INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

In the bacterium Escherichia coli, degradation of mRNA is almost always initiated by an endoribonuclease, usually RNase E (1, 26). At least two 3' exoribonucleases subsequently attack the newly created 3' termini generated by RNase E. One of these, RNase II, a monomer with a molecular mass of 72.5 kDa, is hydrolytic (31) and accounts for up to 90% of the exoribonucleolytic activity in crude extracts (12). The other, polynucleotide phosphorylase (PNPase), a trimer with 78-kDa subunits, is phosphorolytic and accounts for the remaining 10% of the exoribonuclease activity in E. coli extracts (12). Although strains singly mutated in the genes encoding RNase II (rnb) or PNPase (pnp) exhibit a mild phenotype, double mutants deficient in both PNPase and RNase II are inviable (13). This finding has been interpreted to indicate that these exonucleases are functionally redundant but collectively essential. Other data, however, suggest that RNase II and PNPase are not functionally equivalent but are differentially sensitive to RNA secondary structure (3, 7, 8, 16, 19, 24, 28). In such cases, PNPase is required for the degradation of highly structured RNAs and RNase II cannot substitute (7, 8, 19). Moreover, RNase II, but not PNPase, may actually stabilize some RNAs (3, 28). In addition, while RNase II behaves as a soluble monomeric enzyme (31), PNPase can be assembled into a multienzyme complex, the degradosome (5, 27, 29). In the complex, PNPase can degrade extensively structured RNA substrates in concert with RhlB, a putative DEAD-box RNA helicase (10, 29). Alternatively, the action of PNPase against folded RNAs can be stimulated by prior 3' polyadenylation of such substrates (2, 33). RNase II can also be stimulated by polyadenylation in vitro, but to a more limited extent (7).

In order to resolve the paradoxical properties of RNase II and PNPase, we compared their abilities to degrade short synthetic RNA substrates containing a single stem-loop of defined size and thermal stability. This would permit us to test directly whether both enzymes are functionally equivalent. In addition, we could measure the minimum size of base-paired stems which would stall each enzyme and consequently predict which natural secondary structures are intrinsically sensitive to RNase II and which would require PNPase and/or RNA helicases for their degradation.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Synthesis of RNA in vitro. Both strands of the DNA templates for the stem-loop structures shown in Fig. 1a containing KpnI and BamHI cohesive termini at their 5' and 3' ends, respectively, were synthesized at the NAPS Unit, University of British Columbia, annealed, and ligated into the vector pTZ18U (25) by using standard methods (30). Appropriate recombinants, verified by DNA sequence analysis, were modified further by ligation of annealed oligonucleotides GC-10 (5'-GATCC[A]₃₀T) and GC-11 (5'-CTAGA[T]₃₀G) between the BamHI and XbaI sites to generate templates for the SLxA RNAs. For internally labeled RNAs, transcription was performed essentially as previously described (11) by using 1.5 pmol of DNA template linearized with either BamHI (SLx RNAs), XbaI (SLxA RNAs), or HindIII (SLxR RNAs), 25 µCi of [-³²P]CTP, and 20 U of T7 RNA polymerase (Promega) but with the inclusion of 0.18 U of pyrophosphatase (Sigma) to enhance yields. For 5'-labeled RNAs, the GTP concentration was reduced to 125 µM and 25 µCi of [-³²P]GTP was substituted for [-³²P]CTP. RNA structure mapping was performed by using 5' [-³²P]-labeled substrates as described previously (21, 22).

View larger version (15K): [in this window] [in a new window]   FIG. 1.   Schematic diagram of the structures of RNA substrates. (a) Three different classes of 3' extensions, denoted as SLx, where x is the number of base pairs in the stem-loop. The common 5' end of all substrates is 5' pppGGGAAUUCGAGCUCGGUAC. An imperfect inverted repeat in the SLxR RNAs (see the text) is shown by arrows. (b) Primary and predicted secondary structures of the four stem-loops examined in this work.

Exonuclease assays. RNase II (6) and PNPase (8) were purified to at least 90% homogeneity as described previously. Assays of RNase II were performed essentially as previously described (6) in a buffer containing 17 mM HEPES-KOH (pH 7.5), 100 mM KCl, 1 mM MgCl₂, 2 mM dithiothreitol, and 5% glycerol with 2 pmol of RNA and 0.1 ng of purified RNase II (0.4 milli-units; 1.4 fmol) in 25 µl at 37°C for the times noted in the figures. Assays of PNPase (0.2 ng [0.9 fmol]; 8 × 10⁶ U) were performed similarly in a buffer containing 20 mM Tris-HCl (pH 7.5), 20 mM KCl, 1 mM MgCl₂, and 1.5 mM dithiothreitol supplemented with 10 mM Na-phosphate (neutralized). In either case, aliquots were withdrawn at the appropriate times, quenched in 3 volumes of a buffer containing 90% deionized formamide, denatured by boiling, and separated on an 8% sequencing gel. Data were quantified by measuring the recoveries of substrate and partially digested (stalled) intermediates by using a phosphorimager.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

RNA substrates of defined structure. Figure 1 illustrates the structure of the RNA substrates used in this investigation. Three different classes of 3' extensions were created. The first, denoted SLx (where x denotes the number of base pairs in the stem-loop structure), contains a six-residue 3' extension, GGGAUC (Fig. 1a, top). The second, SLx-A, contains a 41-residue 3' extension, GGGAUCC[A]₃₀UCUAG (Fig. 1a, middle), which mimics a typical bacterial poly(A) tail. The third class of substrate, SLx-R, contains a 36-residue extension corresponding to the polylinker of the vector 3' to the BamHI site (5'-GGG AUCCUCUAGAGUCGACCUGCAGGCAUGCAAGCU). This extension is essentially random and duplicates the 3' extension of a model substrate, t40B, used previously (6). Four different stem-loop structures, shown in Fig. 1b, were combined with each class of extension. Each stem-loop contains a four-residue loop (a GNRA tetraloop in one case) and a stem of 5, 7, 9, or 11 G-C base pairs (Fig. 1b).

Exonuclease digestion of SLx and SLxA RNAs. RNAs in the SLx class mimic the products obtained after RNase E digestion of a typical mRNA substrate inasmuch as this endonuclease cleaves in single-stranded regions, often between stem-loop structures, thus leaving a short 3' extension beyond the base of the stem-loop (9, 14, 20). Each of the RNA substrates (the multiple bands are due to 3'-terminal heterogeneity) was digested with RNase II (Fig. 2a) or PNPase (Fig. 2b), and the fraction of full-length substrate or intermediate products remaining was measured (Table 1). The three most stable substrates, SL11, SL9, and SL7, are almost completely resistant to either RNase II or PNPase although the same dilution of either enzyme was fully active against other substrates (see below). In contrast, SL5 RNA does undergo limited digestion by PNPase (12% of the substrate disappears in 10 min) but not by RNase II (Fig. 2 and Table 1). The relative resistance of SL5 RNA could be overcome by increasing the amount of either exonuclease in the assay by 10-fold, with the result that 61 and 72% of the SL5 RNA was digested by RNase II and PNPase, respectively, after 10 min of digestion (data not shown). We presume that this reflects the ability of the added enzyme to "capture" RNAs which have spontaneously melted (see the Discussion).

View larger version (32K): [in this window] [in a new window]   FIG. 2.   Digestion of SLx RNAs with 3' exonucleases. Digestions were performed as described in Materials and Methods. Aliquots were removed at 0, 2.5, 5, and 10 min of digestion and denatured. RNAs were separated by electrophoresis under denaturing conditions, and the products were visualized by autoradiography or by phosphorimaging (see Materials and Methods). Shown are digestions with RNase II (a) and PNPase (b). Each panel is a separate gel. The schematic in the central margin illustrates the structure of the substrates.

View larger version (35K): [in this window] [in a new window]   FIG. 3.   Digestion of SLxA RNAs with 3' exonucleases. Digestions were performed as described in Materials and Methods. Aliquots were removed after 0, 2.5, 5, 7.5 (a only), and 10 min of digestion, denatured, and resolved as described in the legend to Fig. 2. Shown are digestions with RNase II (a) and PNPase (b). Brackets in the margins point to intermediates which accumulate during digestion (see the text). Each panel is a different gel; therefore, the relative mobilities of products cannot be compared directly between panels. Lanes with sequence ladders are not shown. The schematic diagrams in the margin denote the structures of the substrate and intermediates. Lane M, undigested SL11A RNA.

Exonuclease digestion of the SLxR series of substrates. Although we recognized that members of the SLxR series of substrates, designed as a control for the SLxA series, might prove problematic in view of their potential to engage in intra- and intermolecular base pairing through 5' extensions, we examined their susceptibility to digestion under conditions identical to those used above. SL5R RNA was relatively susceptible to both RNase II and PNPase. At least 35% of the substrate disappeared totally within 10 min, and most of the starting material was converted to shorter intermediates (see Fig. 4a, lanes 16 to 20, and Table 1). In contrast, although full-length SL11R RNA was digestible by either exonuclease, as a significant fraction of the initial substrate disappeared during the assay, it was converted to relatively stable shorter intermediate products, much like SL11A. A minor RNase II product from digestion of SL11R RNA (arrowhead in Fig. 4a) represents removal of about three or four residues from the extreme 3' end. This may represent stalling of RNase II 3' to an imperfect 7-bp stem-loop formed by pairing between the sequence 5'-CCUCUAG and 5'-CUGCAGG (G-U and C-C mismatches are underlined; see also Fig. 1b). A similar minor product was also observed with SL9R in other experiments (not visible in Fig. 4a, lanes 6 to 10). A further set of major products shown by brackets in Fig. 4a, lanes 1 to 5, represents stalling 3' to the 11-bp stem. In the assays of digestion by PNPase, small amounts of an intermediate shortened by just three or four residues, similar to that obtained with RNase II, appeared transiently (Fig. 4b, lanes 1 to 5) but did not accumulate. Rather, over 80% of the initial substrate was converted further to stable intermediates corresponding to stalling 8 to 11 residues 3' to the 11-bp stem-loop. Increasing the concentration of RNase II by up to 10-fold or that of PNPase by up to 5-fold enhanced the initial rate of shortening of SL11R RNA, as would be expected. Neither increase altered the extent of conversion of SL11R RNA to stalled intermediates or the size of the latter (data not shown). This differs from the response of SL5 RNA and presumably reflects the high stability of the stem-loop in SL11R. SL7R and SL9R RNAs exhibited behavior between that of SL5R and SL11R.

View larger version (32K): [in this window] [in a new window]   FIG. 4.   Digestion of SLxR RNAs with 3' exonucleases. Digestions were performed as described in Materials and Methods. Aliquots were removed at 0, 2.5, 5, 7.5, and 10 min of digestion, denatured, and resolved as described in the legend to Fig. 2. Shown are digestions with RNase II (a) and PNPase (b). Each panel is a separate gel. Lanes with sequence ladders are not shown. Brackets in the margins mark the positions of intermediates presumed to be the result of stalling of the enzyme. The arrowheads show the position of a transient intermediate (see the text). The schematic diagrams in the central margin denote the structures of the substrate and intermediates (see the text).

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Functional similarities between RNase II and PNPase. To our knowledge, this is the first systematic comparison of the properties of RNase II and PNPase in vitro, although we and other investigators have examined these enzymes' activities against a single or limited number of substrates (6-8, 17, 18, 24). We chose conditions in which each enzyme exhibited comparable exoribonuclease activity and in which the activity was limiting. To a large extent, the determinants of these enzymes' abilities to attack different substrates are quite similar. Neither enzyme is able to attack RNA stem-loops containing a 3'-terminal extension of six residues, in agreement with previous data in vitro (6) and in vivo (3, 28). However, comparably stable RNAs in the SLxA or SLxR class are readily shortened by both enzymes. The partial removal of the 3' extension on these substrates by both enzymes shows that there is no initial barrier to initiation of exonucleolytic attack; rather, the barrier to continued digestion is the internal stem-loop itself. These observations are best explained by a model in which either exonuclease requires a single-stranded RNA target larger than six residues for initial binding. PNPase is very inefficient against short oligomers (K_m values from 50 to 250 mM), but becomes highly efficient (K_m of 10 nM) for oligomers greater than 10 residues (16). Likewise, RNase II loses processivity on poly(A) containing fewer than 10 to 15 residues (4). Whether stalling (and subsequent dissociation) or complete digestion occurs will depend on the balance between the rate of enzyme dissociation and the rate of transient melting of weaker stem-loop barriers, such as in SL5A and SL7A. The ability of increased concentrations of RNase II or PNPase to overcome the resistance of SL5 to decay may simply reflect the greater likelihood of either enzyme binding to a partially or fully melted substrate molecule before the latter refolds ("substrate capture").

Is the behavior of the exoribonucleases in vitro consistent with mRNA decay in vivo? Apart from repetitive extragenic palindrome (REP) sequences and rho-independent terminators, perfectly matched stem-loops containing more than six contiguous base pairs ought to occur relatively infrequently in most mRNAs (frequency, <1 in 4,056 residues). Imperfect stem-loops would, of course, occur much more often. Moreover, all such structures would contain roughly equal frequencies of A-U and G-C base pairs, unlike the more stable model RNAs used here. Thus, it is unlikely that either exoribonuclease would encounter many highly stable, internal barriers in most mRNA fragments created by RNase E cleavage. Rather, new 3' ends will most often be generated in regions which are unstructured or contain weak stem-loops which are in rapid equilibrium with their alternatively folded or unfolded counterparts. The structure of such cleavage products would permit access by either exoribonuclease as long as more than 10 to 12 residues at their extremities were or could become single-stranded. An example of this situation occurs in the rpsT mRNA. A major RNase E cleavage site occurs five residues 3' to a moderately stable (G = 2.7 kCal/mol) stem-loop (stem-loop IV; see reference 20). This structure is not a barrier to RNase II or to PNPase in vitro or apparently in vivo (7, 19). To this extent, these two enzymes are functionally redundant. In those cases where a stable stem-loop does occur less than 10 to 12 residues 5' to an RNase E cleavage site, our data show that oligoadenylation can restore the accessibility of the cleavage product to both exoribonucleases (7, 8).