Journal of Bacteriology, May 2000, p. 2672-2674, Vol. 182, No. 9
Department of Biochemistry, Faculty of
Pharmacy, University of Barcelona, 08028 Barcelona, Spain
Received 17 November 1999/Accepted 1 February 2000
Genes for D-galactarate (gar) and
D-glucarate (gud) metabolism in
Escherichia coli are organized in three transcriptional units: garD, garPLRK, and gudPD.
Two observations suggested a common regulator for the three operons.
(i) Their expression was triggered by D-galactarate,
D-glucarate, and D-glycerate. (ii) Metabolism
of the three compounds was impaired by a single Tn5 insertion mapped in the yaeG gene (proposed name,
sdaR), outside the D-galactarate and
D-glucarate systems. Expression of the sdaR gene is autogenously regulated.
The genes encoding the enzymes in
the D-glucarate and D-galactarate pathways have
been identified in the Escherichia coli genome and found to
be distributed in apparently three transcriptional units (Fig.
1) (12). One unit, located at
min 60 and transcribed counterclockwise, is formed by three genes that
encode a putative D-glucarate permease (b2789), a
nonfunctional D-glucarate dehydratase-related protein
(b2788), and the functional D-glucarate dehydratase
(b2787). The other two units are located at min 70 and are divergently transcribed, one (clockwise) formed by the gene encoding
D-galactarate dehydratase (yhaG) and the other
(counterclockwise) formed by the genes for a putative
D-galactarate permease (yhaU),
5-keto-4-deoxy-D-glucarate aldolase (yhaF),
tartronate semialdehyde reductase (yhaE), and glycerate
kinase (yhaD). Despite this recent detailed description of
the gene structure and organization of these two metabolic systems, no
information on their regulation was available. In this report we assign
to a gene of unknown function the role of encoding a common regulator
for D-galactarate, D-glucarate, and D-glycerate metabolism.
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
A Common Regulator for the Operons Encoding the
Enzymes Involved in D-Galactarate, D-Glucarate,
and D-Glycerate Utilization in Escherichia
coli
ABSTRACT
Top
Abstract
Text
References
TEXT
Top
Abstract
Text
References
View larger version (17K):
[in a new window]
FIG. 1.
Restriction map and gene organization of the
gud (A) and gar (B) regions of the E. coli chromosome. Relevant restriction sites are shown along the
E. coli DNA as follows: B, BamHI; E,
EcoRI; EV, EcoRV; H, HindIII; K,
KpnI; and P, PvuII. Open arrows indicate the
direction and extension of the genes involved in
D-galactarate, D-glucarate, and
D-glycerate metabolism. Genes are labeled inside the arrows
according to the system of the E. coli Genome Project and
outside by the names proposed in this work. Thin arrows correspond to
the fragments fused to lacZ displaying promoter activity and
are labeled by numbers that indicate the distance (in nucleotides)
upstream of ATG.
Coordinate regulation of D-galactarate,
D-glucarate, and D-glycerate metabolism.
Enzyme activities involved in the metabolism of
D-galactarate and D-glucarate were determined
in crude extracts of strain MC4100 (8) grown aerobically in
minimal medium (6) with D-galactarate,
D-glucarate, or their common intermediate metabolite D-glycerate. Activity levels of D-galactarate
dehydratase (5), D-glucarate dehydratase
(4), glycerate kinase (1), and tartronate semialdehyde reductase (9) showed that both enzyme systems were induced by growth on either of the carbon sources.
D-Glycerate was the best inducer (Table
1).
|
Expression of the transcriptional units.
To identify the
functional promoters in the D-galactarate and
D-glucarate systems, different fragments of the two gene
clusters were fused to the lacZ gene of plasmid pRS550 or
pRS551 (17) and introduced as a single copy in the genomic
background of MC4100 as described by Elliott (10). Analysis
of the 
-galactosidase activities (14) showed the presence
of promoter function only 5' of the following genes: yhaG
(proposed name, garD), yhaU (proposed name,
garP), and b2789 (proposed name, gudP) (Fig. 1).
A garP::Tn5 insertion mutant (strain
JA175) was obtained from strain MC4100 as described by Bruijn and
Lupski (7). Impairment of D-glucarate and
D-glycerate utilization in this mutant, which lacks the
function of downstream genes in the garPLRK operon due to
polarity effects, also indicated that no other promoter activity lies
in this operon.
-Galactosidase activities of 
(garD-lacZ),
(garP-lacZ), and (gudP-lacZ) were found to
be induced in cultures grown in the presence of
D-galactarate, D-glucarate, or
D-glycerate compared to the basal levels obtained in
glycerol. The activation was two- to threefold higher in
D-glycerate than in D-galactarate or
D-glucarate (Fig. 2). These
results indicated a coordinate regulation of these three promoters. No
induction was observed with other related sugars, such as
D-glucuronic acid or D-galacturonic acid. The inducing capacity of any of the three compounds observed in strain JA175, which was unable to form D-glycerate from
D-galactarate or D-glucarate, indicated that
all of them acted as inducers. Induction by D-galactarate
in strain JA175, which lacks galactarate permease, showed that this
substrate is able to enter the cells by another permease, probably
D-glucarate permease. This finding would be supported by
the high similarity displayed by these two permeases (12).
These results led us to explore if the three promoters were under the
control of a common regulatory protein recognizing any of the three
substrates as an inducer.
|
Isolation and mapping of pleiotropic mutants.
To search for a
common regulator, 104 cells of strain MC4100 bearing
(garD-lacZ) were mutated by ethyl methanesulfonate
(14) and screened for blue and white colonies on glycerol
plates containing D-glucarate and
5-bromo-4-chloro-3-indolyl--D-galactoside. From among
the white colonies we selected those that were unable to grow on
D-glucarate, D-galactarate, or
D-glycerate but able to grow on other carbon sources. These
cells displayed no -galactosidase activity and no detectable
galactarate or glucarate dehydratase, tartronate semialdehyde
reductase, or glycerate kinase activities when grown under any of the
inducing conditions. The mutation in one of the isolates (strain JA176)
was mapped by conjugation using the Hfr strain collection of Wanner
(19). The 68% recombination with the Tn10 marker
of strain BW6156 and the 37% recombination with the Tn10
marker present in strain BW6164 allowed us to locate the mutation in
the genomic region of 95 to 5 min, mapping outside of the
D-galactarate and D-glucarate loci. Fine
mapping was performed by P1 transduction (14) with strain
CAG12025 (15) (18% cotransduction), which located the
mutation close to min 3.2.
Identification and cloning of the putative regulator.
To
identify the gene responsible for this pleiotropic effect, we obtained
a Tn5 insertion mutant (7) that mapped to the same locus and displayed the same phenotype as strain JA176. To rule
out the possibility of multiple transposon insertions, this mutation
was P1 transduced into the wild-type background of strain MC4100
(strain JA177). For Southern blot analysis, chromosomal DNA of strain
JA177 was digested with restriction enzymes that had no recognition
sites on the kanamycin resistance-coding region of the transposon.
Using a Tn5 probe, we identified a 5.5-kb
BamHI-EcoRV fragment, which was subsequently
cloned into pBluescript. By sequencing the region adjacent to the
Tn5 joining site using as a primer an internal sequence of
the transposon, the precise location of the Tn5 insertion
was determined at 20 nucleotides upstream of the stop codon of gene
yaeG, which encodes a protein of 391 residues (accession no.
AE000125, nucleotides 8952 to 10127) (3). In order to
confirm that the above-described mutation of strain JA176 also affected
the yaeG gene, the corresponding region was amplified by
PCR, using primer A1 (CGGAATTCGCGACGGTAAGCAGGTT) and primer A2 (TGCGGATCCTCCTCGACGACTTACG).
The fragment was cloned into pBluescript, making use of the
BamHI and EcoRI sites of the primers
(underlined). After sequencing of several clones, the mutation was
identified in all as a C
T transition resulting in a replacement of
Pro297 by a Ser in the encoded protein. This gene is likely to be a
regulator of these systems and is given here the name sdaR
for sugar diacid regulator. Furthermore, computer analysis permitted us
to classify the sdaR gene product within a set of proteins
that present a conserved helix-turn-helix motif, including other gene
expression regulators such as XylR (13). In the case of the
SdaR protein this motif was identified close to the carboxy-terminal
end, between amino acid residues 343 and 367. We would like to point
out that T-fasta analysis of SdaR yielded a high percentage of identity
(95.9% in a 170-amino-acid overlap) with some protein sequences
encoded in Homo sapiens chromosome 5. This unusually high
identity has to be explained by an incorrect entry in GenBank, as the
same identity was found in comparing the nucleotide sequences.
Regulation of sdaR expression.
Control of
sdaR expression was studied by fusing its putative promoter
region to lacZ in the genetic background of strain MC4100.
The fragment obtained by PCR using primer A3
(CGGAATTCGGCACTCAACATTCAGC) and primer A4
(TGCGGATCCAGTACCAGCAATGCAC) extended 188 bp upstream of the
sdaR GTG start codon proposed in the E. coli
genome (3). -Galactosidase activities showed that
sdaR was expressed at a basal level of 35 U in glycerol
cultures, which reached values of 350 U in the presence of
D-glucarate or D-galactarate and of 950 U in
the presence of D-glycerate. Lack of a functional
sdaR gene product abolished the activation of the
sdaR-lacZ fusion by the three compounds, indicating that the
expression of the regulator gene is mediated by its own product.
(sdaR-lacZ) or (garP-lacZ) in the knockout
mutants of the sdaR gene. Autogenous regulation of
sdaR in response to the inducers must be explained by
positive regulation as described for the rhaSR genes of
E. coli (18), the eutR gene of
Salmonella enterica serovar Typhimurium (16), or
the moaR gene of Klebsiella aerogenes
(2). In the presence of the inducing molecules, low residual
levels of SdaR are activated, thereby increasing its own expression.
Under these conditions the rise in the regulator concentration would
balance the equilibrium between the inactive and the active forms of
the activator towards a further regulator activation, which would in
turn enhance expression of the three structural operons.
| |
ACKNOWLEDGMENTS |
|---|
We are grateful to Jorge Membrillo-Hernandez for helpful and enthusiastic discussion.
This work was supported by grant PB97-0920 from the Dirección General de Enseñanza Superior e Investigación Científica, Madrid, Spain, and by the help of the "Commissionat per Universitats i Recerca de la Generalitat de Catalunya." R.M. is the recipient of a predoctoral fellowship from the University of Barcelona, Barcelona, Spain.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Departamento de Bioquímica, Facultad de Farmacia, Universidad de Barcelona, Avda. Diagonal 643, 08028 Barcelona, Spain. Phone: 34-93-402 4521. Fax: 34-93-402 1896. E-mail: Palaciu{at}farmacia.far.ub.es.
| |
REFERENCES |
|---|
|
Top
Abstract
Text
References
|
|---|
| 1. |
Anderson, R. L., and W. A. Wood.
1962.
Pathway of xylose and L-lyxose degradation in Aerobacter aerogenes.
J. Biol. Chem.
237:296-303 |
| 2. |
Azakami, H.,
H. Sugino,
N. Yokoro,
N. Iwata, and Y. Murooka.
1993.
moaR, a gene that encodes a positive regulator of the monoamine regulon in Klebsiella aerogenes.
J. Bacteriol.
175:6287-6292 |
| 3. |
Blattner, F. R.,
G. Plunkett III,
C. A. Bloch,
N. T. Perna,
V. Burland,
M. Riley,
J. Collado-Vides,
J. D. Glasner,
C. K. Rode,
G. F. Mayhew,
J. Gregor,
N. W. Davis,
H. A. Kirkpatrick,
M. A. Goeden,
D. J. Rose,
B. Mau, and Y. Shao.
1997.
The complete genome sequence of Escherichia coli K-12.
Science
277:1453-1474 |
| 4. | Blumenthal, H. J. 1966. D-Glucarate dehydrase. Methods Enzymol. 9:660-665. |
| 5. | Blumenthal, H. J., and T. Jepson. 1966. D-Galactarate dehydrase. Methods Enzymol. 9:665-669. |
| 6. |
Boronat, A., and J. Aguilar.
1979.
Rhamnose-induced propanediol oxidoreductase in Escherichia coli: purification, properties, and comparison with the fucose-induced enzyme.
J. Bacteriol.
140:320-326 |
| 7. | Bruijn, F. J., and J. R. Lupski. 1984. The use of transposon Tn5 mutagenesis in the rapid generation of correlated physical and genetic maps of DNA segments cloned into multicopy plasmids. Gene 27:131-149[CrossRef][Medline]. |
| 8. | Casadaban, M. J. 1976. Transposition and fusion of the lac genes to selected promoters in Escherichia coli using bacteriophage lambda and Mu. J. Mol. Biol. 104:541-555[CrossRef][Medline]. |
| 9. |
Cusa, E.,
N. Obradors,
L. Baldomà,
J. Badía, and J. Aguilar.
1999.
Genetic analysis of a chromosomal region containing genes required for assimilation of allantoin nitrogen and linked glyoxylate metabolism in Escherichia coli.
J. Bacteriol.
181:7479-7484 |
| 10. |
Elliott, T.
1992.
A method for constructing single-copy lac fusions in Salmonella typhimurium and its application to the hemA-prfA operon.
J. Bacteriol.
174:245-253 |
| 11. | Hlavacek, W. S., and M. A. Savageau. 1996. Rules for coupled expression of regulator and effector genes in inducible circuits. J. Mol. Biol. 255:121-139[CrossRef][Medline]. |
| 12. | Hubbard, K. B., M. Koch, D. R. J. Palmer, P. C. Babbitt, and J. A. Gerlt. 1998. Evolution of enzymatic activities in the enolase superfamily: characterization of the (D)-glucarate/galactarate catabolic pathway in Escherichia coli. Biochemistry 37:14369-14375[CrossRef][Medline]. |
| 13. |
Koonin, E. V.,
R. L. Tatusov, and K. E. Rudd.
1995.
Sequence similarity analysis of Escherichia coli proteins: functional and evolutionary implications.
Proc. Natl. Acad. Sci. USA
92:11921-11925 |
| 14. | Miller, J. H. 1992. A short course in bacterial genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 15. |
Nichols, B. P.,
O. Shafiq, and V. Meiners.
1998.
Sequence analysis of Tn10 insertion sites in a collection of Escherichia coli strains used for genetic mapping and strain construction.
J. Bacteriol.
180:6408-6411 |
| 16. |
Roof, D. M., and J. R. Roth.
1992.
Autogenous regulation of ethanolamine utilization by a transcriptional activator of the eut operon in Salmonella typhimurium.
J. Bacteriol.
174:6634-6643 |
| 17. | Simons, R. W., F. Houman, and N. Kleckner. 1987. Improved single and multicopy lac-based cloning vectors for protein and operon fusions. Gene 53:85-96[CrossRef][Medline]. |
| 18. | Tobin, J. F., and R. F. Schleif. 1990. Transcription from the rha operon PSR promoter. J. Mol. Biol. 211:1-4[CrossRef][Medline]. |
| 19. | Wanner, B. L. 1986. Novel regulatory mutants of the phosphate regulon in Escherichia coli K-12. J. Mol. Biol. 191:39-58[CrossRef][Medline]. |
Journal of Bacteriology, May 2000, p. 2672-2674, Vol. 182, No. 9
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Nagorska, K., Hinc, K., Strauch, M. A., Obuchowski, M.
(2008). Influence of the {sigma}B Stress Factor and yxaB, the Gene for a Putative Exopolysaccharide Synthase under {sigma}B Control, on Biofilm Formation. J. Bacteriol.
190: 3546-3556
[Abstract] [Full Text] -
Yang, C., Rodionov, D. A., Rodionova, I. A., Li, X., Osterman, A. L.
(2008). Glycerate 2-Kinase of Thermotoga maritima and Genomic Reconstruction of Related Metabolic Pathways. J. Bacteriol.
190: 1773-1782
[Abstract] [Full Text] -
Nishino, K., Honda, T., Yamaguchi, A.
(2005). Genome-Wide Analyses of Escherichia coli Gene Expression Responsive to the BaeSR Two-Component Regulatory System. J. Bacteriol.
187: 1763-1772
[Abstract] [Full Text] -
Sampaio, M.-M., Chevance, F., Dippel, R., Eppler, T., Schlegel, A., Boos, W., Lu, Y.-J., Rock, C. O.
(2004). Phosphotransferase-mediated Transport of the Osmolyte 2-O-{alpha}-Mannosyl-D-glycerate in Escherichia coli Occurs by the Product of the mngA (hrsA) Gene and Is Regulated by the mngR (farR) Gene Product Acting as Repressor. J. Biol. Chem.
279: 5537-5548
[Abstract] [Full Text] -
Hunt, S. M., Hamilton, M. A., Sears, J. T., Harkin, G., Reno, J.
(2003). A computer investigation of chemically mediated detachment in bacterial biofilms. Microbiology
149: 1155-1163
[Abstract] [Full Text] -
Schultz, A. C., Nygaard, P., Saxild, H. H.
(2001). Functional Analysis of 14 Genes That Constitute the Purine Catabolic Pathway in Bacillus subtilis and Evidence for a Novel Regulon Controlled by the PucR Transcription Activator. J. Bacteriol.
183: 3293-3302
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»