede exonuclease action
against
structured RNAs (
3,
6,
28). This property is likely
the
basis of the observation that RNase II can stabilize RNA-OUT
and
fragments of the
rpsO mRNA (
3,
28). At first
glance,
such behavior would seem to promote futile cycles of
polyadenylation
and deadenylation. We believe that it serves to drive
mRNA decay
into an RNase E-dependent mode, promoting 5'

3' decay
(
9).
Previous investigations have reported that PNPase will stall six
residues 3' to a stable RNA stem-loop (
24) whereas RNase
II
stalls only four residues away (
17,
24). In contrast, we
observed only modest differences between situations in which the
two
exoribonucleases cease digestion before encountering a stable
secondary
structure. Our data for SL11A RNA show that there is
a distribution of
stalling points with the most frequent of these
occurring somewhat more
3' than reported by others (eight residues
from the base of the stem
for both RNase II and PNPase). We believe
that the differences among
published reports must reflect variations
in substrate sequence and
composition. In this regard, the SL
RNA substrates contain stem-loops
which are composed of G-C base
pairs exclusively; in addition, the
three first residues 3' to
the base of the stem-loop are
Gs.
Is the behavior of the exoribonucleases in vitro consistent with
mRNA decay in vivo?
Apart from repetitive extragenic palindrome
(REP) sequences and rho-independent terminators, perfectly matched
stem-loops containing more than six contiguous base pairs ought to
occur relatively infrequently in most mRNAs (frequency, <1 in 4,056 residues). Imperfect stem-loops would, of course, occur much more often. Moreover, all such structures would contain roughly equal frequencies of A-U and G-C base pairs, unlike the more stable model
RNAs used here. Thus, it is unlikely that either exoribonuclease would
encounter many highly stable, internal barriers in most mRNA fragments
created by RNase E cleavage. Rather, new 3' ends will most often be
generated in regions which are unstructured or contain weak stem-loops
which are in rapid equilibrium with their alternatively folded or
unfolded counterparts. The structure of such cleavage products would
permit access by either exoribonuclease as long as more than 10 to 12 residues at their extremities were or could become single-stranded. An
example of this situation occurs in the rpsT mRNA. A major
RNase E cleavage site occurs five residues 3' to a moderately stable
(
G =
2.7 kCal/mol) stem-loop (stem-loop IV; see reference
20). This structure is not a barrier to RNase II or
to PNPase in vitro or apparently in vivo (7, 19). To this
extent, these two enzymes are functionally redundant. In those cases
where a stable stem-loop does occur less than 10 to 12 residues 5' to
an RNase E cleavage site, our data show that oligoadenylation can
restore the accessibility of the cleavage product to both
exoribonucleases (7, 8).
The two 3' exoribonucleases do, however, differ significantly in one
regard. PNPase spontaneously forms a complex with RNase
E (
5,
10,
27,
29,
32), in which form its activity can
be stimulated by
RhlB, a DEAD-box RNA helicase. This relatively
recently appreciated
property of PNPase allows it to catalyze
the degradation of highly
folded RNAs, including REP sequences
or rho-independent terminators
(
10,
29). This could explain
the reports of differential
degradation of structured RNAs dependent
on PNPase (
3,
7,
15,
19). In contrast, RNase II does
not bind to components of the
degradosome and cannot be activated
by RhlB, thereby limiting its
ability to degrade RNAs containing
stable stem-loops (
10).
 |
ACKNOWLEDGMENTS |
This work was supported by operating grant MT-5396 from the
Medical Research Council of Canada. Salary support for C.S. was partially provided by a grant from NSERC.
We thank members of the laboratory, especially Glen Coburn, for their advice.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry & Molecular Biology, University of British Columbia, D.H. Copp Building, 2146 Health Sciences Mall, Vancouver, British Columbia, Canada V6T 1Z3. Phone: (604) 822-2792. Fax: (604) 822-5227. E-mail: gamackie{at}interchange.ubc.ca.
 |
REFERENCES |
| 1.
|
Belasco, J. G.
1993.
mRNA degradation in prokaryotic cells: an overview, p. 3-12.
In
J. G. Belasco, and G. Brawerman (ed.), Control of messenger RNA stability. Academic Press, San Diego, Calif.
|
| 2.
|
Blum, E.,
A. J. Carpousis, and C. F. Higgins.
1999.
Polyadenylation promotes degradation of 3'-structured RNA by the Escherichia coli mRNA degradosome in vitro.
J. Biol. Chem.
274:4009-4016[Abstract/Free Full Text].
|
| 3.
|
Braun, F.,
E. Hajnsdorf, and P. Régnier.
1996.
Polynucleotide phosphorylase is required for the rapid degradation of the RNase E-processed rpsO mRNA of Escherichia coli devoid of its 3' hairpin.
Mol. Microbiol.
19:997-1005[CrossRef][Medline].
|
| 4.
|
Cannistraro, V. J., and D. Kennell.
1994.
The processive reaction mechanism of ribonuclease II.
J. Mol. Biol.
243:930-943[CrossRef][Medline].
|
| 5.
|
Carpousis, A. J.,
G. Van Houwe,
C. Ehretsmann, and H. M. Krisch.
1994.
Copurification of E. coli RNase E and PNPase: evidence for a specific association between two enzymes important in RNA processing and degradation.
Cell
76:889-900[CrossRef][Medline].
|
| 6.
|
Coburn, G. A., and G. A. Mackie.
1996.
Overexpression, purification and properties of Escherichia coli ribonuclease II.
J. Biol. Chem.
271:1048-1053[Abstract/Free Full Text].
|
| 7.
|
Coburn, G. A., and G. A. Mackie.
1996.
Differential sensitivities of portions of the mRNA for ribosomal protein S20 to 3'-exonucleases dependent on oligoadenylation and RNA secondary structure.
J. Biol. Chem.
271:15776-15781[Abstract/Free Full Text].
|
| 8.
|
Coburn, G. A., and G. A. Mackie.
1998.
Reconstitution of the degradation of the mRNA for ribosomal protein S20 with purified enzymes.
J. Mol. Biol.
279:1061-1074[CrossRef][Medline].
|
| 9.
|
Coburn, G. A., and G. A. Mackie.
1999.
Degradation of mRNA in Escherichia coli: an old problem with some new twists.
Prog. Nucleic Acid Res. Mol. Biol.
62:55-108[Medline].
|
| 10.
|
Coburn, G. A.,
X. Miao,
D. J. Briant, and G. A. Mackie.
1999.
Reconstitution of a minimal RNA degradosome demonstrates functional coordination between a 3' exonuclease and a DEAD-box RNA helicase.
Genes Dev.
13:2594-2603[Abstract/Free Full Text].
|
| 11.
|
Cormack, R. S., and G. A. Mackie.
1992.
Structural requirements for the processing of Escherichia coli 5S ribosomal RNA by RNase E in vitro.
J. Mol. Biol.
228:1078-1090[CrossRef][Medline].
|
| 12.
|
Deutscher, M. P., and N. B. Reuven.
1991.
Enzymatic basis for hydrolytic versus phosphorolytic mRNA degradation in Escherichia coli and Bacillus subtilis.
Proc. Natl. Acad. Sci. USA
88:3277-3280[Abstract/Free Full Text].
|
| 13.
|
Donovan, W. P., and S. R. Kushner.
1986.
Polynucleotide phosphorylase and ribonuclease II are required for cell viability and mRNA turnover in Escherichia coli K-12.
Proc. Natl. Acad. Sci. USA
83:120-124[Abstract/Free Full Text].
|
| 14.
|
Ehretsmann, C. P.,
A. J. Carpousis, and H. M. Krisch.
1992.
Specificity of Escherichia coli endoribonuclease RNase E: in vivo and in vitro analysis of mutants in a bacteriophage T4 mRNA processing site.
Genes Dev.
6:149-159[Abstract/Free Full Text].
|
| 15.
|
Godefroy, T.
1970.
Kinetics of polymerization and phosphorolysis reactions of Escherichia coli polynucleotide phosphorylase.
Eur. J. Biochem.
14:222-231[Medline].
|
| 16.
|
Guaneros, G., and C. Portier.
1991.
Different specificities of ribonuclease II and polynucleotide phosphorylase in 3' mRNA decay.
Biochimie
73:543-549[Medline].
|
| 17.
|
Li, Z., and M. P. Deutscher.
1994.
The role of individual exoribonucleases in processing at the 3' end of Escherichia coli tRNA precursors.
J. Biol. Chem.
269:6064-6071[Abstract/Free Full Text].
|
| 18.
|
Li, Z., and M. P. Deutscher.
1996.
Maturation pathways for E. coli tRNA precursors: a random multienzyme process in vivo.
Cell
86:503-512[CrossRef][Medline].
|
| 19.
|
Mackie, G. A.
1989.
Stabilization of the 3' one-third of Escherichia coli ribosomal protein S20 mRNA in mutants lacking polynucleotide phosphorylase.
J. Bacteriol.
171:4112-4120[Abstract/Free Full Text].
|
| 20.
|
Mackie, G. A.
1992.
Secondary structure of the mRNA for ribosomal protein S20.
J. Biol. Chem.
267:1054-1061[Abstract/Free Full Text].
|
| 21.
|
Mackie, G. A., and J. L. Genereaux.
1993.
The role of RNA structure in determining RNase E-dependent cleavage sites in the mRNA for ribosomal protein S20 in vitro.
J. Mol. Biol.
234:998-1012[CrossRef][Medline].
|
| 22.
|
Mackie, G. A.,
J. L. Genereaux, and S. K. Masterman.
1997.
Modulation of the activity of RNase E in vitro by RNA sequences and secondary structures 5' to cleavage sites.
J. Biol. Chem.
272:609-616[Abstract/Free Full Text].
|
| 23.
|
Matzura, O., and A. Wennborg.
1996.
RNAdraw: an integrated program for RNA secondary structure calculation and analysis under 32-bit Microsoft Windows.
Comput. Appl. Biosci.
12:247-249[Abstract/Free Full Text].
|
| 24.
|
McLaren, R. S.,
S. F. Newbury,
G. S. C. Dance,
H. C. Causton, and C. F. Higgins.
1991.
mRNA degradation by processive 3'-5' exoribonucleases in vitro and the implications for prokaryotic mRNA decay in vivo.
J. Mol. Biol.
221:81-95[Medline].
|
| 25.
|
Mead, D. A.,
E. Szczesna-Skorupa, and B. Kemper.
1986.
Single-stranded DNA `blue' T7 promoter plasmids: a versatile tandem promoter system for cloning and protein engineering.
Protein Eng.
1:67-74[Abstract/Free Full Text].
|
| 26.
|
Melefors, Ö.,
U. Lundberg, and A. von Gabain.
1993.
RNA processing and degradation by RNase K and RNase E, p. 53-70.
In
J. G. Belasco, and G. Brawerman (ed.), Control of messenger RNA stability. Academic Press, San Diego, Calif.
|
| 27.
|
Miczak, A.,
V. R. Kaberdin,
C.-L. Wei, and S. Lin-Chao.
1996.
Proteins associated with RNase E in a multicomponent ribonucleolytic complex.
Proc. Natl. Acad. Sci. USA
93:3865-3869[Abstract/Free Full Text].
|
| 28.
|
Pepe, C. M.,
S. Masle a-Gali , and R. W. Simons.
1994.
Decay of the IS 10 antisense RNA by 3' exoribonucleases: evidence that RNase II stabilizes RNA-OUT against PNPase attack.
Mol. Microbiol.
13:1133-1142[CrossRef][Medline].
|
| 29.
|
Py, B.,
C. F. Higgins,
H. M. Krisch, and A. J. Carpousis.
1996.
A DEAD-box helicase in the Escherichia coli RNA degradosome.
Nature
381:169-172[CrossRef][Medline].
|
| 30.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 31.
|
Shen, V., and D. Schlessinger.
1982.
RNases I, II, and IV of Escherichia coli, p. 505-515.
In
P. D. Boyer (ed.), The Enzymes, vol. XV. Academic Press, New York, N.Y.
|
| 32.
|
Vanzo, N. F.,
Y. S. Li,
B. Py,
E. Blum,
C. F. Higgins,
L. C. Reynal,
H. M. Krisch, and A. J. Carpousis.
1998.
Ribonuclease E organizes the protein interactions in the Escherichia coli RNA degradosome.
Genes Dev.
12:2770-2781[Abstract/Free Full Text].
|
| 33.
|
Xu, F., and S. N. Cohen.
1995.
RNA degradation in Escherichia coli regulated by 3' adenylation and 5' phosphorylation.
Nature
374:180-183[CrossRef][Medline].
|
Journal of Bacteriology, May 2000, p. 2422-2427, Vol. 182, No. 9
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Vincent, H. A., Deutscher, M. P.
(2009). The Roles of Individual Domains of RNase R in Substrate Binding and Exoribonuclease Activity: THE NUCLEASE DOMAIN IS SUFFICIENT FOR DIGESTION OF STRUCTURED RNA. J. Biol. Chem.
284: 486-494
[Abstract]
[Full Text]
-
Deikus, G., Condon, C., Bechhofer, D. H.
(2008). Role of Bacillus subtilis RNase J1 Endonuclease and 5'-Exonuclease Activities in trp Leader RNA Turnover. J. Biol. Chem.
283: 17158-17167
[Abstract]
[Full Text]
-
Chang, S. A., Cozad, M., Mackie, G. A., Jones, G. H.
(2008). Kinetics of Polynucleotide Phosphorylase: Comparison of Enzymes from Streptomyces and Escherichia coli and Effects of Nucleoside Diphosphates. J. Bacteriol.
190: 98-106
[Abstract]
[Full Text]
-
Mohanty, B. K., Kushner, S. R.
(2007). Ribonuclease P processes polycistronic tRNA transcripts in Escherichia coli independent of ribonuclease E. Nucleic Acids Res
35: 7614-7625
[Abstract]
[Full Text]
-
Chen, X., Wurtmann, E. J., Van Batavia, J., Zybailov, B., Washburn, M. P., Wolin, S. L.
(2007). An ortholog of the Ro autoantigen functions in 23S rRNA maturation in D. radiodurans. Genes Dev.
21: 1328-1339
[Abstract]
[Full Text]
-
Amblar, M., Barbas, A., Gomez-Puertas, P., Arraiano, C. M.
(2007). The role of the S1 domain in exoribonucleolytic activity: Substrate specificity and multimerization. RNA
13: 317-327
[Abstract]
[Full Text]
-
Barnett, T. C., Bugrysheva, J. V., Scott, J. R.
(2007). Role of mRNA Stability in Growth Phase Regulation of Gene Expression in the Group A Streptococcus. J. Bacteriol.
189: 1866-1873
[Abstract]
[Full Text]
-
Deutscher, M. P.
(2006). Degradation of RNA in bacteria: comparison of mRNA and stable RNA. Nucleic Acids Res
34: 659-666
[Abstract]
[Full Text]
-
Stickney, L. M., Hankins, J. S., Miao, X., Mackie, G. A.
(2005). Function of the Conserved S1 and KH Domains in Polynucleotide Phosphorylase. J. Bacteriol.
187: 7214-7221
[Abstract]
[Full Text]
-
Bollenbach, T. J., Lange, H., Gutierrez, R., Erhardt, M., Stern, D. B., Gagliardi, D.
(2005). RNR1, a 3'-5' exoribonuclease belonging to the RNR superfamily, catalyzes 3' maturation of chloroplast ribosomal RNAs in Arabidopsis thaliana. Nucleic Acids Res
33: 2751-2763
[Abstract]
[Full Text]
-
Nishimura, Y., Kikis, E. A., Zimmer, S. L., Komine, Y., Stern, D. B.
(2004). Antisense Transcript and RNA Processing Alterations Suppress Instability of Polyadenylated mRNA in Chlamydomonas Chloroplasts. Plant Cell
16: 2849-2869
[Abstract]
[Full Text]
-
Weaver, K. E., Ehli, E. A., Nelson, J. S., Patel, S.
(2004). Antisense RNA Regulation by Stable Complex Formation in the Enterococcus faecalis Plasmid pAD1 par Addiction System. J. Bacteriol.
186: 6400-6408
[Abstract]
[Full Text]
-
Tomich, M., Mohr, C. D.
(2004). Transcriptional and Posttranscriptional Control of Cable Pilus Gene Expression in Burkholderia cenocepacia. J. Bacteriol.
186: 1009-1020
[Abstract]
[Full Text]
-
Sohlberg, B., Huang, J., Cohen, S. N.
(2003). The Streptomyces coelicolor Polynucleotide Phosphorylase Homologue, and Not the Putative Poly(A) Polymerase, Can Polyadenylate RNA. J. Bacteriol.
185: 7273-7278
[Abstract]
[Full Text]
-
Kushner, S. R.
(2002). mRNA Decay in Escherichia coli Comes of Age. J. Bacteriol.
184: 4658-4665
[Full Text]
-
Clements, M. O., Eriksson, S., Thompson, A., Lucchini, S., Hinton, J. C. D., Normark, S., Rhen, M.
(2002). Polynucleotide phosphorylase is a global regulator of virulence and persistency in Salmonella enterica. Proc. Natl. Acad. Sci. USA
99: 8784-8789
[Abstract]
[Full Text]
-
Hambraeus, G., Karhumaa, K., Rutberg, B.
(2002). A 5' stem-loop and ribosome binding but not translation are important for the stability of Bacillus subtilis aprE leader mRNA. Microbiology
148: 1795-1803
[Abstract]
[Full Text]
-
Hambraeus, G., Persson, M., Rutberg, B.
(2000). The aprE leader is a determinant of extreme mRNA stability in Bacillus subtilis. Microbiology
146: 3051-3059
[Abstract]
[Full Text]