Previous Article | Next Article 
Journal of Bacteriology, May 2000, p. 2468-2475, Vol. 182, No. 9
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Regions of RNase E Important for 5'-End-Dependent
RNA Cleavage and Autoregulated Synthesis
Xunqing
Jiang,
Alexis
Diwa, and
Joel G.
Belasco*
Skirball Institute of Biomolecular Medicine
and Department of Microbiology, New York University School of
Medicine, New York, New York 10016
Received 17 December 1999/Accepted 18 February 2000
 |
ABSTRACT |
RNase E is an important regulatory enzyme that plays a key role in
RNA processing and degradation in Escherichia coli.
Internal cleavage by this endonuclease is accelerated by the presence
of a monophosphate at the RNA 5' end. Here we show that the preference of E. coli RNase E for 5'-monophosphorylated substrates is
an intrinsic property of the catalytically active amino-terminal half
of the enzyme and does not require the carboxy-terminal region. This
property is shared by the related E. coli ribonuclease CafA (RNase G) and by a cyanobacterial RNase E homolog derived from Synechocystis, indicating that the 5'-end dependence of
RNase E is a general characteristic of members of this ribonuclease family, including those from evolutionarily distant species. Although it is dispensable for 5'-end-dependent RNA cleavage, the
carboxy-terminal half of RNase E significantly enhances the ability of
this ribonuclease to autoregulate its synthesis in E. coli.
Despite similarities in amino acid sequence and substrate specificity,
CafA is unable to replace RNase E in sustaining E. coli
cell growth or in regulating RNase E production, even when overproduced
sixfold relative to wild-type RNase E levels.
 |
INTRODUCTION |
The degradation of mRNA serves as an
important genetic regulatory mechanism in all organisms. Within a
single cell, mRNA lifetimes can differ by as much as 2 orders of
magnitude. These differences directly affect both steady-state mRNA
concentrations and the speed with which gene expression can be induced
or repressed in response to environmental cues. Despite the importance
of mRNA turnover for gene regulation, comparatively little is yet
understood about the molecular mechanisms responsible for differences
in mRNA longevity.
In prokaryotic organisms, mRNA degradation is accomplished by a
combination of endonucleolytic cleavage and 3' exonucleolytic digestion. The degradation of most mRNAs in Escherichia coli
is thought to begin with internal cleavage by RNase E. This important endonuclease is essential for cell growth, and its inactivation has
been shown to prolong the lifetime of bulk mRNA and to impede the
processing and decay of a variety of individual transcripts (1, 2,
17, 20, 21, 27). RNase E is a large ribonuclease (1,061 amino
acid residues) that exists in E. coli as a component of the
RNA degradosome, a multienzyme RNA degradation complex that also
contains a 3' exoribonuclease (polynucleotide phosphorylase), an RNA
helicase (RhlB), a glycolytic enzyme (enolase), and possibly other
components (5, 18, 22). Previous studies have shown that the
amino-terminal half of RNase E (amino acid residues 1 to 498) contains
the active site for RNA cleavage and that this portion of the protein
is essential for cell growth (14, 15). The carboxy-terminal
half of RNase E (residues 499 to 1061) provides a scaffold for the
assembly of the other degradosome components and contains an
arginine-rich RNA-binding domain of unknown function (8, 14, 26,
28).
RNase E shows a preference for cleaving RNA within regions that are AU
rich and single stranded (10, 16). Equally important in
defining the substrate specificity of this endonuclease is its striking
5'-end dependence. In vitro experiments have shown that purified
E. coli RNase E prefers to cleave RNAs that are monophosphorylated, rather than triphosphorylated, at the 5' end (12). This property is somewhat surprising in view of the
fact that RNA cleavage by this endonuclease typically occurs at a
significant distance from the 5' terminus, and the preference suggests
that somewhere on RNase E there may be a site for recognizing and
binding monophosphorylated RNA 5' ends. Whether the ability to
recognize the 5' phosphorylation state of RNA is an intrinsic
characteristic of the catalytic amino-terminal half of RNase E or a
property conferred by the carboxy-terminal half of the protein is not
known. Nor is it clear whether this property is peculiar to the
E. coli enzyme or widely shared by homologous enzymes from
distantly related species. In principle, the 5'-end dependence of RNase
E would be expected to hasten further digestion of the
5'-monophosphorylated products of endonucleolytic cleavage, thereby
enhancing the processivity of mRNA decay.
Another important property of RNase E is its ability to autoregulate
its synthesis by controlling the degradation rate of its own mRNA
(rne mRNA), whose longevity in E. coli varies
inversely with cellular RNase E activity (6). Feedback
inhibition of rne gene expression is mediated in
cis by the rne 5' untranslated region, which can
confer this property onto heterologous reporter transcripts to which it
is fused. The short lifetime of rne mRNA in E. coli and the unusual sensitivity of rne expression to
cellular RNase E activity suggest that certain features of the 5'
untranslated region make the rne transcript particularly
vulnerable to cleavage by RNase E.
To learn more about the biochemical mechanisms underlying the
specificity of RNA cleavage by RNase E, we have begun to investigate the origin of its preference for 5'-monophosphorylated substrates and
of its ability to autoregulate its synthesis. Our data indicate that
the 5'-end dependence of RNase E maps to the amino-terminal half of the
enzyme and that this property is shared by other proteins with sequence
homology to this region of RNase E. Though dispensable for
5'-end-dependent cleavage, the carboxy-terminal half of the protein
plays a key role in the mechanism of feedback regulation of RNase E synthesis.
 |
MATERIALS AND METHODS |
Plasmids and strains.
The isogenic E. coli K-12
strains CJ1827 (rne+) and CJ1828
(ams-1) are MC1061 derivatives that each contain a
chromosomal copy of the rne-lacZ fusion ez1
(6). CJ1832 is another MC1061 derivative in which
transcription of the rne gene has been placed under the control of a lac promoter and operator; the construction of
this strain will be described elsewhere (C. Jain and J. G. Belasco, unpublished data). CJ1833 is identical to CJ1832 except that
it contains a wild-type rne gene on the chromosome. Strains
BL21(DE3) and BL21(DE3)-2 contain an
isopropyl-
-D-thiogalactopyranoside (IPTG)-inducible gene
encoding T7 RNA polymerase (11).
Plasmid pT7-R25, which was used as a template for the in vitro
synthesis of RNA I.26, has previously been described (3). Plasmid pRNE1000 is a derivative of cloning vector pMPM-K1
(Kmr) (13) that directs the constitutive
synthesis of a full-length amino-terminally tagged form of E. coli RNase E at a cellular concentration similar to that of
wild-type RNase E encoded by the chromosomal rne gene. The
31 amino acids inserted after the N-terminal methionine residue
(EKKAAAHHHHHHVAAEQKLISEEDLNGAARS) include a hexahistidine affinity tag
and a c-Myc epitope tag. Transcription is driven by a modified
IS10 promoter containing an up mutation in the
35
region (TGGATA
TTGATA). A T7 phage promoter
lies upstream of the IS10 promoter. Plasmid
pNRNE1000 encodes a tagged, truncated form of RNase E lacking
the C-terminal 563 residues (N-RNase E). It was constructed by cleaving
pRNE1000 with AflII, filling in the ends, and inserting a
linker with stop codons in all three reading frames
(CTAGTCTAGACTAG). Plasmid pCAFA1000 encodes an
amino-terminally tagged form of E. coli CafA. It was constructed by replacing the pRNE1000 segment that encodes residues 2 to 1061 of RNase E with a DNA fragment that encodes all 495 residues of
CafA. Plasmid pSYNRNE1000 encodes an amino-terminally tagged form
of the RNase E homolog of Synechocystis sp. strain PCC
6803 (GenBank accession no. D90899). The plasmid was constructed by
replacing the pRNE1000 segment that encodes residues 2 to 1061 of
RNase E with a DNA fragment that encodes all 674 residues of Synechocystis RNase E (SynRne). Plasmids pRNE2000 and
pNRNE2000 are identical to pRNE1000 and pNRNE1000, respectively, except that ribonuclease synthesis is enhanced by an IS10 promoter
mutation in the
10 region (TCAAAT
TAAAAT) instead of
the
35 region. Plasmids pCAFA3000 and pSYNRNE3000 are identical
to pCAFA1000 and pSYNRNE1000, except that protein synthesis is
maximized by the presence of both the
10 and
35 promoter mutations.
The fidelity of each plasmid construction was verified by restriction
analysis and DNA sequencing.
Protein purification.
Purified Xrn1p was kindly provided by
Arlen Johnson (University of Texas, Austin). Amino-terminally tagged
forms of N-RNase E, CafA, and SynRne were produced by induction of T7
RNA polymerase in E. coli strain BL21(DE3) or BL21(DE3)-2
containing pNRNE1000, pCAFA1000, or pSYNRNE1000, respectively. Two to
3 h after adding IPTG (1 mM) to a log-phase culture
(A600 = 0.5) grown in Luria-Bertani (LB)
medium, the cells were pelleted, resuspended in buffer A (10 mM Tris-Cl
[pH 7.5], 1 mM EDTA, 0.1 mM dithiothreitol, 0.1 mM
phenylmethylsulfonyl fluoride, 5% glycerol, 0.5% Genapol X-080), and
lysed with a French press. The lysates were cleared by centrifugation (6,000 × g for 20 min), and N-RNase E, CafA, and SynRne
were purified from each of the resulting supernatants by affinity
chromatography on a Ni-nitrilotriacetate column (Qiagen) eluted with an
imidazole gradient (10 to 400 mM in buffer A). Peak fractions were
pooled and further purified to near homogeneity by anion-exchange
chromatography on an UNO-Q column (Bio-Rad) eluted with a salt gradient
(50 to 600 mM NaCl in buffer A). The peak fractions were pooled and
dialyzed overnight against buffer A, and the purified proteins were
stored at
80°C. Protein samples were diluted just before their use
in cleavage assays.
RNA synthesis, analysis, and cleavage.
Internally
radiolabeled RNA was synthesized by in vitro transcription with T7 RNA
polymerase. The reaction mixture (20 µl) contained Tris Cl (40 mM, pH
7.9), MgCl2 (6 mM), NaCl (10 mM), dithiothreitol (7.5 mM),
spermidine (2 mM), GTP (0.25 mM), CTP (0.25 mM), UTP (0.25 mM),
ATP (0.025 mM), [
-32P]ATP (30 µCi), GMP (0 or 15 mM), RNasin (20 U; Promega), plasmid pT7-R25 linearized by
HindIII cleavage (0.2 µg), and T7 RNA polymerase (40 U). After incubation for 16 h at 37°C, the reaction mixture was
diluted with water (30 µl) and the RNA was isolated by gel filtration
on Sephadex G-50 and stored at
20°C. Capped RNA was synthesized
under identical conditions, except that the cap analog m7G(5')ppp(5')G (2 mM) was used in place of GMP.
The suitability of these reaction conditions for synthesizing
5'-monophosphorylated or -capped RNA was confirmed in experiments
involving the synthesis of RNA that was internally labeled with
a
fluorescent nucleotide analog and 5' end labeled with
[

-
32P]GTP. Fluorescent RNA radiolabeled at the 5'
terminus was synthesized
in a reaction mixture (20 µl) that contained
Tris Cl (40 mM, pH
7.9), MgCl
2 (6 mM), NaCl (10 mM),
dithiothreitol (7.5 mM), spermidine
(2 mM), GTP (0.25 mM), CTP (0.25 mM), UTP (0.075 mM), ATP (0.025
mM), fluorescein-12-UTP (0.25 mM),
[

-
32P]GTP (30 µCi), GMP (0, 5, or 15 mM), RNasin (20 U; Promega),
plasmid pT7-R25 linearized by
HindIII
cleavage (0.2 µg), and T7
RNA polymerase (40 U). After incubation for
16 h at 37°C, the
reaction mixture was diluted with water (30 µl) and the RNA was
isolated by gel filtration on Sephadex G-50. RNA
samples synthesized
at various GMP/GTP ratios were subjected to
electrophoresis on
an 8% polyacrylamide gel containing 7 M urea and
analyzed for
radioactivity and fluorescence with a Molecular Dynamics
Storm
820 PhosphorImager and a Molecular Dynamics 575 FluorImager,
respectively.
The relative radioactivity of the samples (
C)
was 1 (GMP/GTP ratio
= 0:1), 0.339 (GMP/GTP ratio = 20:1), or
0.095 (GMP/GTP ratio
= 60:1). The relative fluorescence of the
samples (
F) was 1 (GMP/GTP
ratio = 0:1), 1.71 (GMP/GTP
ratio = 20:1), or 1.04 (GMP/GTP ratio
= 60:1). From these
values, the percentage of 5'-monophosphorylated
RNA (1
C/F) was calculated to be 0% (GMP/GTP ratio = 0:1),
80%
(GMP/GTP ratio = 20:1), or 91% (GMP/GTP ratio = 60:1).
Similar
experiments with fluorescently labeled RNA indicated that the
reaction conditions used for capped RNA synthesis [2 mM
m
7G(5')ppp(5')G instead of GMP] yielded products that were
more
than 90%
capped.
RNA cleavage with N-RNase E, CafA, SynRne, or Xrn1p was carried out at
30°C with a reaction mixture (35 µl) containing Tris
Cl (25 mM, pH
7.5), MgCl
2 (10 mM), KCl (60 mM), NH
4Cl (100 mM),
dithiothreitol (0.1 mM), glycerol (5% [vol/vol]), RNA I.26 (3
pmol [50 pmol in assays of SynRne]), and ribonuclease (0.14 pmol
of
N-RNase E, 0.14 pmol of CafA, 3.4 pmol of SynRne, or 0.25 pmol
of
Xrn1p). Reaction samples (5 µl) were removed at different time
intervals and quenched by the addition of 15 µl of loading buffer
(22 mM Tris borate [pH 7.5], 4 mM EDTA, 90% formamide, 0.1% xylene
cyanol, 0.1% bromophenol blue). After denaturation at 95°C for
5 min, the samples were subjected to electrophoresis on an 8%
polyacrylamide gel containing 7 M urea. Radioactive gel bands
were
visualized and quantitated on a Molecular Dynamics Storm
820
PhosphorImager.
Complementation and rne-lacZ repression in E. coli.
The ability of various proteins to compensate for the
absence of wild-type RNase E production in E. coli was
assessed by introducing plasmids that encode these proteins into
CJ1832, an E. coli strain in which transcription of the
chromosomal RNase E gene is IPTG dependent. After several generations
of growth in the presence of IPTG (1 mM), the cells were plated on LB
agar lacking IPTG so that their ability to grow into colonies in the
absence of RNase E could be judged. Expression of the
rne-lacZ reporter ez1 in the
lac
host strains CJ1827 and CJ1828 was measured by performing
-galactosidase assays on extracts prepared from log-phase cultures grown at 37°C in LB medium, as previously described (6).
The relative concentrations of plasmid-encoded RNase E, N-RNase E,
CafA, and SynRne in CJ1828 cells containing pRNE1000, pRNE2000,
pNRNE1000, pNRNE2000, pCAFA3000, or pSYNRNE3000 were determined
by
immunoblot analysis with monoclonal anti-Myc antibodies (Zymed).
The
relative concentration of plasmid-encoded RNase E in CJ1832
cells
containing pRNE1000 or pRNE2000 was compared to the concentration
of
chromosomally encoded wild-type RNase E in isogenic CJ1833
cells by
immunoblot analysis with polyclonal anti-RNase E antibodies.
In each
case, cultures were grown to log phase at 37°C in LB medium
lacking
IPTG, and cell extracts were prepared by heating culture
samples to
100°C for 7 min in loading buffer (62 mM Tris Cl [pH
6.8], 2%
sodium dodecyl sulfate [SDS], 10% glycerol, 0.001% bromophenol
blue). After assaying for total cellular protein (
24), equal
amounts of each sample (10 µg) were fractionated by electrophoresis
on an SDS-6% polyacrylamide gel and blotted onto a Hybond-P
polyvinylidene
difluoride membrane (Amersham). Gel bands were
visualized and
quantitated with anti-Myc or anti-RNase E antibodies, a
Vistra-enhanced
chemifluorescence kit (Amersham), and a Molecular
Dynamics 575
FluorImager.
 |
RESULTS |
5'-end-dependent cleavage of RNA by the amino-terminal half of
E. coli RNase E.
To begin to elucidate the molecular
mechanism underlying the 5'-end dependence of RNase E, we decided to
investigate whether the ability of this enzyme to distinguish the 5'
phosphorylation state of its substrates is an intrinsic characteristic
of the catalytically active N-terminal half of the protein or whether the observed substrate preference also requires the C-terminal region,
which contains an arginine-rich RNA-binding domain of unknown function.
For this purpose, we overproduced and purified a truncated form of
RNase E (N-RNase E) comprising the N-terminal 498 residues of the
enzyme preceded by a hexahistidine affinity tag and a c-Myc epitope
tag. As a model substrate, we chose a derivative of RNA I, an
untranslated regulatory RNA that controls the replication of ColE1-type
plasmids such as pBR322. In E. coli and in vitro, RNase E
cleaves RNA I at an internal site 5 nucleotides from the 5' end. RNA
I.26 is an extended version of RNA I that carries 22 additional
nucleotides at the 5' end and up to 55 additional nucleotides at the 3'
end (Fig. 1). Except for one extra
5'-terminal nucleotide and some heterogeneity at the 3' end (see
below), RNA I.26 closely resembles another RNA I derivative (RNA I.25)
previously shown to be cleaved by RNase E in E. coli at the
same site and at the same rate as wild-type RNA I (3). RNA
I.26 was synthesized in vitro by transcription of a DNA template with
T7 RNA polymerase. Two RNA products were obtained, a long runoff
transcript ending at the terminus of the DNA template (RNA I.26-L) and
a shorter transcript ending at a natural termination site near the 3'
end of wild-type RNA I (RNA I.26-S) (Fig. 1).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 1.
RNA I.26. The sequence and secondary structure of RNA
I.26 are shown, except for 47 nucleotides
(AAGCAGCAGAUUACGGGGGAUCCUCUAGAGUCGACCUGCAGGCAUGC) near the
3' terminus. The secondary structure of RNA I.26 and that of the
closely related transcript RNA I were determined previously by chemical
alkylation and ribonuclease sensitivity (3, 19, 25). The
primary site of RNase E cleavage is marked. Synthesis of RNA I.26 by in
vitro transcription with T7 RNA polymerase generates two RNA products,
the long runoff transcript (RNA I.26-L) shown (L) and a shorter
transcript (RNA I.26-S) whose approximate 3' end is indicated (S). nt,
nucleotides.
|
|
To assess whether cleavage by the N-terminal half of RNase E is 5' end
dependent, it was necessary to compare the cleavage
rates of RNAs that
differed only in their 5' phosphorylation state,
one beginning with a
5'-terminal triphosphate and the other with
a 5'-terminal
monophosphate. Due to the lack of a convenient existing
procedure for
synthesizing 5'-monophosphorylated RNAs, we developed
a new method for
this purpose. As usual, the triphosphorylated
substrate (pppRNA I.26)
was prepared by in vitro transcription
in the presence of all four
nucleoside triphosphates, whereas
the reaction mixture for the in vitro
synthesis of the monophosphorylated
substrate (pRNA I.26) contained in
addition a large excess of
GMP (GMP/GTP = 60) for incorporation at
the RNA 5' end. Two experiments
were performed to compare the
phosphorylation state of the 5'
ends of pppRNA I.26 and pRNA I.26.
First, when these two RNAs
were synthesized from a nucleotide mixture
containing [

-
32P]GTP and fluorescein-labeled UTP, the
ratio of radioactivity
to fluorescence in the RNA products indicated
~91% monophosphorylation
of the pRNA I.26 sample (see Materials and
Methods). In a second
experiment, the monophosphorylated and
triphosphorylated substrates
were internally radiolabeled by synthesis
in the presence of [

-
32P]ATP and then treated with the
yeast 5' exonuclease Xrn1p (Fig.
2),
which preferentially degrades RNAs beginning with a 5' monophosphate
rather than a 5' triphosphate (
23). Digestion of pRNA I.26
with
this exonuclease proceeded more than 100 times faster than
digestion
of pppRNA I.26. Together, these analyses indicate that
monophosphorylated
RNAs can readily be synthesized by in vitro
transcription in the
presence of excess GMP.

View larger version (88K):
[in this window]
[in a new window]
|
FIG. 2.
Digestion of pppRNA I.26 and pRNA I.26 by Xrn1p.
Internally radiolabeled pppRNA I.26 and pRNA I.26 (3 pmol) were treated
with equal amounts of purified Xrn1p (0.25 pmol). Reaction samples were
quenched at time intervals with EDTA and analyzed by electrophoresis on
a denaturing polyacrylamide gel. Bands corresponding to the long (L)
and short (S) forms of RNA I.26 are marked.
|
|
Like Xrn1p, the N-terminal half of RNase E showed a marked preference
for the monophosphorylated substrate. Endonucleolytic
cleavage of
internally radiolabeled pRNA I.26 by N-RNase E was
25- to 30-fold
faster than cleavage of pppRNA I.26 (Fig.
3), a
rate acceleration comparable in
magnitude to that observed for
RNA cleavage by the full-length enzyme
(
12). A similar differential
rate of cleavage by N-RNase E
was observed in an internally controlled
experiment in which the
monophosphorylated and triphosphorylated
substrates were combined in a
2:1 ratio; digestion of this RNA
mixture was biphasic, with ~65% of
the substrate cleaved rapidly
and ~35% cleaved slowly (data not
shown). In each case, initial
cleavage of RNA I.26 occurred at a site
~27 nucleotides from the
5' end, corresponding to the site where
RNase E cleaves wild-type
RNA I and RNA I.25 in
E. coli
(Fig.
1) (
3). Prolonged treatment
with N-RNase E resulted in
further cleavage at secondary sites.
No cleavage was observed when
N-RNase E was omitted from the reaction
mixture (data not shown). These
findings indicate that the 5'-end
dependence of RNA cleavage by RNase E
is a property of the amino-terminal
half of this endonuclease.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 3.
Digestion of pppRNA I.26, pRNA I.26, and capped RNA I.26
by N-RNase E. Internally radiolabeled pppRNA I.26, pRNA I.26, and
m7G(5')ppp(5')G-capped RNA I.26 (3 pmol) were treated with
equal amounts of purified N-RNase E (0.14 pmol). Reaction samples were
quenched at different time intervals with EDTA and analyzed by
electrophoresis on a denaturing polyacrylamide gel. Bands corresponding
to the long (L) and short (S) forms of RNA I.26 are marked, as are
their respective primary cleavage products (CL and
CS) lacking an ~27-nucleotide 5'-terminal fragment.
Beneath the autoradiogram is a semilogarithmic plot of intact RNA
remaining (RNA I.26-L plus RNA I.26-S) versus time for each of the
three substrates. Best-fit lines were calculated by linear regression
analysis. The relative cleavage rate of the three RNA substrates was
27:1:2 (monophosphorylated:triphosphorylated:capped).
|
|
The simplest explanation for the preferential cleavage of
monophosphorylated RNAs by N-RNase E is that this portion of the
enzyme
may contain a binding site for monophosphorylated RNA 5'
termini. This
5'-end binding site might be entirely distinct from
the active site
that catalyzes internal RNA cleavage. Thus, the
overall cleavage rate
of an RNA may reflect the combined affinity
of its 5' end and its
internal cleavage site(s) for the enzyme.
In principle, the slow
cleavage of triphosphorylated RNAs could
result either from weaker
binding of their 5' termini to the same
enzyme pocket that binds
monophosphorylated 5' ends or from a
failure of their 5' termini to
bind at all to RNase E. To distinguish
these possibilities, we compared
the cleavage rate of pppRNA I.26
with that of a 5'-capped form of RNA
I.26. The m
7G(5')ppp(5')G cap structure characteristic of
eukaryotic mRNAs
comprises an inverted nucleotide joined to the RNA 5'
end via
a 5'-5' phosphoanhydride linkage. A cap would be expected to
render
the 5' terminus unrecognizable to proteins of bacterial origin
by masking it with a structure that, in effect, resembles a second
3'-terminal nucleotide. Nonetheless, capped RNA I.26 was cleaved
by
N-RNase E at a rate no slower than that of pppRNA I.26 (Fig.
3). We
conclude that RNase E is able to cleave substrates that
lack a
recognizable 5' end and that the low rate of cleavage of
pppRNA I.26
does not contain any detectable kinetic component
that could be
attributed to recognition of its triphosphorylated
5' terminus by the
enzyme.
RNA cleavage by Synechocystis RNase E and E. coli CafA.
Sequence homologs of E. coli RNase E
are found in a variety of prokaryotic organisms (7).
Typically, the strongest homology is to the amino-terminal region of
the E. coli protein (amino acid residues 1 to 413). For
example, the cyanobacterium Synechocystis sp. strain PCC
6803 produces a protein (GenBank accession no. D90899) whose N-terminal
region (residues 1 to 406) is 35% identical to the corresponding
portion of E. coli RNase E, and E. coli itself
contains a second protein, CafA, whose N-terminal region (residues 1 to
420) shares 36% identity with the amino-terminal portion of RNase E. Purified Synechocystis RNase E (SynRne) has been shown to
possess endoribonuclease activity and to cleave 9S RNA and RNA I in
vitro at sites similar to those cleaved by E. coli RNase E
(7). Likewise, recent studies with E. coli have
indicated that disruption of the cafA gene affects 16S rRNA processing, suggesting that this protein too has ribonuclease activity
and prompting proposals that it be renamed RNase G (9, 30).
The sequence similarity of SynRne and CafA to the amino-terminal half
of RNase E raised the possibility that endonucleolytic
cleavage by
these RNase E homologs might be 5' end dependent.
To address this
question, each of these proteins was overproduced
in
E. coli
and purified (Fig.
4A) so that the rate
at which it
cleaved monophosphorylated versus triphosphorylated RNA
I.26 could
be compared. Both SynRne and CafA cleaved RNA I.26 at or
near
the previously defined RNase E cleavage site (Fig.
4B),
demonstrating
that purified CafA indeed has endonuclease activity and
validating
the designation of this protein as a ribonuclease (RNase G).
Moreover,
like
E. coli RNase E, SynRne and CafA both showed
a marked preference
for the monophosphorylated substrate (Fig.
4C and
D), cleaving
it 5 to 6 times (SynRne) to more than 25 times (CafA)
faster than
they cleaved triphosphorylated RNA I.26. These data suggest
that
the 5'-end dependence of RNase E is a property that is
evolutionarily
well conserved among RNase E homologs, including those
of distantly
related species.

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 4.
Digestion of pppRNA I.26 and pRNA I.26 by CafA and
SynRne. (A) Purified N-RNase E, CafA, and SynRne were examined by
SDS-polyacrylamide gel electrophoresis beside a set of protein
molecular weight standards (lane MW). The gel was stained with
Coomassie blue. Calibration is in kilodaltons. The calculated sizes of
these amino-terminally tagged proteins are 57.3 kDa for N-RNase E, 58.9 kDa for CafA, and 78.5 kDa for SynRne. The electrophoretic mobility of
SynRne is known to be anomalously slow (7). (B) The primary
cleavage products (CL and CS) generated by
treating pRNA I.26 with full-length RNase E, N-RNase E, CafA, or SynRne
were compared by electrophoresis on a denaturing polyacrylamide gel
beside uncut pRNA I.26 (L and S). (C) Internally radiolabeled pppRNA
I.26 and pRNA I.26 (50 pmol) were treated with purified SynRne (3.4 pmol). Reaction samples were quenched at different time intervals with
EDTA and analyzed by electrophoresis on a denaturing polyacrylamide
gel. Bands corresponding to the long (L) and short (S) forms of RNA
I.26 are marked, as are their respective primary cleavage products
(CL and CS) lacking a 5'-terminal fragment.
Beneath the autoradiogram is a semilogarithmic plot of intact RNA
remaining (RNA I.26-L plus RNA I.26-S) versus time for each of the two
substrates. (D) Internally radiolabeled pppRNA I.26 and pRNA I.26 (3 pmol) were treated with purified CafA (0.14 pmol), and reaction samples
were quenched at time intervals and analyzed as described for panel C. Beneath the autoradiogram is a semilogarithmic plot of intact RNA
remaining (RNA I.26-L plus RNA I.26-S) versus time.
|
|
Complementation of RNase E deficiency and feedback regulation of
RNase E synthesis.
In view of the these findings, we decided to
investigate whether the amino-terminal half of E. coli RNase
E is alone sufficient to mediate other important properties of the
enzyme and whether SynRne and CafA share these properties. First, we
examined whether N-RNase E is as effective as the full-length protein
in supporting E. coli cell growth when present at a
comparable cellular concentration. For this purpose, we made use of an
E. coli strain (CJ1832) bearing a repressible RNase E
(rne) gene. Normally, this strain is entirely dependent on
IPTG for RNase E production and cell growth because expression of the
endogenous rne gene has been placed under the control of a
lac promoter. In the absence of IPTG, growth of CJ1832 can
be rescued by introducing a plasmid (pRNE1000) from which full-length
E. coli RNase E is expressed at wild-type levels in an
epitope-tagged form. Unlike the full-length protein, epitope-tagged N-RNase E fails to restore growth when produced at up to three times
the concentration of wild-type RNase E (pNRNE1000) but does restore
cell growth when expressed at eight times wild-type RNase E levels (pNRNE2000).
The inability of
cafA+ E. coli cells such as
CJ1832 to grow in the absence of RNase E does not resolve whether CafA
is capable
of replacing RNase E in sustaining cell growth. This
uncertainty
results from a lack of information as to the cellular
concentration
of CafA, which makes it impossible to know whether the
growth
defect in the absence of RNase E is due to an inability of CafA
to substitute functionally for RNase E or merely due to an inadequate
supply of CafA. This is an important distinction in view of the
failure
of wild-type RNase E itself to sustain cell growth when
produced in
CJ1832 at less than 10% of its normal cellular concentration
(C. Jain
and J. Belasco, unpublished
data).
To determine whether CafA and SynRne can functionally substitute for
RNase E when present at a comparable concentration, plasmids
encoding
epitope-tagged forms of these proteins were tested for
their ability to
restore growth of CJ1832 in the absence of IPTG.
Whereas SynRne
sustains cell growth when expressed at the same
concentration as
wild-type RNase E (pSYNRNE3000), CafA cannot
replace
E. coli
RNase E in supporting cell growth even when overproduced
approximately
sixfold relative to wild-type RNase E levels (pCAFA3000).
It is not
likely that the inviability of CJ1832 cells containing
plasmid
pCAFA3000 results from any hypothetical lethal effect
of CafA at these
levels, as the same cells grow normally when
RNase E production is
induced with
IPTG.
Another important property of
E. coli RNase E is its ability
to autoregulate its synthesis by a feedback repression mechanism
that
controls the degradation rate of its own mRNA and of heterologous
reporter transcripts to which the
rne 5' untranslated region
has
been fused (
6). For example,

-galactosidase
production from
the
rne-lacZ gene fusion
ez1 is
very sensitive to the level of
RNase E activity in
E. coli.
To determine whether the amino-terminal
half of RNase E is alone
sufficient to mediate feedback regulation
and whether SynRne and CafA
share this ability to control expression
of the
E. coli rne
gene, we introduced plasmids encoding epitope-tagged
forms of
E. coli RNase E, N-RNase E, SynRne, or CafA into an
E. coli strain (CJ1828) bearing an
ez1 reporter and a
mutant
rne allele (
ams-1) on its chromosome. The
ams-1 allele encodes a mutated
form of RNase E that supports
growth at 37°C but that is severely
impaired in its ability to
repress
ez1 gene expression (
6).

-Galactosidase assays were then performed on cell extracts to
measure the reduction in
ez1 expression that results from
introducing
each plasmid and its encoded ribonuclease into CJ1828. From
these
repression ratios and the relative cellular concentration of the
plasmid-encoded ribonucleases (as determined by immunoblot analysis),
we calculated a parameter that is a measure of each protein's
regulatory activity (Table
1). Whereas
full-length RNase E was
very effective at reducing expression of the
rne-lacZ reporter,
the truncation variant N-RNase E was only
~3% as potent, and SynRne
and CafA exhibited little, if any,
repressing activity. These
findings indicate that the C-terminal half
of RNase E is very
important for efficient feedback regulation of
rne gene expression.
Consequently, the ineffectiveness of
SynRne and CafA at regulating
rne-lacZ expression may be
due, at least in part, to their lack
of a region homologous to this
portion of RNase E.
 |
DISCUSSION |
RNase E plays a key role in RNA processing and degradation in
E. coli. Internal cleavage by this endonuclease is
facilitated by the presence of a monophosphate group at the RNA 5' end
(12). Our data indicate that the preference of E. coli RNase E for 5' monophosphorylated substrates is a property
determined by the evolutionarily conserved amino-terminal half of the
enzyme (residues 1 to 498). In contrast, the C-terminal half of RNase E
(residues 499 to 1061), which is poorly conserved, is dispensable for
5'-end-dependent cleavage despite the presence there of an
arginine-rich RNA- binding domain. Apparently, this arginine-rich
domain is not required for 5'-end recognition. Though not involved in
5'-end-dependent RNA cleavage, the carboxy-terminal half of RNase E is
crucial for efficient feedback regulation of RNase E synthesis.
Our studies of E. coli CafA (RNase G) and the cyanobacterial
RNase E homolog SynRne show that the 5'-end dependence of E. coli RNase E is shared by other members of this ribonuclease
family, including those from evolutionarily distant species. We
conclude that the preference of RNase E and its homologs for substrates bearing a 5' monophosphate is determined by conserved features of the
N-terminal region of each enzyme, some of which presumably form a
pocket for binding monophosphorylated RNA 5' ends. Among the three
proteins examined in this study, the regions of greatest sequence
homology correspond to residues 40 to 68, 90 to 131, 165 to 170, 287 to
350, and 382 to 413 of E. coli RNase E and include a
putative RNA-binding domain related in sequence to a domain present in
ribosomal protein S1 and several other proteins that bind RNA
(4).
Although it prefers monophosphorylated substrates, E. coli
RNase E is nonetheless capable of slowly cleaving RNAs that bear a 5'
triphosphate. The ability of RNase E to cut triphosphorylated RNAs does
not seem to involve recognition of the 5' terminus, as a capped RNA
lacking a recognizable 5' end is cleaved at the same rate. Thus, the
rate of endonucleolytic cleavage by RNase E appears to have two
components: (i) a 5'-end-independent basal rate that presumably
reflects the intrinsic susceptibility of an internal RNA site to
binding and cleavage at the enzyme active site and (ii) a rate
acceleration that can result from the presence of a monophosphate at
the 5' end.
Though not essential for viability, the C-terminal half of RNase E
markedly enhances the ability of the enzyme to autoregulate its
synthesis and to perform other functions important for cell growth. As
a consequence, N-RNase E is only 3% as effective as the full-length
protein at repressing expression of an rne-lacZ reporter and
must be produced at higher levels to sustain growth. Despite its
importance for efficient feedback regulation, the C-terminal half of
RNase E is not capable of carrying out this function on its own, as
missense mutations or deletions within the amino-terminal half of the
protein can abolish the ability of RNase E to repress
rne-lacZ expression (6). Together, these findings
indicate that the RNA cleavage activity of RNase E is not alone
sufficient for efficient feedback regulation, which also depends upon
the participation of the C-terminal half of the protein. The mechanism
by which the C-terminal half of RNase E contributes to autoregulation
and cell growth is not known, but other studies have indicated that
this portion of the enzyme contains an arginine-rich RNA-binding domain
and serves as a scaffold for the assembly of the other degradosome
components (8, 14, 28). In principle, either of these
features might enhance the efficiency of mRNA degradation in E. coli, which on average is half as fast in cells that produce only
a truncated form of RNase E lacking the C-terminal region
(11).
The reduced autoregulatory efficiency of N-RNase E may explain a
previous report that an E. coli strain with a nonsense
mutation at codon 593 of the chromosomal rne gene is viable
despite the loss of the C-terminal half of RNase E (8). Most
likely, the truncated form of RNase E encoded by this strain has a
diminished capacity to effect feedback regulation and therefore is
overproduced, compensating for the impediment to growth that would
otherwise be expected. Likewise, our earlier overestimate of the
activity of the amino-terminal half of RNase E (residues 1 to 498) in
rne-lacZ repression (6) was probably a result of
the overproduction of the protein, which would have partially masked
its attenuated efficacy.
Like E. coli RNase E, the sequence homolog CafA cleaves RNA
in a 5'-end-dependent fashion, and both enzymes cut RNA I.26 at approximately the same place. These findings raise the possibility that
RNase E and CafA might be functionally redundant in E. coli. However, our data show that, despite its similarity to RNase E, CafA is
unable to replace RNase E in sustaining cell growth or in regulating
rne gene expression, even when overproduced sixfold relative
to wild-type RNase E levels. Taken together, these findings are
consistent with the idea that CafA and RNase E have distinct, if
somewhat overlapping, roles in E. coli. Consonant with this notion is the previous observation that CafA and RNase E catalyze different steps in the maturation of 16S ribosomal RNA in E. coli, yet each is capable of substituting for the other in this
process, albeit with reduced efficiency and slightly altered
cleavage-site specificity (9, 30). Further investigation
will be needed to learn the full extent of CafA function in E. coli.
The preference of RNase E and its homologs for 5'-monophosphorylated
substrates may have important biological consequences. For example,
this property would be expected to increase the processivity of mRNA
degradation by accelerating further digestion of 5'-monophosphorylated intermediates produced by endonucleolytic cleavage of triphosphorylated primary transcripts. Such processivity may be important for minimizing the production of aberrant protein products from partially degraded mRNAs, and it would help to explain the frequent failure of degradation intermediates to accumulate significantly during mRNA decay
(29). The effect of 5' phosphorylation on RNA cleavage by
members of this ribonuclease family may also be important for ordering
the sequence of processing events during RNA maturation, e.g., by delaying RNase E or CafA cleavage until after cleavage by another endonuclease has occurred. Additional study should reveal more fully
the mechanism and consequences of the 5'-end dependence of RNase E and
its homologs.
 |
ACKNOWLEDGMENTS |
We thank Arlen Johnson for supplying purified Xrn1p, Li-How Chen
and Ibuki Kimura for anti-RNase E antibodies, Masaaki Wachi for a
plasmid clone of the cafA gene, Vladimir Kaberdin and
Alexander von Gabain for clones of the SynRne gene, Chaitanya Jain for
E. coli strains CJ1827, CJ1828, CJ1832, and CJ1833, and Marc
Dreyfus for E. coli strain BL21(DE3)-2.
This research was supported by a grant to J.G.B. from the National
Institutes of Health (GM35769).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Skirball
Institute of Biomolecular Medicine, New York University School of
Medicine, 540 First Avenue, New York, NY 10016. Phone: (212) 263-5409. Fax: (212) 263-8951. E-mail:
belasco{at}saturn.med.nyu.edu.
 |
REFERENCES |
| 1.
|
Apirion, D.
1978.
Isolation, genetic mapping, and some characterization of a mutation in Escherichia coli that affects the processing of ribonucleic acids.
Genetics
90:659-671[Abstract/Free Full Text].
|
| 2.
|
Babitzke, P., and S. R. Kushner.
1991.
The Ams (altered mRNA stability) protein and ribonuclease E are encoded by the same structural gene of Escherichia coli.
Proc. Natl. Acad. Sci. USA
88:1-5[Abstract/Free Full Text].
|
| 3.
|
Bouvet, P., and J. G. Belasco.
1992.
Control of RNase E-mediated RNA degradation by 5'-terminal base pairing in E. coli.
Nature
360:488-491[CrossRef][Medline].
|
| 4.
|
Bycroft, M.,
T. J. Hubbard,
M. Proctor,
S. M. Freund, and A. G. Murzin.
1997.
The solution structure of the S1 RNA binding domain: a member of an ancient nucleic acid-binding fold.
Cell
88:235-242[CrossRef][Medline].
|
| 5.
|
Carpousis, A. J.,
G. Van Houwe,
C. Ehretsmann, and H. M. Krisch.
1994.
Co-purification of E. coli RNase E and PNPase: evidence for a specific association between two enzymes important in RNA processing and degradation.
Cell
76:889-900[CrossRef][Medline].
|
| 6.
|
Jain, C., and J. G. Belasco.
1995.
RNase E autoregulates its synthesis by controlling the degradation rate of its own mRNA in Escherichia coli: unusual sensitivity of the rne transcript to RNase E activity.
Genes Dev.
9:84-96[Abstract/Free Full Text].
|
| 7.
|
Kaberdin, V. R.,
A. Miczak,
J. S. Jakobsen,
S. Lin-Chao,
K. J. McDowall, and A. von Gabain.
1998.
The endoribonucleolytic N-terminal half of Escherichia coli RNase E is evolutionarily conserved in Synechocystis sp. and other bacteria but not the C-terminal half, which is sufficient for degradosome assembly.
Proc. Natl. Acad. Sci. USA
95:11637-11642[Abstract/Free Full Text].
|
| 8.
|
Kido, M.,
K. Yamanaka,
T. Mitani,
H. Niki,
T. Ogura, and S. Hiraga.
1996.
RNase E polypeptides lacking a carboxyl-terminal half suppress a mukB mutation in Escherichia coli.
J. Bacteriol.
178:3917-3925[Abstract/Free Full Text].
|
| 9.
|
Li, Z.,
S. Pandit, and M. P. Deutscher.
1999.
RNase G (CafA protein) and RNase E are both required for the 5' maturation of 16S ribosomal RNA.
EMBO J.
18:2878-2885[CrossRef][Medline].
|
| 10.
|
Lin-Chao, S.,
T.-T. Wong,
K. J. McDowall, and S. N. Cohen.
1994.
Effects of nucleotide sequence on the specificity of rne-dependent and RNase E-mediated cleavages of RNA I encoded by the pBR322 plasmid.
J. Biol. Chem.
269:10797-10803[Abstract/Free Full Text].
|
| 11.
|
Lopez, P. J.,
I. Marchand,
S. A. Joyce, and M. Dreyfus.
1999.
The C-terminal half of RNase E, which organizes the Escherichia coli degradosome, participates in mRNA degradation but not rRNA processing in vivo.
Mol. Microbiol.
33:188-199[CrossRef][Medline].
|
| 12.
|
Mackie, G. A.
1998.
Ribonuclease E is a 5'-end-dependent endonuclease.
Nature
395:720-723[CrossRef][Medline].
|
| 13.
|
Mayer, M. P.
1995.
A new set of useful cloning and expression vectors derived from pBlueScript.
Gene
163:41-46[CrossRef][Medline].
|
| 14.
|
McDowall, K. J., and S. N. Cohen.
1996.
The N-terminal domain of the rne gene product has RNase E activity and is non-overlapping with the arginine-rich RNA-binding site.
J. Mol. Biol.
255:349-355[CrossRef][Medline].
|
| 15.
|
McDowall, K. J.,
R. G. Hernandez,
S. Lin-Chao, and S. N. Cohen.
1993.
The ams-1 and rne-3071 temperature-sensitive mutations in the ams gene are in close proximity to each other and cause substitutions within a domain that resembles a product of the Escherichia coli mre locus.
J. Bacteriol.
175:4245-4249[Abstract/Free Full Text].
|
| 16.
|
McDowall, K. J.,
S. Lin-Chao, and S. N. Cohen.
1994.
A+U content rather than a particular nucleotide order determines the specificity of RNase E cleavage.
J. Biol. Chem.
269:10790-10796[Abstract/Free Full Text].
|
| 17.
|
Melefors, Ö., and A. von Gabain.
1991.
Genetic studies of cleavage-initiated mRNA decay and processing of ribosomal 9S RNA show that the Escherichia coli ams and rne loci are the same.
Mol. Microbiol.
5:857-864[Medline].
|
| 18.
|
Miczak, A.,
V. R. Kaberdin,
C. L. Wei, and S. Lin-Chao.
1996.
Proteins associated with RNase E in a multicomponent ribonucleolytic complex.
Proc. Natl. Acad. Sci. USA
93:3865-3869[Abstract/Free Full Text].
|
| 19.
|
Morita, M., and A. Oka.
1979.
The structure of a transcriptional unit on colicin E1 plasmid.
Eur. J. Biochem.
97:435-443[Medline].
|
| 20.
|
Mudd, E. A.,
H. M. Krisch, and C. F. Higgins.
1990.
RNase E, an endoribonuclease, has a general role in the chemical decay of E. coli mRNA: evidence that rne and ams are the same genetic locus.
Mol. Microbiol.
4:2127-2135[Medline].
|
| 21.
|
Ono, M., and M. Kuwano.
1979.
A conditional lethal mutation in an Escherichia coli strain with a longer chemical lifetime of mRNA.
J. Mol. Biol.
129:343-357[CrossRef][Medline].
|
| 22.
|
Py, B.,
C. F. Higgins,
H. M. Krisch, and A. J. Carpousis.
1996.
A DEAD-box RNA helicase in the Escherichia coli RNA degradosome.
Nature
381:169-172[CrossRef][Medline].
|
| 23.
|
Stevens, A., and T. L. Poole.
1995.
5'-exonuclease-2 of Saccharomyces cerevisiae: purification and features of ribonuclease activity with comparison to 5'-exonuclease-1.
J. Biol. Chem.
270:16063-16069[Abstract/Free Full Text].
|
| 24.
|
Stoscheck, C. M.
1990.
Quantitation of protein.
Methods Enzymol.
182:50-68[CrossRef][Medline].
|
| 25.
|
Tamm, J., and B. Polisky.
1983.
Structural analysis of RNA molecules involved in plasmid copy number control.
Nucleic Acids Res.
11:6381-6397[Abstract/Free Full Text].
|
| 26.
|
Taraseviciene, L.,
G. R. Bjork, and B. E. Uhlin.
1995.
Evidence for an RNA binding region in the Escherichia coli processing endoribonuclease RNase E.
J. Biol. Chem.
270:26391-26398[Abstract/Free Full Text].
|
| 27.
|
Taraseviciene, L.,
A. Miczak, and D. Apirion.
1991.
The gene specifying RNase E (rne) and a gene affecting mRNA stability (ams) are the same gene.
Mol. Microbiol.
5:851-855[Medline].
|
| 28.
|
Vanzo, N. F.,
Y.-S. Li,
B. Py,
E. Blum,
C. F. Higgins,
L. C. Raynal,
H. M. Krisch, and A. J. Carpousis.
1998.
Ribonuclease E organizes the protein interactions in the Escherichia coli RNA degradosome.
Genes Dev.
12:2770-2781[Abstract/Free Full Text].
|
| 29.
|
von Gabain, A.,
J. G. Belasco,
J. L. Schottel,
A. C. Y. Chang, and S. N. Cohen.
1983.
Decay of mRNA in Escherichia coli: investigation of the fate of specific segments of transcripts.
Proc. Natl. Acad. Sci. USA
80:653-657[Abstract/Free Full Text].
|
| 30.
|
Wachi, M.,
G. Umitsuki,
M. Shimizu,
A. Takada, and K. Nagai.
1999.
Escherichia coli cafA gene encodes a novel RNase, designated as RNase G, involved in processing of the 5' end of 16S rRNA.
Biochem. Biophys. Res. Commun.
259:483-488[CrossRef][Medline].
|
Journal of Bacteriology, May 2000, p. 2468-2475, Vol. 182, No. 9
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Garrey, S. M., Blech, M., Riffell, J. L., Hankins, J. S., Stickney, L. M., Diver, M., Hsu, Y.-H. R., Kunanithy, V., Mackie, G. A.
(2009). Substrate Binding and Active Site Residues in RNases E and G: ROLE OF THE 5'-SENSOR. J. Biol. Chem.
284: 31843-31850
[Abstract]
[Full Text]
-
Deikus, G., Bechhofer, D. H.
(2009). Bacillus subtilis trp Leader RNA: RNase J1 ENDONUCLEASE CLEAVAGE SPECIFICITY AND PNPase PROCESSING. J. Biol. Chem.
284: 26394-26401
[Abstract]
[Full Text]
-
Schein, A., Sheffy-Levin, S., Glaser, F., Schuster, G.
(2008). The RNase E/G-type endoribonuclease of higher plants is located in the chloroplast and cleaves RNA similarly to the E. coli enzyme. RNA
14: 1057-1068
[Abstract]
[Full Text]
-
Collins, J. A., Irnov, I., Baker, S., Winkler, W. C.
(2007). Mechanism of mRNA destabilization by the glmS ribozyme. Genes Dev.
21: 3356-3368
[Abstract]
[Full Text]
-
LI, Z., GONG, X., JOSHI, V. H., LI, M.
(2005). Co-evolution of tRNA 3' trailer sequences with 3' processing enzymes in bacteria. RNA
11: 567-577
[Abstract]
[Full Text]
-
Purusharth, R. I., Klein, F., Sulthana, S., Jager, S., Jagannadham, M. V., Evguenieva-Hackenberg, E., Ray, M. K., Klug, G.
(2005). Exoribonuclease R Interacts with Endoribonuclease E and an RNA Helicase in the Psychrotrophic Bacterium Pseudomonas syringae Lz4W. J. Biol. Chem.
280: 14572-14578
[Abstract]
[Full Text]
-
Even, S., Pellegrini, O., Zig, L., Labas, V., Vinh, J., Brechemmier-Baey, D., Putzer, H.
(2005). Ribonucleases J1 and J2: two novel endoribonucleases in B.subtilis with functional homology to E.coli RNase E. Nucleic Acids Res
33: 2141-2152
[Abstract]
[Full Text]
-
Kim, K.-s., Lee, Y.
(2004). Regulation of 6S RNA biogenesis by switching utilization of both sigma factors and endoribonucleases. Nucleic Acids Res
32: 6057-6068
[Abstract]
[Full Text]
-
Jiang, X., Belasco, J. G.
(2004). Catalytic activation of multimeric RNase E and RNase G by 5'-monophosphorylated RNA. Proc. Natl. Acad. Sci. USA
101: 9211-9216
[Abstract]
[Full Text]
-
Redko, Y., Tock, M. R., Adams, C. J., Kaberdin, V. R., Grasby, J. A., McDowall, K. J.
(2003). Determination of the Catalytic Parameters of the N-terminal Half of Escherichia coli Ribonuclease E and the Identification of Critical Functional Groups in RNA Substrates. J. Biol. Chem.
278: 44001-44008
[Abstract]
[Full Text]
-
Feng, Y., Vickers, T. A., Cohen, S. N.
(2002). The catalytic domain of RNase E shows inherent 3' to 5' directionality in cleavage site selection. Proc. Natl. Acad. Sci. USA
99: 14746-14751
[Abstract]
[Full Text]
-
Kennell, D.
(2002). Processing Endoribonucleases and mRNA Degradation in Bacteria. J. Bacteriol.
184: 4645-4657
[Full Text]
-
Kushner, S. R.
(2002). mRNA Decay in Escherichia coli Comes of Age. J. Bacteriol.
184: 4658-4665
[Full Text]
-
Spickler, C., Stronge, V., Mackie, G. A.
(2001). Preferential Cleavage of Degradative Intermediates of rpsT mRNA by the Escherichia coli RNA Degradosome. J. Bacteriol.
183: 1106-1109
[Abstract]
[Full Text]
-
Mackie, G. A.
(2000). Stabilization of Circular rpsT mRNA Demonstrates the 5'-End Dependence of RNase E Action in Vivo. J. Biol. Chem.
275: 25069-25072
[Abstract]
[Full Text]