Previous Article | Next Article ![]()
Journal of Bacteriology, January 2001, p. 155-161, Vol. 183, No. 1
Department of Applied Biochemistry, Kyoto
Prefectural University, Shimogamo, Sakyo, Kyoto 606-8522, Japan
Received 13 April 2000/Accepted 10 October 2000
HrcA, a negative control repressor for chaperone expression from
the obligate thermophile Bacillus thermoglucosidasius
KP1006, was purified in a His-tagged form in the presence of 6 M urea but hardly renatured to an intact state due to extreme insolubility. Renaturation trials revealed that the addition of DNA to purified B. thermoglucosidasius HrcA can result in solubilization of
HrcA free from the denaturing agent urea. Results from band shift and light scattering assays provided three new findings: (i) any species of
DNA can serve to solubilize B. thermoglucosidasius HrcA,
but DNA containing the CIRCE (controlling inverted repeat of chaperone expression) element is far more effective than other nonspecific DNA;
(ii) B. thermoglucosidasius HrcA renatured with nonspecific DNA bound the CIRCE element in the molecular ratio of 2.6:1; and (iii)
B. thermoglucosidasius HrcA binding to the CIRCE element was stable at below 50°C whereas the complex was rapidly denatured at
70°C, suggesting that the breakdown of HrcA is induced by heat stress
and HrcA may act as a thermosensor to affect the expression of heat
shock regulatory genes. These results will help to determine the nature
of HrcA protein molecules.
In the heat shock response of
gram-positive bacteria and Based on our interest in protein thermostability, we characterized the
dnaK operon genes from the obligate thermophile
Bacillus thermoglucosidasius KP1006 and showed that there
are significant differences in the proline content of the
dnaK operon proteins (DnaK, DnaJ, and GrpE) which are
closely correlated with the thermostability of enzyme proteins
(25, 26). B. thermoglucosidasius KP1006 is an
obligate thermophile that can grow at temperatures between 42 and
69°C, with optimum growth between 61 and 63°C (21).
B. thermoglucosidasius strains show considerable phenotypic
resemblance to B. stearothermophilus. The stress-inducible
proteins from B. thermoglucosidasius and B. stearothermophilus are proposed to share a high degree of identity
(26). We are now shifting our focus to B. thermoglucosidasius HrcA with the aim of investigating its
thermostability and function. To study the native features of B. thermoglucosidasius HrcA, it is necessary to solubilize the
purified protein in the absence of the denaturing agent urea. In many
trials, we devised a convenient method to renature B. thermoglucosidasius HrcA in a soluble form, excluding urea even in
the absence of the chaperonin GroEL. Here we show that the presence of
DNA is crucial to the solubilization and thermostability of HrcA.
Later, we found that the method we devised is essentially the same as
that previously reported by Egan and Schleif (5). On the
basis of results of our in vitro studies, we discuss the possibility
that HrcA binding to the CIRCE element may act as a thermosensor for
regulation of the two chaperone operons in B. thermoglucosidasius KP1006.
Bacterial strains, plasmids, media, and growth
conditions.
The bacterial strains used in this study were B. thermoglucosidasius KP1006 (DSM2542) (21), E. coli MV1184 {ara DNA manipulations.
Extraction of genomic DNA from B. thermoglucosidasius KP1006 was carried out as described before
(24). Two primers, HF (CGGAATTCGAAGAAATGTTTTTTGGG) and HR (AGGCTGCAGTTTTCCATT), were used to amplify the
DNA fragment containing the B. thermoglucosidasius hrcA gene
and its flanking region by PCR with B. thermoglucosidasius
genomic DNA as the template. The latter corresponds to the nucleotide
sequence of a part of B. thermoglucosidasius HrcA (amino
acid residues 276 to 294) (26), and the former was
designed from the nucleotide sequences for the 5'-flanking regions of
B. subtilis hrcA (9) and B. stearothermophilus hrcA (13). PCR was performed with
LA-Taq DNA polymerase (Takara Shuzo) for 30 cycles according to the
manufacturer's directions. Denaturation, annealing, and extension
temperatures were 94°C for 1 min, 55°C for 1 min, and 72°C for 2 min, respectively. Other DNA manipulations followed protocols described
before (2).
Purification and renaturation of B. thermoglucosidasius HrcA.
To purify B. thermoglucosidasius HrcA overexpressed in E. coli, the
hrcA gene was tagged with a stretch of six His residues at
its N terminus. A DNA fragment containing the gene was amplified by PCR
using primer 1 (CGGGATCCCATGTTAACGGATCGCCAACT, corresponding to the region for the initiation codon of hrcA) and primer 2 (CGGGATCCAAATAGTCACAAGGA, corresponding to the sequence
between hrcA and grpE), both with BamHI sites at their termini, with B. thermoglucosidasius genomic DNA as the template. The amplified DNA
fragment was digested with BamHI and cloned into a
BamHI site of the His-tagging vector pET15-b. The resulting
plasmid was named as pETTY (Fig. 1A) and
used for transformation of E. coli BL21(DE3). His-tagged
B. thermoglucosidasius HrcA (His-HrcA) was produced in the
transformant cells by induction with
isopropyl-
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.1.155-161.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Renaturation of Bacillus thermoglucosidasius HrcA
Repressor by DNA and Thermostability of the HrcA-DNA Complex In
Vitro
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-proteobacteria, the CIRCE (controlling
inverted repeat of chaperone expression)-HrcA systems play an important
role in the mechanism for regulation of expression of heat shock genes
(14, 15, 29). HrcA, a repressor protein encoded by the
hrcA gene, is responsible for negative control of heat shock
genes by binding to the CIRCE element located in the region controlling
transcription. The CIRCE element in Bacillus species is
composed of a pair of conserved 9-bp inverted repeats and intervening
nonconservative 9-bp spacers. The groE and dnaK
operons of Bacillus species have been demonstrated to be
under this control system (28, 29). Indeed, analyses of
the entire genome sequence of Bacillus subtilis revealed
that the strictly conserved inverted repeat is restricted to these two
chaperone operons (15). Further studies on B. subtilis HrcA and Bacillus stearothermophilus HrcA
indicated that the GroE chaperonin machine modulates the activity of
the HrcA repressor (12). In Clostridium
acetobutylicum DSM1731, however, the HrcA protein can be refolded
by the chaperones DnaK, DnaJ, and GrpE (17). Furthermore,
in Bradyrhizobium japonicum 110spc4, elevated levels of GroESL in an hrcA mutant had no influence on
free-living growth and symbiotic nitrogen fixation (11).
The many examples of cooperation between HrcA and these chaperones for
proper function of HrcA in diverse bacteria (1) are
consistent with the common and stable characteristics that HrcA is
hardly soluble and easily forms aggregates when expressed and purified
from Escherichia coli. This unfavorable characteristic was
reported for B. subtilis HrcA (19), B. stearothermophilus HrcA (12), Staphylococcus aureus HrcA (16), and C. acetobutylicum
HrcA (17). Although in vitro experiments performed with
B. stearothermophilus HrcA revealed the participation of
GroEL in modulating HrcA function, the purification process and band
shift assays still required the presence of 8 and 0.5 M urea,
respectively (12). The insolubility of HrcA has thus far
impeded in vitro analyses aimed at elucidating the nature of HrcA. On
the other hand, many DNA-binding proteins tend to form inclusion bodies
upon overproduction, which is a serious obstacle to purification of the
proteins after gene cloning (4, 6).
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
(lac-proAB) rpsL
thi (
80 lacZ
M15)
(srl-recA)306::Tn10(Tetr)/F'
[traD306 proAB+ lacIq
lacZ
M15]} (23), and E. coli
BL21(DE3) [F
ompT
hsdSB(rB
mB
) gal dem(DE3)]
(20). Plasmids pUC119 (23) and pSTV29
(Takara Shuzo, Kyoto, Japan) were used as cloning vectors, and
pET15-b (Novagen, Madison, Wis.) was used as a His-tagging fusion
vector. B. thermoglucosidasius KP1006 was grown as
previously described (22). The E. coli cells
were aerobically grown at 37°C in L broth (1% polypeptone, 0.5%
yeast extract, 0.5% NaCl, 0.1% glucose [pH 7.2]) supplemented with
ampicillin (50 µg/ml).
-D-thiogalactopyranoside (0.5 mM) and purified essentially according to the protocol supplied by Clontech (Palo Alto,
Calif.) under denaturing conditions in the presence of 6 M urea with
metal affinity chromatography. All procedures were done at 4°C unless
otherwise stated. After passing through the affinity resin, the eluate
containing pure His-HrcA in the presence of 6 M urea was extensively
dialyzed against 20 mM Tris-HCl-5 mM EDTA (pH 7.5) containing 3 M
urea. The protein concentration was then adjusted to 200 µg/ml with
dialyzing buffer. To 1-ml aliquots, 50 µg of plasmid DNA (pUC119)
dissolved in dialyzing buffer (50 µl) was added and then extensively
dialyzed against 20 mM Tris-HCl-5 mM EDTA (pH 7.5). The dialysate was
ultracentrifuged at 100,000 × g for 15 min, and the
supernatant was saved as a final sample. Plasmid DNA used for
renaturation was purified by ultracentrifugation to equilibrium in
cesium chloride-ethidium density gradients (18).

View larger version (14K):
[in a new window]
FIG. 1.
(A) Schematic representation and physical map of the
hrcA-dnaK operon. The CIRCE element and the hrcA
gene are indicated with a hairpin and thick arrow, respectively. A
1.1-kbp PCR product obtained from primers HF and HR, the
EcoRI fragment cloned in pTY-1, and the BamHI
fragment in pETTY are shown as bars, as are pTI-2 (26)
containing the C terminus of the hrcA gene with the
grpE, dnaK, and dnaJ genes. (B) DNA
sequence of the N terminus of the hrcA gene and its
5'-flanking region. The vegetative promoter (
35 and
10 consensus
sequence) is boxed. The CIRCE element is indicated with thick arrows. A
Shine-Dalgarno sequence (SD) for ribosome binding is underlined.
Band shift assay.
The CIRCE-containing probe was a 330-bp
DNA fragment carrying the region upstream of the start codon of
B. thermoglucosidasius hrcA and synthesized by PCR with
primers 1 and HrcA-5 (CGGGATCCAAAATAAGCAGTTGG, corresponding
to amino acid residues 5 to 10 of B. thermoglucosidasius HrcA). The probe used as nonspecific DNA was a 340-bp fragment carrying
B. thermoglucosidasius dnaK from amino acid residues 505 to
the stop codon (26). The nonspecific DNA probe was
generated by PCR with primers DnaK505
(CGGGATCCGGAAAGAAGCGGCAGAACTC) and DnaK-Rev
(CGGGATCCTTATTTGTTGTCGTCTTTCAC). Each probe was internally labeled by PCR in the presence of 60 kBq of
[
-32P]dCTP. The mixture for binding assay reactions
contained binding buffer (20 mM Tris-HCl-5 mM EDTA [pH 7.5]), 0.2 µg of labeled probe, and 1.0 µg of purified His-HrcA. Binding was
performed as described before (12, 28). The samples were
loaded onto a 7% polyacrylamide gel and run at 20 mA with 1×
Tris-borate-EDTA buffer (18). After polyacrylamide gel
electrophoresis (PAGE), gels were wrapped with Saran Wrap and exposed
to X-ray film for 3 to 15 h at room temperature.
Light scattering photometry. Light scattering was carried out using a Shimadzu RF5300PC fluorescence spectrophotometer equipped with a temperature-controlled cell holder and a magnetic stirrer. The excitation and emission wavelengths were set at 450 nm; the excitation and emission slits were set at 5 nm. The data were sent to a computer every 20 s. The reaction was started by adding 25 µg of purified His-HrcA (0.1 ml) to a solution (2.9 ml) containing the appropriate amount of DNA in 20 mM Tris-HCl-5 mM EDTA (pH 7.5). Purified B. thermoglucosidasius DnaK (26) and GroEL (unpublished result) proteins used for the assay were prepared from E. coli MV1184 harboring plasmids carrying the B. thermoglucosidasius dnaK and groEL genes, respectively.
Protein concentration assay. Protein concentration was determined by the Bradford method (3) to eliminate false-positive signals associated with urea.
Nucleotide sequence accession number. The nucleotide sequence data reported in this paper will appear in the DDBJ/EMBL/GenBank nucleotide sequence databases with accession number AB039833.
| |
RESULTS |
|---|
|
|
|---|
Cloning of B. thermoglucosidasius hrcA.
Since the
dnaK, grpE, and dnaJ genes were cloned
from B. thermoglucosidasius KP1006 together with the C
terminus of the hrcA gene in the same operon
(26), we tried to clone the N terminus of the
hrcA gene and its 5'-flanking region, using colony
hybridization on the genomic library of various restriction
enzyme-digested fragments. However, we were unable to obtain the
fragment encompassing the desired region of the hrcA gene.
This had also been the case for B. stearothermophilus hrcA
(13). Thus, we switched to a method based on cloning by
PCR, essentially as used for B. stearothermophilus hrcA. By
this PCR-based method, a 1.1-kbp DNA fragment was amplified as a single
band. The fragment was cleaved with EcoRI, and the larger
fragment was ligated to the vector plasmid pUC119 at the EcoRI site (pTY-1 [Fig. 1A]). The entire DNA sequence of
the cloned fragment in pTY-1 was determined. As expected, the fragment
contained the region coding for the N terminus of B. thermoglucosidasius hrcA and 300 bp of its 5'-flanking region. The
coding region further upstream of hrcA showed high sequence
similarity to the hemN gene of B. subtilis
(9). This indicates that the gene organization is
identical to that found in B. subtilis MB11
(10) and B. stearothermophilus NUB36 (7,
13). Between the stop codon of the hemN gene and the
start codon of the hrcA gene, there were 83-bp-long
intervening sequences. A set of vegetative promoters (TTGACA
for the
35 region and TACGTT for the
10 region)
and a genetic element consisting of a pair of 9-bp inverted repeats
separated by 9-bp spacers were also found in the intervening region
(Fig. 1B). The inverted repeats here are the CIRCE element of B. thermoglucosidasius KP1006, which precisely matches the CIRCE
elements of B. subtilis MB11 (29) and B. stearothermophilus NUB36 (13).
Purification and renaturation of B. thermoglucosidasius
HrcA.
Although intact B. thermoglucosidasius HrcA was
overexpressed in E. coli cells, the HrcA protein was hardly
detected in the soluble cell-free fraction by sodium dodecyl sulfate
(SDS)-PAGE analyses. The band for the HrcA protein was seen at the
position of the predicted molecular mass (39 kDa) only for the
whole-cell fraction, not for the cell extract (data not shown). This
indicates that B. thermoglucosidasius HrcA can be expressed
but is almost entirely insoluble. This characteristic also applies for
HrcA proteins from other bacteria. Thus, we modified the B. thermoglucosidasius hrcA gene to add a six-His tag at its N
terminus, using pET15-b plasmid. His-HrcA was then purified to
homogeneity by metal affinity chromatography under denaturing
conditions containing 6 M urea (Fig. 2A).
After purification, the effects of stepwise decreases in the urea
concentration were determined. Results from these analyses indicated
that His-HrcA could be hardly solubilized in less than 3 M urea.
|
Renatured HrcA protein binds to the CIRCE element without urea and GroEL. To provide evidence that HrcA proteins bind to the CIRCE element, excessive amounts of HrcA proteins from B. stearothermophilus NUB36 (12) and B. subtilis 168 (28) were used for the band shift assay for the DNA fragment containing the CIRCE element. However, these reaction mixtures still contained 0.5 M urea and/or GroEL to prevent further aggregation of HrcA. Therefore, we carried out band shift assays to examine whether B. thermoglucosidasius HrcA renatured with DNA can efficiently interact with the CIRCE element under in the absence of urea and GroEL.
His-HrcA protein was incubated at room temperature with a 330-bp DNA fragment containing the CIRCE element and end labeled with 32P. As seen in Fig. 3A, His-HrcA protein (0.10 µg, 2.4 pmol) retarded the entire probe DNA fragment (0.20 µg, 0.92 pmol) containing the CIRCE element (lane 2). If it is assumed that the renatured protein is 100% active, the molar ratio of HrcA and DNA would be 2.6:1. A lower amount of His-HrcA protein failed to induce a complete band shift for the probe. This result indicates that two to three HrcA molecules bind to the fragment. As reported previously, HrcA protein renatured by GroEL and ATP retarded at most only approximately 0.3 equivalents of the probe fragment (12). Therefore, the His-HrcA protein used here was demonstrated to be renatured to a more functional state and thus to interact with the fragment containing the CIRCE element more efficiently. On the other hand, His-HrcA protein retarded the nonspecific probe DNA with poor efficiency (lane 4). In competition assays (lanes 5 and 6), the excess amount of nonlabeled probe DNA containing the CIRCE element significantly inhibited the interaction of His-HrcA with the labeled specific probe DNA, while nonlabeled nonspecific probe DNA slightly affected retardation of the probe DNA. These results indicated that His-HrcA protein interacts far more strongly with DNA containing the CIRCE element than with any other DNA.
|
Light scattering assays revealed that DNA prevents HrcA from
aggregation without GroEL.
To confirm the effect of DNA on
renaturation of B. thermoglucosidasius HrcA, we investigated
the light scattering change of His-HrcA solution containing DNA. Light
scattering increases with time if the protein is aggregated. As seen in
Fig. 4A, plasmids pUC119 and pTY-1
suppressed the increase of light scattering. Addition of 50 µg of
pUC119 (7.4 nM) or 15 µg of pTY-1 (1.66 nM) to 25 µg of His-HrcA
protein (0.20 µM) prevented HrcA aggregation. The stationary level of
light scattering was dependent on the amount and species of DNA added.
Amounts of DNA lower than those indicated above could suppress
aggregation, but the stationary level of light scattering was elevated.
However, the level of light scattering did not increase even if the
reaction time was extended. These results indicate that HrcA has a
stronger interaction with the CIRCE element than with nonspecific DNA
and that the HrcA-DNA complex is stable under these conditions.
|
| |
DISCUSSION |
|---|
|
|
|---|
This work presents a convenient method to renature and solubilize B. thermoglucosidasius KP1006 HrcA with DNA. Previous attempts to perform in vitro studies for bacillary HrcA proteins have been impeded by the insolubility of the protein (12, 19). The presence of the denaturing agent urea and the chaperonin GroEL, which are somehow effective for renaturation of B. stearothermophilus HrcA, prevents direct analysis of the native nature of HrcA repressors (12). Therefore, using B. thermoglucosidasius KP1006 HrcA, which has features similar to those of B. stearothermophilus HrcA, we devised a method to renature and solubilize the protein in the absence of urea and GroEL. During assays with various reagents, we found that DNA can efficiently renature and solubilize B. thermoglucosidasius HrcA in a functional state that is free from urea and GroEL. The method utilizes the inherent capacity of B. thermoglucosidasius HrcA to bind to DNA.
Early work on DNA-dependent renaturation of an insoluble DNA-binding protein was reported by Egan and Schleif (5), who used sheared salmon sperm or calf thymus DNA in large excess to AraC and RhaS proteins. In contrast, we found here that widely available and nonspecific plasmid DNA can promote the refolding of B. thermoglucosidasius HrcA in quantitative amounts. We also found that DNA sheared by sonication (to about 200 to 500 bp in length) was less effective for renaturation, probably due to undetectable damage to the DNA that we prepared. While any species of DNA can renature B. thermoglucosidasius HrcA, DNA containing the CIRCE element is far more effective for renaturation than nonspecific DNA. This finding was also confirmed by the band shift and light scattering assays. Many DNA-binding proteins in addition to HrcA tend to aggregate during purification processes (4, 6). The types of protocols represented by our method using plasmid DNA and the work reported by Egan and Schleif (5) should prove useful for eliminating or minimizing solubility problems during the process of solubilization and renaturation of insoluble DNA-binding proteins.
The band shift assays shown in Fig. 3A provide a clue to the molecular relationships between B. thermoglucosidasius HrcA and the CIRCE element. Judging from the molecular ratio obtained (2.6:1), two or three B. thermoglucosidasius HrcA molecules bound to the CIRCE element. Previous studies on bacillary HrcA proteins failed to determine the molecular relationships with the CIRCE element since a large excess amount of HrcA was necessary for band shift assays due to the extreme insolubility (11, 12, 28). B. thermoglucosidasius HrcA is more likely to have such an oligomeric structure since DNA-binding proteins tend to be oligomeric (4, 27). In contrast to our observation, Ohta et al. visualized the binding of presumably monomeric S. aureus HrcA to the CIRCE element by atomic force microscopy (16). The low identity (31.2%) between B. thermoglucosidasius HrcA and S. aureus HrcA may explain the difference in the subunit structures of the proteins. More stoichiometric analysis is required to elucidate the precise molecular relationship. In addition, the results of light scattering assays (Fig. 4B) demonstrated that DNA containing the CIRCE element can keep B. thermoglucosidasius HrcA in the folded state more effectively and stably than GroEL. This suggests that the fate of HrcA molecules present in a cell should be dependent on whether the protein molecules bind to the CIRCE element under nonstress conditions.
While preparing this report, we became aware of a report that B. japonicum HrcA remained in a soluble form upon overproduction and during purification processes (11). The identity between B. japonicum HrcA and B. thermoglucosidasius HrcA was as low as 29.4% despite their common function to bind to the CIRCE element. We do not know the reason for the comparatively high solubility of B. japonicum HrcA. However, the fact that an excess amount of B. japonicum HrcA versus DNA was necessary for a complete band shift indicates that the repressor protein may precipitate from solution over time. By contrast, B. thermoglucosidasius HrcA solubilized with DNA does not precipitate for several weeks at 4°C.
How can we explain the implication of HrcA binding to nonspecific DNA? Two plausible explanations may be proposed based on two different viewpoints. From the viewpoint of repression, HrcA may possess two modes of binding to DNA. The first mode would be preliminary binding to nonspecific DNA, which would serve to assist the second mode binding to the CIRCE element for negative control of heat shock genes. This seems reasonable since there are only two copies of the CIRCE element in the genomic DNA of B. subtilis (15), while nonspecific DNA is abundant in a cell. From the viewpoint of protein refolding, nonspecific DNA may act as a ligand to promote refolding of HrcA. In this case, the DNA would prevent correctly folded HrcA from unfolding and aggregating just like chaperonin GroEL (12).
The thermostability of the B. thermoglucosidasius HrcA-DNA
complex containing the CIRCE element was examined in band shift and
light scattering assays. Its thermostability should be crucial in
investigating whether HrcA plays a role as a thermosensor for chaperone
expression. It is natural that B. thermoglucosidasius HrcA
exists on genomic DNA in cells to repress gene expression by binding to
the CIRCE element under nonstress conditions. Therefore, it seems
reasonable to assume that B. thermoglucosidasius HrcA renatured with DNA containing the CIRCE element in vitro would be
comparable to the native form of the repressor in vivo. As seen in Fig.
3B and 4C, B. thermoglucosidasius HrcA is stable below
50°C during a few minutes of incubation, but much of the protein is
denatured by treatment above 65°C. The susceptibility of B. thermoglucosidasius HrcA at higher temperatures suggests that the
protein may be detached from the CIRCE element after denaturation
caused by heat stress. The susceptibility is not affected by the
presence of GroEL (Fig. 4C), as seen in yeast
-glucosidase
(8). However, the denaturation of HrcA in our experiments
was mostly irreversible since thermally denatured HrcA failed to
re-form the complex with probe DNA upon incubation at the lower
temperature (data not shown). This irreversibility of denaturation
suggests that HrcA inactivated by heat stress is less likely to be
regenerated by chaperonin GroEL (Fig. 4C), and de novo HrcA synthesis
should be required when cells have recovered. This implies that
B. thermoglucosidasius HrcA may act as a thermosensor, and
the thermal inactivation of HrcA protein may affect heat stress gene
expression as an alternative. Most probably, de novo HrcA synthesis and
effective refolding of newly synthesized HrcA by GroEL are key for
initiation of the negative control of heat shock genes
(28).
We suggest that HrcA may be a thermosensor to affect the expression of heat shock genes, while the overall flow of negative gene regulation is dependent on how HrcA can be effectively refolded by GroEL. We plan to analyze more native features of B. thermoglucosidasius HrcA and determine the basis of its physical interaction with GroEL.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Applied Biochemistry, Kyoto Prefectural University, Shimogamo, Sakyo, Kyoto 606-8522, Japan. Phone and fax: (81) 75-703-5667. E-mail: kwatanab{at}kpu.ac.jp.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Ahmad, S.,
A. Selvapandiyan, and R. K. Bhantnagar.
1999.
A protein-based phylogenetic tree for gram-positive bacteria derived from hrcA, a unique heat-shock regulatory gene.
Int. J. Syst. Bacteriol.
49:1387-1394 |
| 2. | Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1989. Current protocols in molecular biology. John Wiley & Sons, New York, N.Y. |
| 3. | Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254[CrossRef][Medline]. |
| 4. | Dorman, C. J., J. C. Hinton, and A. Free. 1999. Domain organization and oligomerization among H-NS-like nucleoid-associated proteins in bacteria. Trends Microbiol. 7:124-128[CrossRef][Medline]. |
| 5. | Egan, S. M., and R. F. Schleif. 1994. DNA-dependent renaturation of an insoluble DNA binding protein. Identification of the RhaA binding site at rhaBAD. J. Mol. Biol. 243:821-829[CrossRef][Medline]. |
| 6. | Grob, P., and D. G. Guiney. 1996. In vitro binding of the Salmonella dublin virulence plasmid regulatory protein SpvR to the promoter regions of spvA and spvR. J. Bacteriol. 178:81-84. |
| 7. | Herbort, M., U. Schön, K. Angermann, J. Lang, and W. Schumann. 1996. Cloning and sequencing of the dnaK operon of Bacillus stearothermophilus. Gene 170:81-84[CrossRef][Medline]. |
| 8. |
Höll-Neugenbauer, B.,
R. Rudolph,
M. Schmidt, and J. Buchner.
1991.
Reconstitution of a heat shock effect in vitro: influence of GroE on the thermal aggregation -glucosidase from yeast.
Biochemistry
30:11609-11614[CrossRef][Medline].
|
| 9. |
Homuth, G.,
M. Heineman,
U. Zuber, and W. Schumann.
1996.
The genes lepA and hemN form a bicistronic operon in Bacillus subtilis.
Microbiology
142:1641-1649 |
| 10. |
Homuth, G.,
S. Masuda,
A. Mogk,
Y. Kobayashi, and W. Schumann.
1997.
The dnaK operon of Bacillus subtilis is heptacistronic.
J. Bacteriol.
179:1153-1164 |
| 11. |
Minder, A.,
H. Fischer,
H. Hennecke, and F. Narberhaus.
2000.
Role of HrcA and CIRCE in the heat shock regulatory network of Bradyrhizobium japonicum.
J. Bacteriol.
182:14-22 |
| 12. | Mogk, A., G. Homuth, C. Scholz, L. Kim, F. X. Schmid, and W. Schumann. 1997. The GroE chaperonine machine is a major modulator of the CIRCE heat shock regulon of Bacillus subtilis. EMBO J. 16:4579-4590[CrossRef][Medline]. |
| 13. | Mogk, A., and W. Schumann. 1997. Cloning and sequencing of the hrcA gene of Bacillus stearothermophilus. Gene 194:133-136[CrossRef][Medline]. |
| 14. |
Nakahigashi, K.,
E. Z. Ron,
H. Yanagi, and T. Yura.
1999.
Differential and independent roles of a 32 homolog (RpoH) and an HrcA repressor in the heat shock response of Agrobacterium tumefaciens.
J. Bacteriol.
181:7509-7515 |
| 15. | Narberhaus, F. 1999. Negative regulation of bacterial heat shock genes. Mol. Microbiol. 31:1-8[CrossRef][Medline]. |
| 16. | Ohta, T., S. Nettikandan, F. Tokumasu, H. Ideno, Y. Abe, M. Kuroda, H. Hayashi, and K. Takeyasu. 1996. Atomic force microscopy proposes a novel model for stem-loop structure that binds a heat shock protein in the Staphylococcus aureus HSP70 operon. Biochem. Biophys. Res. Commun. 226:730-734[CrossRef][Medline]. |
| 17. | Rüngeling, E., T. Laufen, and H. Bahl. 1999. Functional characterization of the chaperones DnaK, DnaJ and GrpE from Clostridium acetobutylicum. FEMS Microbiol. Lett. 170:119-123[Medline]. |
| 18. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 19. |
Schulz, A., and W. Schumann.
1996.
hrcA, the first gene of the Bacillus subtilis dnaK operon, encoding a negative regulator of class I heat shock genes.
J. Bacteriol.
178:1088-1093 |
| 20. | Studier, F. W. 1991. Use of bacteriophage T7 lysozyme to improve an inducible T7 expression system. J. Mol. Biol. 219:37-44[CrossRef][Medline]. |
| 21. | Suzuki, Y., T. Kishigami, K. Inoue, Y. Mizouchi, N. Eto, M. Takagi, and S. Abe. 1983. Bacillus thermoglucosidasius sp nov., a new species of obligately thermophilic bacilli. Syst. Appl. Microbiol. 4:487-495. |
| 22. |
Suzuki, Y.,
T. Yuki,
T. Kishigami, and S. Abe.
1976.
Purification and properties of extracellular -glucosidase of a thermophile, Bacillus thermoglucosidius KP1006.
Biochim. Biophys. Acta
445:386-397[Medline].
|
| 23. | Vieira, J., and J. Messing. 1987. Production of single-stranded plasmid DNA. Methods Enzymol. 153:3-11[Medline]. |
| 24. |
Watanabe, K.,
H. Iha,
A. Ohashi, and Y. Suzuki.
1989.
Cloning and expression in Escherichia coli of an extremely thermostable oligo-1,6-glucosidase gene from Bacillus thermoglucosidasius KP1006.
J. Bacteriol.
171:1219-1222 |
| 25. | Watanabe, K., and Y. Suzuki. 1998. Protein thermostabilization by proline substitutions. J. Mol. Catal. B Enzym. 4:167-180[CrossRef]. |
| 26. | Watanabe, K., T. Iwashiro, and Y. Suzuki. 2000. Features of dnaK operon genes of the obligate thermophile Bacillus thermoglucosidasius KP1006. Antonie Leeuwenhoek 77:241-250. |
| 27. | Weigel, C. A. Schmidt, H. Seitz, D. Tungler, M. Welzeck, and W. Messer. 1999. The N-terminus promotes oligomerization of the Escherichia coli initiator protein DnaA. Mol. Microbiol. 34:53-66[CrossRef][Medline]. |
| 28. |
Yuan, G., and S. L. Wong.
1995.
Isolation and characterization of Bacillus subtilis groE regulatory mutants: evidence for orf39 in the dnaK operon as a repressor gene in regulating the expression of both groE and dnaK.
J. Bacteriol.
177:6462-6468 |
| 29. |
Zuber, U., and W. Schumann.
1994.
CIRCE, a novel heat shock element involvement in regulation of heat shock operon dnaK of Bacillus subtilis.
J. Bacteriol.
176:1359-1363 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»