Previous Article | Next Article 
Journal of Bacteriology, January 2001, p. 229-234, Vol. 183, No. 1
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.1.229-234.2001
The KlGpa1 Gene Encodes a G-Protein
Subunit That Is a Positive Control Element in the Mating Pathway of
the Budding Yeast Kluyveromyces lactis
Alma L.
Saviñón-Tejeda,
Laura
Ongay-Larios,
Julián
Valdés-Rodríguez, and
Roberto
Coria*
Departamento de Genética Molecular,
Instituto de Fisiología Celular, Universidad Nacional
Autónoma de México, 04510 México, D.F., México
Received 11 July 2000/Accepted 4 October 2000
 |
ABSTRACT |
The cloning of the gene encoding the KlGpa1p subunit was achieved
by standard PCR techniques and by screening a Kluyveromyces lactis genomic library using the PCR product as a probe. The
full-length open reading frame spans 1,344 nucleotides including the
stop codon. The deduced primary structure of the protein (447 amino acid residues) strongly resembles that of Gpa1p, the G-protein
subunit from Saccharomyces cerevisiae involved in the
mating pheromone response pathway. Nevertheless, unlike disruption of Gpa1 from S. cerevisiae, disruption of
KlGpa1 rendered viable cells with a reduced capacity to
mate. Expression of a plasmidic KlGpa1 copy in a
Klgpa1 mutant restores full mating competence; hence we
conclude that KlGpa1p plays a positive role in the mating pathway.
Overexpression of the constitutive subunit KlGpa1p(K364)
(GTP bound) does not induce constitutive mating; instead it partially
blocks wild-type mating and is unable to reverse the sterile phenotype
of
Klgpa1 mutant cells. K. lactis expresses a second G
subunit, KlGpa2p, which is involved in regulating cyclic
AMP levels upon glucose stimulation. This subunit does not rescue
Klgpa1 cells from sterility; instead, overproduction of
KlGpa2p slightly reduces the mating of wild-type cells, suggesting cross talk within the pheromone response pathway mediated by KlGpa1p and glucose metabolism mediated by KlGpa2p. The
Klgpa1
Klgpa2 double mutant, although viable, showed the mating
deficiency observed in the single
Klgpa1 mutant.
 |
INTRODUCTION |
Saccharomyces cerevisiae
cells respond to mating pheromones by inducing activation of a G
protein coupled to serpentine receptors (reviewed in reference
17). The G protein, composed of G
(Gpa1p), G
(Ste4p), and G
(Ste18p) subunits, activates a phosphorylation cascade that involves at least Ste20p, the mitogen-activated protein kinase module, and transcription activators (reviewed in reference 9) that finally induce growth arrest, shmoo formation,
induction of genes required for membrane fusion, including
Fus1, and diploid formation. Epistasis analysis has
established that the mating response is mediated by the Ste4
and Ste18 gene products and that lack of Gpa1p in S. cerevisiae confers lethality and lack of either Ste4p or Ste18p
gives rise to sterility (6, 29).
A second G
(Gpa2p) subunit (19) was identified and was
involved, along with Ras2p, in the activation of adenylyl cyclase to
induce cyclic AMP (cAMP) production in response to glucose stimulus.
Isolation of Gpr1p, the seven-transmembrane segment receptor coupled to
Gpa2p, showed that the Gpr1p/Gpa2p pathway acts in parallel to the
Ras/cAMP pathway monitoring nutrient signals (4, 30). It
has been shown that Gpa2p regulates growth and pseudohyphal development
generated by nitrogen starvation (14).
In S. cerevisiae Gpa1p and Gpa2p subunits play divergent and
unrelated roles in signal transduction, since Gpa1p does not participate in the integration of nutrient signals and Gpa2p does not
participate in the pheromone response pathway required for mating.
Kluyveromyces lactis is a heterothallic budding yeast
that is essentially aerobic (reviewed in reference 28).
Its life cycle resembles that of S. cerevisiae, and the
haploid and diploid vegetative growth and sexual reproduction of the
two are highly similar. K. lactis shows two mating partners
that undergo sexual reproduction when they respond to sexual
pheromones. Mata and Mat
cells are able
to mate with each other to produce transient diploids that sporulate to
generate four spores that germinate to haploid clones of two different
mating types (8). We hypothesize that an S. cerevisiae-like pheromone response pathway is conserved in
K. lactis. In fact a gene encoding a protein highly
homologous to the
mating factor of S. cerevisiae has
been identified (3). This sexual pheromone is thought to
activate a pathway that finally turns on transcription factor KlSte12p
(31). This factor is thought to bind to pheromone response
elements located in promoter regions of genes required for mating. We
are interested in searching for homologue genes coding for components
of the G protein putatively involved in transducing the pheromone
stimulus. In particular, here we describe the characterization of a
gene encoding a G
subunit that participates in the mating
pathway. Like S. cerevisiae, K. lactis expresses
a second G
subunit (Gpa2p) that is directly involved in regulation
of cAMP levels in response to glucose stimulus (25).
 |
MATERIALS AND METHODS |
Strains, plasmids, and media.
K. lactis strains used
in this study were WM37 (NRRL Y-1140) (Mata
his3); MD2/1 (MATa argA lysA uraA)
(obtained from H. Fukuhara); 12/8 (Mata argA lysA
uraA), a segregant of the cross between WM37 and MD2/1 that was
used as tester strain; 155 (Mat
ade2 his3 uraA), a
segregant of the cross between MD2/1 and KA5-6C (Mata
ade2 his3 leu1), of unknown origin (obtained from A. Brunner); and 136 (Mata argA his3 uraA), a
segregant of the cross between WM37 and MD2/1. Homozygotic his3
uraA diploids were freshly generated by crossing strain 155 with
strain 136. S. cerevisiae strains used in this study were
W303-1A (Mata ade2-1 his3 leu2 trp1 ura3
can1-100), W303-3B (Mata ade2-1 his3 leu2 trp1
ura3 can1-100 scg1::Ura3), and 70 (Mat
thr3). Escherichia coli strain DH
5 was
used to propagate plasmids. Phagemid pTZ18R was used to subclone DNA
fragments for sequencing. Vector YEpKD, which contains the
Ura3 marker, was constructed by replacing the 2µm
replication origin of vector YEp352 (10) by replication origin pKD from vector KEp6 (obtained from H. Fukuhara). Vector YEpKDHis was constructed by replacing the Ura3 marker
by the His3 marker in YEpKD. The multicopy plasmid
YEpKDHis-KlGpa1 was constructed by subcloning a 2.2-kb
PstI fragment carrying the complete KlGpa1 open reading
frame (ORF) into YEpKDHis digested with the same enzyme. This places
KlGpa1 under the control of its own promoter. YEpKDHis-KlGpa2 was constructed by subcloning a 1.9-kb
SalI-BamHI fragment that carries the KlGpa2 ORF
and its promoter into YEpKDHis digested with the same enzymes.
Construction of a genomic DNA library from K. lactis was
described previously (18). YPD medium contained 1% yeast
extract, 1% Bacto peptone, and 2% glucose. SD medium contained 0.67%
yeast nitrogen base without amino acids, 2% glucose, and 25 mg of the
required amino acids/ml. Luria-Bertani medium supplemented with 50 mg
of ampicillin/ml was used to grow recombinant bacteria.
PCR-mediated mutagenesis.
Construction of
KlGpa1p(K364) was done by standard PCR amplification. The
5' AATATCTACTTTTTTTAAGAATAGT 3' oligodeoxynucleotide (from position
1077 to 1101), which replaces cytosine with adenine at position 1089 of
the sense strand (thereby replacing N364 with K in the
putative protein), was used as the backward primer in a reaction that
yielded a 277-bp amplification product. This fragment was then used as
the forward primer in a second reaction that yielded a 643-bp product
containing the naturally occurring sites ClaI (position
1016) and BstEII (93 bp beyond the stop codon). The
ClaI-BstEII fragment was then subcloned back into
the original wild-type gene. PCR conditions were as follows: 94°C for
5 min; 50 cycles of 94°C for 30 s, 45°C for 45 s, and
72°C for 60 s; and a final extension of 10 min at 72°C.
Cloning and sequencing.
The screening of a K. lactis genomic DNA library was done using the PCR product as a
probe labeled with [
-32P]dCTP by random-primer
DNA-labeling systems (Life Technologies). Positive clones were mapped
with restriction enzymes, and one of them, containing the full gene,
was sequenced in an automatic sequencer (ABI Prism 310; Applied
Biosystems) at the Molecular Biology Facilities of the Instituto de
Fisiología Celular, Universidad Nacional Autónoma de
México. The sequence was analyzed using the GCG program from the
Wisconsin Sequence Analysis Package.
Gene disruption.
The Ura3 marker, obtained as an
HpaI/BamHI fragment (filled-in HpaI),
was inserted into KlGpa1 previously digested at the naturally occurring sites XhoI (position 770) and
BamHI (position 914) (filled-in XhoI). The
resulting plasmid was treated with BglII, which digests
KlGpa1 at positions 377 and 1119, to give rise to a cassette
that carries the Ura3 marker flanked by fragments of 138 and
218 bp of the Klgpa1 ORF. This cassette was used to transfect haploid and diploid strains. Disruption of the
KlGpa2 allele with the Ura3 marker was described
previously (25). Disruption of KlGpa2 with the
His3 cassette was as follows. The KlGpa2 gene was
opened with BglII at positions 348, 408, and 478. A 1.8-kb BamHI fragment containing the His3 gene was then
inserted. This construction was used as the template in a PCR using
primers directed against KlGpa2 at positions 145 (forward)
and 691 (backward), giving rise to a cassette containing the
His3 gene flanked by KlGpa2 sequences of 204 and
213 bp, respectively. This was used to transfect haploid and diploid
strains. Disruptions were confirmed by Southern blotting techniques.
Southern blot and Northern blot analysis.
Chromosomal and
plasmidic DNA blots as well as RNA blots were hybridized with a
32P-labeled probe; the probe was labeled with the randomly
primed system kit (Gibco BRL). Blots were hybridized overnight at
55°C and washed twice with 2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-0.5% sodium dodecyl sulfate (SDS) and twice with
1× SSC-0.1% SDS. All washes were done at 65°C for 10 min.
Mating assays.
A patch of cells of the strain to be tested
was grown on a plate of selective medium for 24 h. The tester
strain was grown as a lawn on a YPD plate for 24 h. Both strains
were replica plated onto a YPD plate and incubated overnight at 30°C
to allow cells to mate. Diploids were selected on SD medium by replica
plating. For quantitative mating assays, strains to be tested were
grown until mid-log phase in YPD medium. Then 106 cells
were mixed with 106 cells of the tester strain, collected
on a nitrocellulose membrane filter, placed on a YPD plate, and
incubated overnight at 30°C. The cells from each filter were
suspended in water, diluted, and plated on SD medium.
Two-hybrid interaction assays.
Assays of physical
interaction were done with the LexA-B42 two-hybrid systems as described
previously (7). S. cerevisiae Gpa1 and
Ste4 genes were subcloned into pJG4-5 and pEG202 as
described previously (21). KlGpa1 and
KlGpa2 were amplified by PCR, introducing NcoI
(position
1) and EcoRI (position
5)/BamHI (18 nucleotides after the stop codon) sites, respectively. PCR products
were subcloned in frame into pEG202.
Other.
Expression of Fus1-LacZ fusion was done as
described previously (21). Molecular biology procedures
were performed as described by Sambrook et al. (24).
Standard yeast genetics procedures were done as described by Sherman et
al. (26).
Nucleotide sequence accession number.
The sequence obtained
in this study has been assigned GenBank accession no. AF135552.
 |
RESULTS |
By means of PCR we were able to amplify two products belonging to
genes encoding
subunits of heterotrimeric G proteins. We have
already demonstrated that one of these genes, KlGpa2, encodes a subunit directly involved in the regulation of cAMP levels in
K. lactis (25). Cells lacking KlGpa2p are
viable but fail to respond to transient stimulus by glucose and the
cAMP level drops significantly, indicating that the G protein
containing KlGpa2p is involved in regulating the activity of adenylyl
cyclase and participates in a pathway related to monitoring the
nutrient status of the cell (25).
The other PCR product was used as a probe to screen a K. lactis genomic library, looking for the full-length gene. Two
positive clones were obtained; one showed a 2.2-kb PstI
fragment that contained the complete ORF, as inferred from Southern
blot analysis. The full sequence of this fragment contains an ORF of
1,344 nucleotides including the stop codon, which codes for a putative
protein of 447 amino acid residues with a molecular mass of 50,739 Da.
Analysis of the deduced primary structure of the protein showed a high
degree of identity with the Gpa2p from K. lactis and with
the Gpa proteins from S. cerevisiae. Close examination
revealed 64% identity and 72% similarity with the Gpa1p from S. cerevisiae. Based on these criteria it could be that the cloned
gene encodes the putative homologue of the G
involved in the mating
pathway of S. cerevisiae. The deduced primary structure of
the protein (KlGpa1p) shows the characteristic structural domains
conserved in G
subunits from different organisms (Fig.
1). It shows the typical G1 and G2
regions involved in the binding and hydrolysis of the guanine
nucleotide. It also shows the consensus amino terminus end (MG-XXXSXX)
that has been identified as an N-myristoylation target in members of
the mammalian G
i family (11); however, unlike members
of this family, KlGpa1p does not contain the cysteine residue at its
carboxyl end that is ADP ribosylated by pertussis toxin
(12), sharing this characteristic with the yeast G
subunits known so far. Like Gpa1p from S. cerevisiae,
KlGpa1p shows an extra internal fragment of 75 amino acid residues
between the conserved G1 region and the first module of the G2 region
(Fig. 1).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 1.
Primary structure of yeast G subunits. Rectangles
below protein, inserts bigger than 29 amino acids. Amino acid sequences
at the amino terminus are aligned, showing the consensus sequence for
N-myristoylation. G1 and G2, conserved regions for guanine nucleotide
binding and hydrolysis domains. Deviations from conserved sequences are
boxed. N-to-K replacement at the G2 region that in S. cerevisiae confers the constitutive mating response is indicated.
Kl, K. lactis; Sc, S. cerevisiae; Sp, S. pombe; Ca,
Candida albicans; Cn, C. neoformans.
|
|
In the budding yeast S. cerevisiae, the heterotrimeric G
protein composed of the Gpa1p (G
), Ste4p (G
), and Ste18p (G
)
subunits mediates pheromone-induced growth arrest. Activation of the G protein promoted by the binding of pheromone involves dissociation of
the
subunit from the 
dimer, which in turn activates a cascade signal that induces the expression of genes whose products are
needed for conjugation (17). Lack of Gpa1p produces
arrested cells with a transient ability to mate, indicating that Gpa1p plays a negative role in the response to the mating pheromone. We
tested if lack of KlGpa1p has the same effect on the pheromone response
pathway of K. lactis. Disruption of KlGpa1 of the
strain 155 (Mat
ade2 his3 uraA) was done by homologous
recombination using a cassette containing the Ura3 marker
flanked by fragments of 393 (from position 377 to 770) and 206 bp (from
position 914 to 1119), respectively. Disruption of the gene and lack of
its messenger were confirmed by Southern blot and Northern blot
analyses, respectively (data not shown). Unlike what was found for
disruption of Gpa1, which causes shmoo formation and
lethality in S. cerevisiae (6), K. lactis haploid cells carrying the disrupted allele were viable
(Fig. 2A) and no significant effect on
morphology and doubling time was observed. Although in mating cultures
wild-type K. lactis cells do not show visible shmoo
morphology, we have observed that the number of budding cells is
reduced two- to threefold, which suggests that growth arrest is induced
by the mating partner. In addition, the disrupted strain had a dramatic
impairment in mating (Fig. 2A) and forming diploids, showing a 20-fold
reduction from the wild-type efficiency. This defect is totally
reversed by expression of wild-type KlGpa1 under the control
of its own promoter (Fig. 2B). Disruption of KlGpa1 in a
Mata background (strain 12/8 [Mata
argA lysA uraA]) has the same effect as that in the
Mat
cell, i.e., a 20- to 30-fold reduction of mating
efficiency, and the level of mating of both disrupted strains (
Klgpa1 ×
Klgpa1) is 0.001 of the
wild-type level. Besides, after 72 h of incubation diploids appear
in the selective medium.

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Effect of KlGpa1 and KlGpa2
disruption on growth properties and mating of K. lactis
cells. Strain 155 (Mat ade2 his3 uraA), containing the
wild-type (W.T.) or the disrupted alleles, was grown for 24 h on
YPD plates (left) and then was replica plated to a YPD plate containing
a lawn of the strain 12/8 (Mata argA lysA uraA)
and incubated overnight at 30°C to allow cells to mate. Diploids were
selected on SD medium supplemented with uracil (right). Numbers in
parentheses, mating efficiencies relative to that of the wild type.
Cells of the strain to be mated were combined with cells of the tester
strain (12/8) on nitrocellulose membrane filters, placed on the surface
of a YPD plate, and incubated overnight at 30°C. Cells were diluted
and plated on SD medium. Mating efficiency is defined as the number of
diploids divided by the number of haploids of the strain being tested.
(B) The Klgpa1 strain carrying either YEpKDHis or
YEpKDHis-KlGpa1 was grown on YPD medium for 24 h. Patches were
replica plated to a YPD plate containing a lawn of the tester strain,
incubated overnight at 30°C, and replica plated to selective medium
for diploids. Mating efficiencies (in parentheses) were calculated as
for panel A.
|
|
On the other hand, disruption of KlGpa2 did not affect
viability or mating (Fig. 2A). As we showed, cells lacking KlGpa2p have
a slight increase in doubling time and reach stationary phase much
earlier than wild-type cells (25), indicating that they have a defect in monitoring nutrient conditions of the medium.
One possible explanation for the apparent sterile phenotype of
KlGpa1 is that an excess of KlGpa2p is able to bind free

produced either by pheromone activation or by lack of KlGpa1p. If this assumption is true, then overproduction of KlGpa2p should block
the mating of wild-type cells and the double mutant (
Klgpa1
Klgpa2) should be lethal and transiently able to mate. To test this hypothesis, we transfected wild-type cells with a multicopy plasmid carrying KlGpa2 under the control of its own
promoter. As shown in Fig. 3, mating was
slightly reduced, indicating that KlGpa2p has the potentiality to
interfere with the pheromone response pathway. As mentioned earlier,
KlGpa2p does not participate in the mating pathway, since cells devoid
of this subunit are viable and able to mate at wild-type levels. In
addition we constructed the
Klgpa1
Klgpa2
mutant. Disruption of both G
alleles was done in a homozygous
ura3/ura3 hisA/hisA diploid with the
Klgpa1::Ura3 and
Klgpa2::His3 cassettes. Disruption was
further confirmed by Southern blot analysis, and the lack of their
messengers was confirmed by Northern blotting. The double-mutant
diploid was then transferred to sporulation medium, and 10 tetrads were
dissected. A first observation was that sporulation of the double
mutant was deficient compared with that of wild-type cells and with
that of the
Klgpa2 strain, i.e., wild-type cells and the
mutant lacking KlGpa2p yielded four viable spores. Sporulation of the
double mutant was deficient, and in most cases only three spores were
able to grow. The inviable spores had either a
gpa1 or
gpa1
gpa2 genotype. This result may suggest that the
product of KlGpa1 is necessary for proper sporulation of
diploid cells. Auxotrophic markers were tested in haploid segregants,
and surprisingly clones having both Ura+ and
His+ alleles were obtained. This striking result
indicates that the
Klgpa1
Klgpa2 double mutant is
viable (Fig. 4). In this double mutant
the sterility impairment observed in the
Klgpa1 strain persisted (Fig. 4). Double-mutant cells carrying the KlGpa1
gene under the control of its own promoter grew normally and were able to mate (not shown), which indicates that KlGpa1p is required to
trigger the pheromone response pathway in K. lactis.

View larger version (95K):
[in this window]
[in a new window]
|
FIG. 3.
Strain 155, transfected with either YEpKDHis or
YEpKDHis-KlGpa2, was grown and mated as indicated for Fig. 2B.
Patches of diploid cells were selected on SD supplemented with uracil.
Mating efficiencies (in parentheses) were calculated as indicated for
Fig. 2A. W.T., wild type.
|
|

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 4.
The wild type (W.T.) and the Klgpa1
Klgpa2 double mutant were grown and mated as indicated for Fig.
2. (Right) Growth on YPD medium. (Left) Diploids grown on SD selective
medium. Mating efficiencies (in parentheses) were calculated as
indicated for Fig. 2A.
|
|
All these observations suggest that KlGpa1p has a positive role in
mating and that its activation by a pheromone via a receptor (if this
is the case) is a required step for conjugation. In S. cerevisiae cells, constitutive activation of Gpa1p, achieved by replacing asparagine 388 with lysine, induces growth arrest and morphology defects in the absence of a pheromone (15). We
tested the effect that the equivalent constitutively active
KlGpa1 allele, i.e., KlGpa1p(K364)
(Fig. 1), has in the mating properties of K. lactis by
transfecting both wild-type and
Klgpa1 cells. Figure
5 shows that, rather than bypassing the
pheromone requirement for mating, KlGpa1p(K364) reduces
mating in wild-type cells and is unable to restore the mating
competence of the
Klgpa1 mutant. Cells expressing the constitutively active KlGpa1 allele are still viable and do
not have a significantly different doubling time.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 5.
Wild-type (W.T.) (A) and Klgpa1 (B)
strains transfected with vector alone, vector plus KlGpa1,
or vector plus KlGpa1(K364) were grown and mated
as indicated for Fig. 2. Diploids were selected on SD medium. Mating
efficiencies (in parentheses) were calculated as indicated for Fig.
2A.
|
|
Finally we tested the effects that expression of both KlGpa1p and
KlGpa2p have on the mating response pathway of S. cerevisiae. While no significant effect was observed in a
qualitative experiment of diploid formation, i.e., S. cerevisiae cells carrying either KlGpa1 or
KlGpa2 mate normally, we observed a weak effect of KlGpa1p on the expression of Fus1 measured with the Fus1-LacZ fusion
(21). Wild-type cells expressing KlGpa1 in a
multicopy plasmid show 1.5-times-lower
-galactosidase activity than
cells carrying the vector alone. Although in vivo KlGpa1p does not seem
to rescue S. cerevisiae
gpa1 cells from lethality, we
were able to observe the association between KlGpa1p and the Ste4p
(G
) subunit using the two-hybrid assay (data not shown). Indeed,
association experiments indicated that KlGpa1p has an interaction that
is almost 20% that of the cognate Gpa1p-Ste4p association. KlGpa2p
fails to show any association with Ste4p in these assays.
 |
DISCUSSION |
We have isolated the K. lactis Gpa1 gene, which encodes
a heterotrimeric G
subunit homologue. The deduced primary structure of the protein predicts similarities with G
subunits from different species of yeast. In fact it shows, depending on the exact alignment, 72% similarity and 64% identity with its S. cerevisiae counterpart.
The functional role of KlGpa1p was inferred from genetic studies of a
Klgpa1-disrupted strain. Disruption of the KlGpa1
allele resulted in haploid viable cells with a strong deficiency in
mating. In contrast, Gpa1p from S. cerevisiae has a negative
role in the pheromone response pathway, i.e., disruption of the
associated gene causes arrested cells in G1 phase with a
transient ability to mate, while its overexpression reduces the
pheromone response and mating. Therefore, K. lactis seems to
be the first example of budding yeast where Gpa1p is a positive element
in the mating pathway. G
subunits playing positive roles in mating
have been described in other yeasts: Gpa1p and Gpa3p in the
basidiomycetes Cryptococcus neoformans (1, 27)
and Ustilago maydis (23), respectively, and
Gpa1p in the fission yeast Schizosaccharomyces pombe
(20).
In S. cerevisiae cells, the G
dimer transmits a
pheromone signal to downstream elements to facilitate mating (5,
29). If parallelism can be drawn between the K. lactis and S. cerevisiae mating pathways, the mating
inhibition effect of KlGpa2p could come from its interaction with the
G
dimer. In fact
Klgpa1 cells, although sterile,
show a weak ability to mate (Fig. 2), which indicates that other gene
products (e.g., G
) are participating in the mating pathway. In
this model of cooperative KlGpa1p and G
signaling, activation of
KlGpa1p by artificial means [i.e., KlGpa1p(K364)] should
bypass the pheromone requirement and cells should increase mating. In
fact the opposite is true, i.e., the activated form of KlGpa1p (GTP
bound) does not rescue
Klgap1 cells from sterility and
also reduces the mating of wild-type cells (Fig. 5). This indicates
that the real situation is more complex and suggests that mating
depends on a delicate balance of active and inactive forms of G
. The
hypothesis that points to a cooperative role for G
in mating
remains to be proved, especially since the identified G
subunit in
S. pombe may play an inhibitory role in mating as described
previously (13) and/or could be involved in the regulation of adenylate cyclase in response to glucose detection
(16). In fact, we have identified the putative
KlSte4 gene (unpublished results), which encodes a protein
with 48% identity to ScSte4p. Unlike the G
subunit of S. pombe (13, 16), KlSte4p contains the amino-terminal
coiled-coil structure found in ScSte4p, which indicates that this
protein has the potentiality to associate to a G
subunit. Therefore,
it becomes essential to investigate the putative role that the G
subunit may play in the pheromone response pathway of K. lactis. Failure of cells expressing the KlGpa1p(K364)
subunit to enter into growth arrest and induce mating may serve as a
useful screen to identify the putative positive effector of KlGpa1p.
K. lactis has at least two G-protein
subunits that are
involved in two different pathways. While KlGpa1p participates in the
mating pathway, KlGpa2p is implicated in regulation of the adenylyl
cyclase (25) and, as we showed here, is able to partially interfere with mating. These data suggest cross talk between these two
proteins and, although we have not investigated a possible role of
KlGpa1p in cAMP regulation, a relationship between cAMP and mating
signaling pathways may exist. In fact, it has been shown that, in
S. cerevisiae cells, the
pheromone suppresses glucose-stimulated cAMP formation (2). This effect is
dependent on the Ste2 receptor and the Ste4p subunit and may involve
the G
subunit encoded by the Gpa2 gene (22).
Although KlGpa1p from K. lactis is structurally colinear and
shows high similarity with its S. cerevisiae counterpart, it plays a divergent role. In fact, it is unable to functionally replace
Gpa1p, which, in S. cerevisiae, connects the pheromone stimulus with the mating response. It may be that, although KlGpa1p may
interact with Ste4p, as seen in the association experiments, it cannot
be activated by the pheromone-bound receptor.
The results here described point to the model in which, in K. lactis, Gpa1p functions as a positive factor that transmits the
signal from a pheromone receptor to a downstream effector(s). In this
respect the KlGpa1p subunit is equivalent to G
subunits from other
yeast species and even to mammalian subunits, which places the Gpa1p of
S. cerevisiae in a special context within the metazoan G
subunits.
Besides the evolutionary relationship between these budding yeasts and
the similarities that they share in sexual reproduction, it seems that
they have developed divergent mechanisms for pursuing the same goal,
i.e., mating of haploid cells.
 |
ACKNOWLEDGMENTS |
This work was supported in part by grants 2259PN and 28015N from
the Consejo Nacional de Ciencia y Tecnología, México, and grant 102369 from PAEP, UNAM, to A.L.S.-T.
We are grateful to Gerardo Coello and Ana M. Escalante for sequence
analysis of KlGpa1. We acknowledge the technical assistance of Soledad Guevara. We are grateful to Marcela Sosa and Guadalupe Codiz
(staff of the Molecular Biology Facilities at the IFC) for assistance.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Departamento de
Genética Molecular, Instituto de Fisiología Celular,
Universidad Nacional Autónoma de México, Apartado Postal
70-242, 04510 México, D.F., México. Phone: (525) 622 56 52. Fax: (525) 622 56 30. E-mail: rcoria{at}ifisiol.unam.mx.
 |
REFERENCES |
| 1.
|
Alspaugh, J. A.,
J. R. Perfect, and J. Heitman.
1997.
Cryptococcus neoformans mating and virulence are regulated by the G-protein subunit Gpa1 and cAMP.
Genes Dev.
11:3206-3217[Abstract/Free Full Text].
|
| 2.
|
Arkinstall, S. J.,
S. G. Papasavvas, and M. A. Payton.
1991.
Yeast -mating factor receptor-linked G-protein signal transduction suppresses Ras-dependent activity.
FEBS Lett.
284:123-128[CrossRef][Medline].
|
| 3.
|
Brake, A.,
B. Irvine,
F. Masiarz, and K. Shultz.
1988.
Structure of genes encoding precursors of two Kluyveromyces lactis transported proteins.
Yeast
4:S436.
|
| 4.
|
Cheol-Won, Y.,
H. Tamaki,
R. Nakayama,
K. Yamamoto, and H. Kumagai.
1997.
G-protein coupled receptor from Saccharomyces cerevisiae.
Biochem. Biophys. Res. Commun.
240:287-292[CrossRef][Medline].
|
| 5.
|
Cole, G. M.,
D. E. Stone, and S. I. Reed.
1990.
Stoichiometry of G protein subunits affects the Saccharomyces cerevisiae mating pheromone signal transduction pathway.
Mol. Cell. Biol.
10:510-517[Abstract/Free Full Text].
|
| 6.
|
Dietzel, C., and J. Kurjan.
1987.
The yeast SCG1 gene: a G -like protein implicated in the a- and -factor response pathway.
Cell
50:1001-1010[CrossRef][Medline].
|
| 7.
|
Gyuris, J.,
E. Golemis,
H. Chertkov, and R. Brent.
1993.
Cdi1, a human G1 and S phase protein phosphatase that associates with Cdk2.
Cell
75:791-803[CrossRef][Medline].
|
| 8.
|
Herman, A., and H. Roman.
1966.
Allele specific determinants of homothalism in Saccharomyces lactis.
Genetics
53:727-740[Free Full Text].
|
| 9.
|
Herskowitz, I.
1995.
MAP kinase pathways in yeast: for mating and more.
Cell
80:187-197[CrossRef][Medline].
|
| 10.
|
Hill, J. E.,
A. M. Myers,
T. J. Koerner, and A. Tzagoloff.
1986.
Yeast/E. coli shuttle vectors with multiple unique restriction sites.
Yeast
2:163-167[CrossRef][Medline].
|
| 11.
|
Johnson, D. R.,
R. S. Bhatnagar,
L. J. Knoll, and J. I. Gordon.
1994.
Genetic and biochemical studies of protein N-myristoylation.
Annu. Rev. Biochem.
63:869-914[CrossRef][Medline].
|
| 12.
|
Johnson, G. L.,
H. R. Kaslow, and H. R. Bourne.
1978.
Genetic evidence that cholera toxin substrates are regulatory components of adenylyl cyclase.
J. Biol. Chem.
253:7120-7123[Abstract/Free Full Text].
|
| 13.
|
Kim, D.-U.,
S.-K. Park,
K.-Y. Chung,
M.-U. Choi, and H.-S. Yoo.
1996.
The G protein subunit Gpb1 of Schizosaccharomyces pombe is a negative regulator of sexual development.
Mol. Gen. Genet.
252:20-32[CrossRef][Medline].
|
| 14.
|
Kübler, E.,
H.-U. Mösch,
S. Rupp, and M. P. Lisanti.
1997.
Gpa2p, a G-protein -subunit, regulates growth and pseudohyphal development in Saccharomyces cerevisiae via a cAMP-dependent mechanism.
J. Biol. Chem.
272:20321-20323[Abstract/Free Full Text].
|
| 15.
|
Kurjan, J.,
J. P. Hirsch, and C. Dietzel.
1991.
Mutations in the guanine nucleotide-binding domains of a yeast G protein confer a constitutive or uninducible state to the pheromone response pathway.
Genes Dev.
5:475-483[Abstract/Free Full Text].
|
| 16.
|
Landry, S.,
M. T. Pettit,
E. Apolinaro, and C. S. Hoffman.
2000.
The fission yeast git5 gene encodes a G subunit required for glucose-triggered adenylate cyclase activation.
Genetics
154:1463-1471[Abstract/Free Full Text].
|
| 17.
|
Leberer, E.,
D. Y. Thomas, and M. Whiteway.
1997.
Pheromone signalling and polarized morphogenesis in yeast.
Curr. Opin. Genet. Dev.
7:59-66[CrossRef][Medline].
|
| 18.
|
Miranda, M.,
L. Ongay-Larios,
S. Guevara,
J. Ramírez,
A. Peña, and R. Coria.
1995.
Nucleotide sequence and chromosomal localization of the gene encoding the old yellow enzyme from Kluyveromyces lactis.
Yeast
11:459-465[CrossRef][Medline].
|
| 19.
|
Nakafuku, M.,
T. Obara,
K. Kaibuchi,
I. Miyajima,
A. Miyajima,
H. Itoh,
S. Nakamura,
K. I. Arai,
K. Matsumoto, and Y. Kaziro.
1988.
Isolation of a second yeast Saccharomyces cerevisiae gene (Gpa2) coding for guanine nucleotide-binding regulatory protein: studies on its structure and possible functions.
Proc. Natl. Acad. Sci. USA
85:1374-1378[Abstract/Free Full Text].
|
| 20.
|
Obara, T.,
M. Nakafuku,
M. Yamamoto, and Y. Kaziro.
1991.
Isolation and characterization of a gene encoding a G-protein subunit from Schizosaccharomyces pombe: involvement in mating and sporulation pathways.
Proc. Natl. Acad. Sci. USA
88:5877-5881[Abstract/Free Full Text].
|
| 21.
|
Ongay-Larios, L.,
A. Saviñón-Tejeda,
M. J. Williamson, Jr.,
M. J. Durán-Avelar, and R. Coria.
2000.
The Leu-132 of the Ste4(G ) subunit is essential for proper coupling of the G protein with the Ste2 factor receptor during the mating pheromone response in yeast.
FEBS Lett.
467:22-26[CrossRef][Medline].
|
| 22.
|
Papasavvas, S. G.,
S. Arkinstall,
J. Reid, and M. Payton.
1992.
Yeast -mating factor receptor and G-protein-linked adenylyl cyclase inhibition requires RAS2 and GPA2 activities.
Biochem. Biophys. Res. Commun.
184:1378-1385[CrossRef][Medline].
|
| 23.
|
Regenfelder, E.,
T. Spellig,
A. Hartmann,
S. Lauenstein,
M. Bölker, and R. Kahmann.
1996.
G proteins in Ustilago maydis: transmission of multiple signals?
EMBO J.
16:1934-1942[CrossRef][Medline].
|
| 24.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 25.
|
Saviñón-Tejeda, A.,
L. Ongay-Larios,
J. Ramírez, and R. Coria.
1996.
Isolation of a gene encoding a G protein subunit involved in the regulation of cAMP levels in the yeast Kluyveromyces lactis.
Yeast
12:1125-1133[CrossRef][Medline].
|
| 26.
|
Sherman, F.,
G. R. Fink, and J. Hicks.
1986.
Methods in yeast genetics.
Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 27.
|
Tolkacheva, T.,
P. McNamara,
E. Piekarz, and W. Courchesne.
1994.
Cloning of a Cryptococcus neoformans gene, GPA1, encoding a G-protein -subunit homolog.
Infect. Immun.
62:2849-2856[Abstract/Free Full Text].
|
| 28.
|
Wésolowski-Louvel, M.,
K. D. Breunig, and H. Fukuhara.
1996.
Kluyveromyces lactis: genetics, biochemistry, and molecular biology of non-conventional yeast.
Springer-Verlag KG, Berlin, Germany.
|
| 29.
|
Whiteway, M.,
L. Hougan,
D. Dignard,
D. Y. Thomas,
L. Bell,
G. C. Saari,
F. J. Grant,
P. O'Hara, and V. L. MacKay.
1989.
The Ste4 and Ste18 genes of yeast encode potential and subunits of the mating factor receptor-coupled G protein.
Cell
56:467-477[CrossRef][Medline].
|
| 30.
|
Xue, Y.,
M. Batlle, and J. P. Hirsch.
1998.
Gpr1 encodes a putative G protein-coupled receptor that associates with the Gpa2p G subunit and functions in a Ras-independent pathway.
EMBO J.
17:1996-2007[CrossRef][Medline].
|
| 31.
|
Yuan, Y. O.,
I. L. Stroke, and S. Fields.
1993.
Coupling of cell identity to signal response in yeast: interaction between the 1 and Ste12 proteins.
Genes Dev.
7:1584-1597[Abstract/Free Full Text].
|
Journal of Bacteriology, January 2001, p. 229-234, Vol. 183, No. 1
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.1.229-234.2001
This article has been cited by other articles:
-
Dignard, D., Andre, D., Whiteway, M.
(2008). Heterotrimeric G-Protein Subunit Function in Candida albicans: both the {alpha} and {beta} Subunits of the Pheromone Response G Protein Are Required for Mating. Eukaryot Cell
7: 1591-1599
[Abstract]
[Full Text]
-
Kawasaki, L., Castaneda-Bueno, M., Sanchez-Paredes, E., Velazquez-Zavala, N., Torres-Quiroz, F., Ongay-Larios, L., Coria, R.
(2008). Protein Kinases Involved in Mating and Osmotic Stress in the Yeast Kluyveromyces lactis. Eukaryot Cell
7: 78-85
[Abstract]
[Full Text]