Previous Article | Next Article ![]()
Journal of Bacteriology, January 2001, p. 94-100, Vol. 183, No. 1
Research Institute of Innovative Technology
for the Earth Branch in Kanagawa University1
and Laboratory of Molecular Microbiology, Department of
Biological Sciences, Faculty of Science, Kanagawa
University,2 2946 Tsuchiya, Hiratsuka, Kanagawa
259-1293, Japan
Received 14 August 2000/Accepted 10 October 2000
An intracellular poly[D( Poly[D( A few intracellular poly-3-hydroxyoctanoate (PHO) depolymerase genes
have been cloned. Huisman et al. have cloned an intracellular PHO
depolymerase gene from Pseudomonas oleovorans using a PHO degradation mutant that cannot degrade PHO (8). Timm and
Steinbüchel have cloned a PHO depolymerase gene from
Pseudomonas aeruginosa PAO1 by hybridization using
information on the DNA sequence of P. oleovorans
(29). In both cases, the gene products have yet to be
characterized. Although many extracellular PHB depolymerase genes
have been cloned (11), no intracellular PHB depolymerase gene has been cloned to date. We tried unsuccessfully to clone the
intracellular PHB depolymerase gene (phaZ) in R. eutropha by Southern hybridization using an extracellular PHB
depolymerase gene as a probe. Therefore, we performed shotgun gene
cloning by assaying enzyme activity of clones expressed in E. coli. It is not easy to measure activity of the intracellular PHB
depolymerase, because the enzyme can digest only amorphous PHB
(16). Protease-treated native PHB granules show activity
against cell extract from Z. ramigera I-16-M and R. eutropha H16, but they still have some autodigestive activity
(18, 21). Therefore, they may not be suitable for
measuring low-level activity. Recently, artificial granules made from
purified PHB and detergents have been reported (7). In
these granules, PHB assumes an amorphous morphology similar to that of
the native PHB granules. By assaying intracellular PHB depolymerase
activity with the artificial granules, we have succeeded in cloning a
phaZ gene from R. eutropha. In this report, we
describe the cloning of a phaZ gene, characterization of its product, and properties of a phaZ null R. eutropha mutant.
Bacterial strains, plasmids, and culture.
Bacterial strains
and plasmids used in this study are listed in Table
1. All R. eutropha strains
were grown in nutrient-rich medium containing 1% (wt/vol) yeast
extract, 1% (wt/vol) Polypeptone, 0.5% (wt/vol) beef extract, and
0.5% (wt/vol) (NH4)2SO4 at 30°C with appropriate antibiotics. To produce PHB, cells grown on a nutrient-rich medium were transferred to a nitrogen-free medium containing 0.27% (wt/vol) KH2PO4, 0.99%
(wt/vol) K2HPO4, 0.02% (wt/vol)
MgSO4 · 7H2O, 0.1% (wt/vol) mineral
solution, and 2% (wt/vol) fructose and were cultured at 30°C as
described previously (21, 23). E. coli strains
were grown in Luria-Bertani medium (LB) at 37°C with or without
antibiotics (ampicillin [50 µg/ml], tetracycline [10 µg/ml],
chloramphenicol [34 µg/ml], kanamycin [50 µg/ml], streptomycin
[50 µg/ml], and gentamicin [10 µg/ml]).
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.1.94-100.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Cloning of an Intracellular
Poly[D(
)-3-Hydroxybutyrate] Depolymerase
Gene from Ralstonia eutropha H16 and Characterization of the
Gene Product
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
)-3-hydroxybutyrate] (PHB)
depolymerase gene (phaZ) has been cloned from
Ralstonia eutropha H16 by the shotgun method, sequenced,
and characterized. Nucleotide sequence analysis of a 2.3-kbp DNA
fragment revealed an open reading frame of 1,260 bp, encoding a protein
of 419 amino acids with a predicted molecular mass of 47,316 Da. The
crude extract of Escherichia coli containing the PHB
depolymerase gene digested artificial amorphous PHB granules and
released mainly oligomeric D(
)-3-hydroxybutyrate, with
some monomer. The gene product did not hydrolyze crystalline PHB or
freeze-dried artificial amorphous PHB granules. The deduced amino acid
sequence lacked sequence corresponding to a classical lipase box,
Gly-X-Ser-X-Gly. The gene product was expressed in R. eutropha cells concomitant with the synthesis of PHB and
localized in PHB granules. Although a mutant of R. eutropha
whose phaZ gene was disrupted showed a higher PHB content
compared to the wild type in a nutrient-rich medium, it accumulated PHB
as much as the wild type did in a nitrogen-free, carbon-rich medium.
These results indicate that the cloned phaZ gene encodes an
intracellular PHB depolymerase in R. eutropha.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
)-3-hydroxybutyrate]
(PHB), a homopolymer of D(
)-3-hydroxybutyrate (3HB), is a
storage material produced by some bacteria in response to environmental
stress. The PHB biosynthesis genes from such bacteria have been cloned
in Escherichia coli and studied in detail (13, 24,
26). However, only a few studies on the intracellular
degradation of PHB have been published. In an in vitro system
consisting of native PHB granules from Bacillus megaterium
and the soluble fraction from PHB-depleted cells of Rhodospirillum rubrum, the existence of a thermostable
activator and a thermolabile depolymerase has been reported
(16). Various chemical and physical treatments
inactivate the native PHB granules. In intracellular degradation of PHB
in Ralstonia eutropha, weak hydrolysis activity
against [14C]PHB granules independent of the harvest time
of the cells was reported (5). We have detected
intracellular PHB depolymerase activity in Zoogloea ramigera
I-16-M (18) and R. eutropha H16 (21), using protease-treated native PHB granules as a substrate.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Strains and plasmids used in this study
DNA manipulation. Preparation of chromosomal DNA and plasmid DNA, isolation and purification of DNA fragments, gel electrophoresis, Southern hybridization, and nucleotide sequencing were carried out according to standard techniques (22). The Sau3A1-digested chromosomal DNA fragments (10 to 15 kbp) from R. eutropha H16 were ligated to a cosmid vector, charomid 9-36 (19). The ligation mixture was packaged by using a LAMBDA INN in vitro packaging kit (Nippon Gene, Toyama, Japan), and the packaged charomid was used to transfect E. coli DH5. The bacteria were inoculated onto LB-ampicillin plates, and the resulting colonies were used as a genomic library.
Construction of phaZ null R. eutropha mutant (strain D1). A part of phaZ (268 bp, PstI-HincII fragment) was inserted into a suicide vector, pJP5603 (Kmr), which can replicate in E. coli but not in R. eutropha. The resultant plasmid (pJPPH171) was introduced into E. coli S-17 by transformation and was mobilized into R. eutropha via conjugation. Transconjugants were selected on kanamycin (50 µg/ml) and ampicillin (25 µg/ml). The selected strain (D1) was confirmed based on Southern blots and antibiotic susceptibility to carry pJPPH171 in the phaZ locus. No expression of phaZ in D1 grown in the conditions under which PHB was accumulated was detected by immunoblot analysis.
Preparation of cell extract for enzyme assay. Cells harvested from an overnight culture in LB were suspended in 50 mM Tris-HCl (pH 7.5) (5 ml/g [wet weight] of cells). The cell suspension was disrupted by sonication (20-kHz tip, 30 W for 5 min). The sonicated cells were centrifuged at 10,000 × g for 10 min, and the supernatant fraction was used as the crude extract.
Preparation of PHB granules. Artificial amorphous PHB granules were prepared by the method described by Horowitz and Sanders (7) as follows. Purified PHB was dissolved in chloroform, and then 0.05% (wt/vol) sodium oleate was added. The mixture was sonicated (20-kHz tip, 200 W for 10 min); then the emulsion was heated at 75°C for 90 min with stirring to remove chloroform and dialyzed for 24 h against 0.01% (wt/vol) oleate at room temperature. Crystalline PHB granules were prepared from R. eutropha by a hypochlorite procedure described by Smibert and Krieg (27).
Enzyme assay. PHB depolymerase activity was assayed as follows. The reaction mixture (0.5 ml) contained Tris-HCl (40 µmol, pH 9.0) and artificial PHB granules (0.3 mg as PHB) and enzyme. After addition of enzyme, the mixture was incubated at 30°C for 15 min, and the reaction was stopped by heating at 100°C for 5 min. To hydrolyze the resulting 3HB oligomers, 0.05 U of 3HB oligomer hydrolase (31) was added, and the mixture was incubated at 30°C for 15 min and centrifuged. The 3HB in the supernatant fraction was measured enzymatically with 3HB dehydrogenase as described previously (31). One unit of the enzyme catalyzes the formation of 1 µmol of 3HB per min under the assay conditions used.
Purification of His-tagged PHB depolymerase from E. coli. The phaZ gene was amplified by PCR with primers Nde (AGGCAGAAAACATATGCTCTAC) and Xho (CGTTCTCGAGCCTGGTGGCCGA). primer Nde introduces an NdeI site at the translation start codon; primer Xho introduces an XhoI site at the stop codon. The amplified DNA was cloned into the protein fusion vector pET23b as an NdeI-XhoI fragment. The fusion contained decahistidine at the carboxy-terminal end of the protein, allowing the purification of the modified protein (His-PHB depolymerase) from the inclusion body on a metal chelation column under denaturing conditions (6). Expression in E. coli BLR(DE3)pLysS and column purification of the protein were performed as recommended by the supplier (Novagen). After metal chelating purification, the protein was finally purified by a continuous elution sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (Prep cell model 491; Bio-Rad). The antibody against purified His-PHB depolymerase was prepared in rabbits as described previously (31).
Purification of PHB granules. R. eutropha cells containing PHB were suspended in 20 mM Tris-HCl (pH 7.5) (5 ml/g [wet weight] of cells) and disrupted by sonication (20-kHz tip, 40 W for 15 min). The resulting suspension (5 ml) was loaded onto a discontinuous glycerol gradient, which was prepared from 3 ml each of 88 and 44% glycerol. After centrifugation for 30 min at 210,000 × g and 4°C, the granules were collected between 88 and 44% glycerol. They were washed with 20 mM Tris-HCl (pH 7.5) and loaded onto another discontinuous sucrose gradient, which was prepared from 4 ml each of 1.66 and 1.5 M sucrose. After centrifugation for 2 h at 210,000 × g and 4°C, the granules were collected between 1.66 and 1.5 M sucrose. The purified granules were withdrawn, washed, and suspended in 20 mM Tris-HCl (pH 7.5).
Other analytical methods.
Wide-angle X-ray scattering (WAXS)
was performed using a MAC Science MXP-18 diffractometer and Cu K
radiation (
= 1.5405 Å). Protein was measured by the method of
Lowry et al. (14). SDS-polyacrylamide gel electrophoresis
was done by the procedure of Laemmli (12). Electroblotting
of proteins was done using nitrocellulose membranes (Schleicher & Schuell, Dassel, Germany) according to the method of Towbin et al.
(30). PHB content was determined by gas chromatography as
described by Braunegg et al. (2).
Nucleotide sequence accession number. The nucleotide sequence data reported in this paper have been deposited in the DDBJ, EMBL, and GenBank nucleotide sequence databases under accession number AB017612.
| |
RESULTS |
|---|
|
|
|---|
Identification and cloning of a genomic fragment relevant to PHB depolymerase. A library of chromosomal DNA from R. eutropha H16 was introduced by transfection into E. coli DH5. Approximately 2,000 colonies were picked for enzymatic assay. To facilitate screening, 5-ml cultures of each clone were grown in LB overnight, and five cultures were pooled in one group for assay. The mixed cultures were centrifuged, and cells were disrupted by sonication. The resulting crude extracts were assayed for PHB depolymerase activity. One of about 400 pools showed PHB depolymerase activity (about 0.087 U/ml). One clone in this pool harbored a genomic DNA fragment of 13 kbp. Judging from a restriction map of this DNA fragment, this region was not in or near the polyhydroxyalkanoate (PHA) synthase gene locus reported by Schubert et al. (24).
After subcloning of the 13-kbp fragment, a 1.7-kbp PstI-PstI fragment that was responsible for the PHB depolymerase activity (Fig. 1) expressed an ~48-kDa protein in an in vitro transcription-translation system (data not shown). Southern hybridization using the 1.7-kbp PstI fragment as a probe showed that the cloned DNA fragment was derived from a single chromosomal site in DNA of R. eutropha (data not shown).
|
Nucleotide sequence analysis of the 2.3-kbp fragment.
The
nucleotide sequence of the 2.3-kbp SacI-PstI
fragment (Fig. 1) was determined. In this region, there were two open
reading frames (ORFs): ORF1, which probably corresponds to a portion of the C-terminal region of some protein, and ORF2. ORF2, assigned for
phaZ, has 1,257 nucleotides and encodes a protein of 419 amino acid residues with a calculated molecular mass of 47,316 Da. The nucleotide sequence of ORF2 revealed relatively high similarity with
several proteins in recent databases: a hypothetical protein, RP681
(1,269 bp) of Rickettsia prowazekii; ORF1 (1,341 bp) of the Paracoccus denitrificans PHA synthase gene locus; and
ORF1 (843 bp) of the Rhodobacter sphaeroides PHA synthase
gene locus (identities in nucleotides and in amino acids of 47.0, 49.0, and 58.9% and 44.4, 37.9, and 41.1%, respectively) (Fig.
2) (1, 9, 15). Analysis of
the amino acid sequence deduced from ORF2 did not reveal any similarity
with intracellular PHO depolymerase sequences of P. oleovorans or P. aeruginosa (8, 29) or
with extracellular PHB depolymerases of Ralstonia pickettii
(formerly Alcaligenes faecalis) T1 and P. lemoignei (10, 20).
|
Properties of the PHB depolymerase expressed in E. coli.
The properties of the PHB depolymerase expressed in E. coli
were examined with crude extracts of recombinant E. coli.
The ORF2 product (PhaZ) expressed in E. coli JM109 showed an
alkaline pH optimum (pH 8.5 to 10). The ability of the enzyme to
degrade PHB granules of different morphology was examined (Fig.
3). Analysis by WAXS of the PHB
preparations used (Fig. 3B) revealed that the depolymerase hydrolyzed
only amorphous PHB; it did not degrade purified, crystalline PHB
granules or freeze-dried artificial amorphous PHB granules (Fig. 3A).
Even the slight crystallization observed in the freeze-dried artificial
PHB granules hindered PHB degradation under the experimental
conditions. To examine the water-soluble products of the PHB
depolymerase reaction, we determined the amounts of 3HB monomer in the
reaction mixture with or without treatment with the extracellular 3HB
oligomer hydrolase (31) after the PHB depolymerizing
reaction. About eight times more 3HB monomer was formed with than
without treatment with the 3HB oligomer hydrolase. Since 3HB
dehydrogenase does not use 3HB oligomers as a substrate, these results
show that the PHB depolymerase expressed in E. coli degraded
amorphous PHB granules to 3HB oligomers as major products.
|
Detection of PhaZ in R. eutropha.
With polyclonal
antibody against the purified His-PHB depolymerase, the gene product
was examined in R. eutropha cells (Fig. 4). No immunostained band was detected in
the whole-cell lysate of R. eutropha cells grown in a
nutrient-rich medium for 2 days. When the cells were transferred to the
nitrogen-starved, carbon-rich medium for PHB production, an ~50-kDa
protein band was detected in the PHB granule fraction and in whole-cell
lysate; then the intensity of the band increased with time after the
onset of PHB synthesis. No immunostained band was observed in the
supernatant fraction of PHB-rich cells. These results indicate that the
cloned gene encodes the R. eutropha intracellular PHB
depolymerase.
|
PHB accumulation in the phaZ null mutant.
The
phaZ null R. eutropha mutant strain D1 was
constructed using a suicide vector. Although PhaZ was lost in PHB
granules of D1 as judged by immunoblot analysis, PHB depolymerase
activity in the supernatant fraction of cell extracts (21)
was still present in D1 (wild type, 2.3 U/ml; D1, 1.8 U/ml). The effect of PhaZ on PHB accumulation was examined. In a nutrient-rich medium, R. eutropha maximized PHB content at 12 h (log phase of
cell growth) to about 40% (wt/wt [dry] of cell), which decreased
quickly to below 5% (wt/wt [dry] of cell) after 43 h (Fig.
5A and B). On the other hand, D1 showed a
smaller peak of accumulation of PHB, and the decrease of PHB content at
80 h was not great (36% of the maximum value). In the mutant D1
harboring phaZ, the PHB content of the cells decreased
quickly after 12 h in a fashion similar to that for wild-type
R. eutropha (Fig. 5B). Under PHB-producing conditions in a
nitrogen-free, carbon-rich medium, however, the wild type and D1 did
not differ significantly in the accumulation of PHB (Fig. 5C).
|
| |
DISCUSSION |
|---|
|
|
|---|
The nucleotide sequence of the cloned DNA showed relatively high similarity to the DNA sequence corresponding to the hypothetical protein RP681 of R. prowazekii, ORF1 of the P. denitrificans PHB synthase gene locus, and ORF1 of the R. sphaeroides PHA synthase gene locus (1, 9, 15) (Fig. 2). These three bacteria have a PHB synthase gene, and the latter two ORFs containing a PHB depolymerase-like sequence were located very close to this gene. Although the roles of these genes are not known, they may encode intracellular PHB depolymerases. Since the amino acid sequence of the intracellular PHB depolymerase of R. eutropha has no lipase box, whereas sequences of all known intracellular PHO depolymerases and extracellular PHB depolymerases do, the PHB depolymerase of R. eutropha seems to differ from related enzymes in the structure of its active center. Alignment of the deduced amino acid sequences shows several common regions containing histidine or aspartate residues known to be key amino acids of the charge relay system of the catalytic triad in lipase, but there is no common sequence containing serine residues (Fig. 2). Therefore, the intracellular PHB depolymerase may have in its active center an amino acid other than serine.
The enzyme expressed in E. coli showed high activity at alkaline pH (8.5 to 10). The soluble intracellular PHB depolymerase from R. rubrum is active at pH 8.0 toward the native PHB granules from B. megaterium (16). The intracellular PHB depolymerase in soluble fractions from Z. ramigera I-16-M (18) and R. eutropha (21) also has a high optimum pH. PHB depolymerase characterized in this study was found only as a PHB granule-bound form. Therefore, the local pH of PHB granules is important for enzyme action, but we do not know the exact pH of or near the surface of the inclusion bodies.
Our results confirm that the intracellular PHB depolymerase degrades only amorphous PHB as first suggested by Merrick and Doudoroff (16) (Fig. 3). It is surprising that the enzyme cannot hydrolyze freeze-dried amorphous PHB, which was only slightly crystallized as judged by WAXS. It is possible that the crystallization occurred at the surface of PHB granules in such preparations. The water-soluble products of the enzymatic reaction seemed to be mainly 3HB oligomers. This means that R. eutropha probably has an intracellular 3HB oligomer hydrolase or another type of intracellular PHB depolymerase for intracellular PHB metabolism. As described above, PHB depolymerase activity has been found in the supernatant of R. eutropha cells (21). The product of the cloned gene was found only in the PHB granule fraction of R. eutropha (Fig. 4) by immunoblot analysis. It is possible that the concentration of PHB depolymerase in the soluble fraction was not as high as the concentration that binds to PHB granules, and the enzymes in the supernatant and PHB granules are derived from the same protein molecule. However, phaZ null mutant D1 still has intracellular PHB depolymerase activity in the supernatant fraction of cell extracts. Therefore, we concluded that there are at least two intracellular PHB depolymerases in R. eutropha and that PhaZ localizes to PHB granules. Characterization of the depolymerase in the supernatant fraction of cell extracts in R. eutropha should be performed.
The phaZ null mutant had a higher PHB content than the wild type in nutrient-rich conditions after 40 to 80 h of cultivation (Fig. 5). It is interesting that PhaZ seems to function well only in R. eutropha cells grown in a nutrient-rich medium (Fig. 5B). The phaZ null mutant accumulated an amount of PHB similar to that of the wild type in PHB accumulation conditions (Fig. 5C). These results indicate that the cloned PhaZ is probably inhibited during active synthesis of PHB without growth. Although PHB metabolism in R. eutropha has been reported to be cyclic in nature (4), it seems uneconomical for bacteria to synthesize and degrade PHB in granules at the same time. Some unknown regulation of PHB degradation in the granules may occur. Some factor like the heat-stable activator found by Merrick and Doudoroff (16) in R. rubrum may also work in the PHB depolymerizing system in R. eutropha. However, it is also possible that some physical factors, for example, morphological changes of PHB granules during PHB synthesis, are involved in the regulation of PHB degradation.
| |
ACKNOWLEDGMENTS |
|---|
This study was performed as part of the Program for the Development of Biodegradable Plastics supported by the New Energy and Industrial Technology Development Organization (NEDO) and a Grant-in-Aid for Scientific Research on Priority Area, "Sustainable Biodegradation Plastics," no. 11217214 (1999), from the Ministry of Education, Science, Sports and Culture (Japan).
We thank H. Abe, Research Center, Denki Kagaku Kogyo Co. Ltd., for analysis by WAXS and T. Kobayashi for helpful discussions.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Laboratory of Molecular Microbiology, Department of Biological Sciences, Faculty of Science, Kanagawa University, 2946 Tsuchiya, Hiratsuka, Kanagawa 259-1293, Japan. Phone: 81-463-59-4111. Fax: 81-463-58-9684. E-mail: 43saito{at}info.kanagawa-u.ac.jp.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Andersson, S. G., A. Zomovodipour, J. O. Andersson, T. Sicheritz-Ponten, U. C. Alsmork, R. M. Podowski, A. K. Naslund, A. S. Eriksson, H. H. Winkler, and C. G. Kurland. 1998. The genome sequence of Rickettsia prowazekii and the origin of mitochondria. Nature 396:133-140[CrossRef][Medline]. |
| 2. |
Braunegg, G.,
B. Sonnleitner, and R. M. Lafferty.
1978.
A rapid gas chromatographic method for the determination of poly- -hydroxybutyric acid in microbial biomass.
Eur. J. Appl. Microbiol. Biotechnol.
6:20-37.
|
| 3. | Davison, J., M. Heusterspreute, N. Chevalier, V. Ha-Thi, and F. Brunel. 1987. Vectors with restriction site banks. V. pJDR215, a wide-host-range cosmid vector with multiple cloning sites. Gene 51:275-280[CrossRef][Medline]. |
| 4. | Doi, Y., A. Segawa, Y. Kawaguchi, and M. Kunioka. 1990. Cyclic nature of poly(3-hydroxyalkanoate) metabolism in Alcaligenes eutrophus. FEMS Microbiol. Lett. 55:165-169[Medline]. |
| 5. | Hippe, H., and H. G. Schlegel. 1967. Hydrolyse von PHBS durch intracelluläre Depolymerase von Hydrogenomonas H16. Arch. Mikrobiol. 56:278-299[Medline]. |
| 6. | Hochuli, E., H. Dobeli, and A. Schacher. 1987. New metal chelate adsorbents selective for proteins containing neighboring histidine residues. J. Chromatogr. 411:177-184[CrossRef][Medline]. |
| 7. | Horowitz, D. M., and J. K. M. Sanders. 1994. Amorphous, biomimetic granules of polyhydroxybutyrate: preparation, characterization, and biological implications. J. Am. Chem. Soc. 116:2695-2702[CrossRef]. |
| 8. |
Huisman, G. W.,
E. Wonink,
R. Meima,
B. Kazemier,
P. Terpstra, and B. Witholt.
1991.
Metabolism of poly(3-hydroxyalkanoates) (PHAs) by Pseudomonas oleovorans: identification and sequence of genes and function of the encoded proteins in the synthesis and degradation of PHA.
J. Biol. Chem.
266:2191-2198 |
| 9. | Hustede, E., and A. Steinbüchel. 1993. Characterization of the polyhydroxyalkanoate synthase gene locus of Rhodobacter sphaeroides. Biotechnol. Lett. 15:709-714. |
| 10. |
Jendrossek, D.,
A. Frisse,
A. Behrends,
M. Andermann,
H. D. Kratzin,
T. Stanislawski, and H. G. Schlegel.
1995.
Biochemical and molecular characterization of the Pseudomonas lemoignei polyhydroxyalkanoate depolymerase system.
J. Bacteriol.
177:596-607 |
| 11. | Jendrossek, D., A. Schirmer, and H. G. Schlegel. 1996. Biodegradation of polyhydroxyalkanoic acids. Appl. Microbiol. Biotechnol. 46:451-463[CrossRef][Medline]. |
| 12. | Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[CrossRef][Medline]. |
| 13. | Lee, S. Y. 1996. Bacterial polyhydroxyalkanoates. Biotechnol. Bioeng. 49:1-14[CrossRef]. |
| 14. |
Lowry, O. H.,
N. J. Rosebrough,
A. L. Farr, and R. J. Randall.
1951.
Protein measurement with the Folin phenol reagent.
J. Biol. Chem.
193:265-275 |
| 15. |
Maehara, A.,
S. Ueda,
H. Nakano, and T. Yamane.
1999.
Analysis of a polyhydroxyalkanoic acid granule-associated 16-kilodalton protein and its putative regulator in the pha locus of Paracoccus denitrificans.
J. Bacteriol.
181:2914-2921 |
| 16. |
Merrick, J., and M. Doudoroff.
1964.
Depolymerization of poly- -hydroxybutyrate by an intracellular enzyme system.
J. Bacteriol.
88:60-71 |
| 17. | Penfold, R. J., and J. M. Pemberton. 1992. An improved suicide vector for construction of chromosomal insertion mutations in bacteria. Gene 118:145-146[CrossRef][Medline]. |
| 18. | Saito, T., H. Saegusa, Y. Miyata, and T. Fukui. 1992. Intracellular degradation of poly(3-hydroxybutyrate) granules of Zoogloea ramigera I-16-M. FEMS Microbiol. Rev. 103:333-338[CrossRef]. |
| 19. |
Saito, I., and G. R. Stark.
1986.
Charomids: cosmid vectors for efficient cloning and mapping of large or small restriction fragments.
Proc. Natl. Acad. Sci. USA
83:8664-8668 |
| 20. |
Saito, T.,
K. Suzuki,
J. Yamamoto,
T. Fukui,
K. Miwa,
K. Tomita,
S. Nakanishi,
S. Odani,
J. Suzuki, and K. Ishikawa.
1989.
Cloning, nucleotide sequence, and expression in Escherichia coli of the gene for poly(3-hydroxybutyrate) depolymerase from Alcaligenes faecalis.
J. Bacteriol.
171:184-189 |
| 21. | Saito, T., K. Takizawa, and H. Saegusa. 1995. Intracellular poly(3-hydroxybutyrate) depolymerase in Alcaligenes eutrophus. Can. J. Microbiol. 41:187-191. |
| 22. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 23. | Schlegel, H. G., H. Kaltwasser, and G. Gottschalk. 1961. Ein submersverfahren zur Kultur wasserstoffoxydierender Bakterien: wachstumsphysiologische Untersuchungen. Arch. Mikrobiol. 38:209-222[CrossRef][Medline]. |
| 24. |
Schubert, P.,
A. Steinbüchel, and H. G. Schlegel.
1988.
Cloning of the Alcaligenes eutrophus genes for synthesis of poly- -hydroxybutyric acid (PHB) and synthesis of PHB in Escherichia coli.
J. Bacteriol.
170:5837-5847 |
| 25. | Simon, R., U. Priefer, and A. Pühler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram-negative bacteria. Bio/Technology 1:784-791[CrossRef]. |
| 26. |
Slater, C. S.,
W. H. Voige, and D. E. Dennis.
1988.
Cloning and expression in Escherichia coli of the Alcaligenes eutrophus H16 poly- -hydroxybutyrate biosynthesis pathway.
J. Bacteriol.
170:4431-4436 |
| 27. | Smibert, R. M., and N. R. Krieg. 1994. Phenotypic characterization, p. 650. In P. Gerhardt, R. G. E. Murray, W. A. Wood, and N. R. Krieg (ed.), Methods for general and molecular bacteriology. American Society for Microbiology, Washington, D.C. |
| 28. |
Taylor, D. P.,
S. N. Cohen,
W. G. Clark, and B. L. Marrs.
1983.
Alignment of genetic and restriction maps of the photosynthesis region of the Rhodopseudomonas capsulata chromosome by a conjugation-mediated marker rescue.
J. Bacteriol.
154:580-590 |
| 29. | Timm, A., and A. Steinbüchel. 1992. Cloning and molecular analysis of the poly(3-hydroxyalkanoic acid) gene locus of Pseudomonas aeruginosa PAO1. Eur. J. Biochem. 209:15-30[Medline]. |
| 30. |
Towbin, H.,
T. Staehelin, and J. Gordon.
1979.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA
76:4350-4354 |
| 31. |
Zhang, K.,
M. Shiraki, and T. Saito.
1997.
Purification of an extracellular D( )-3-hydroxybutyrate oligomer hydrolase from Pseudomonas sp. strain A1 and cloning and sequencing of its gene.
J. Bacteriol.
179:72-77 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Appl. Environ. Microbiol. | Infect. Immun. | Eukaryot. Cell |
|---|---|---|
| Mol. Cell. Biol. | J. Virol. | Microbiol. Mol. Biol. Rev. |
| ALL ASM JOURNALS |