This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Richaud, C.
Right arrow Articles by Thomas, J.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Richaud, C.
Right arrow Articles by Thomas, J.-C.

 Previous Article  |  Next Article 

Journal of Bacteriology, May 2001, p. 2989-2994, Vol. 183, No. 10
0021-9193/01/$04.00+0   DOI: 10.1128/JB.183.10.2989-2994.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

Nitrogen or Sulfur Starvation Differentially Affects Phycobilisome Degradation and Expression of the nblA Gene in Synechocystis Strain PCC 6803

Catherine Richaud,* Gérald Zabulon, Annette Joder, and Jean-Claude Thomas

Unité Mixte de Recherche 8543, Centre National de la Recherche Scientifique, "Photorégulation et Dynamique des Membranes Végétales," Ecole Normale Supérieure, 75230 Paris cedex 05, France

Received 7 November 2000/Accepted 6 March 2001


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

Nitrogen (N) limitation in cyanobacteria is well documented: a reduced growth rate is observed, accompanied by a cessation of phycobiliprotein synthesis and an ordered degradation of phycobilisomes (PBS). This leads to a dramatic bleaching phenomenon known as chlorosis. In Synechococcus strain PCC 7942, bleaching due to PBS degradation is also observed under sulfur (S) or phosphorus (P) limitation, and all three are under the control of the nblA gene product, a 59-amino-acid polypeptide which is overexpressed under N, S, and P starvation (J. L. Collier, and A. R. Grossman, EMBO J. 13:1039-1047, 1994). Cyanobase sequence data for Synechocystis strain PCC 6803 indicate the presence of two tandem open reading frames (sll0452 and sll0453) homologous to nblA. We cloned the two genes, identified a unique 5' mRNA end suggestive of a single transcription start site, and studied nblA expression under conditions of N or S starvation by Northern hybridization: transcripts were detected only under N starvation (no signal is detected in replete medium or with S starvation), whether nblA1 or nblA2 was used as a probe. Mutations in nblA1 and nblA2 were constructed by insertion of a kanamycin cassette; both mutations were nonbleaching under N starvation. Synechocystis strain PCC 6803 does not bleach under S starvation, consistent with the absence of nblA induction in these conditions. These results were confirmed by analysis of the PBS components: sequential degradation of phycocyanin and associated linkers was observed only under conditions of N starvation. This indicates differences between Synechocystis strain PCC 6803 and Synechococcus strain PCC 7942 in their regulatory and signaling pathways leading to N- and S-starved phenotypes.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

Nutrient-limited growth of non-N2-fixing cyanobacteria induces a set of general responses, including cessation of cell division and important morphological and physiological alterations such as loss of photosynthetic membranes, increase of glycogen and inclusion bodies, and loss of pigments (chlorophyll, phycobiliproteins [PBPs], and all carotenoids except zeaxanthin). Besides these general effects, certain nutrient-specific responses have been described, such as increased synthesis of high-affinity transport systems, synthesis of more readily transported metabolites, and synthesis of a new type of phycocyanin (PC) (for a review, see reference 4).

The effect of nitrogen (N) starvation on the abundance of pigment molecules in several cyanobacteria has been well documented, in Anacystis nidulans (2), Synechococcus sp. (34), Anabaena (11, 33), Synechococcus strain PCC 7002 (28), and Synechocystis strain PCC 6803 (10). The resulting decrease in chlorophyll and phycobilisome (PBS) content leads to a dramatic change in cell color from the normal blue-green to yellow-green, which is known as bleaching or chlorosis. PBS, which can constitute up to 50% of the total cellular protein, is progressively, rapidly, and almost completely degraded; the chlorophyll content also declines. In this sense, PC, the major constituant of PBS, acts as a nitrogen store; the material released by protein degradation may provide substrates for the synthesis of polypeptides required for acclimation to new N status (2). In some Synechococcus species, bleaching also occurs in response to nutrient starvation for sulfur (S) (13, 24, 32), phosphorus (P) (12), carbon (20), and iron (26). For starvation under such nutrient conditions, as PBSs are a poor source of S-containing amino acids and do not contain P or Fe, their degradation would be rather for minimizing the absorption of excess excitation energy under stress conditions (25). The most thoroughly documented study of PBS degradation in response to environmental conditions is that for Synechococcus sp. strain PCC 7942. Collier and Grossman demonstrated that bleaching is different for N or S versus P starvation (5). On growth media devoid of N or S, the decrease in PBPs (due to blocked synthesis and a breakdown of existing molecules) is much more rapid and complete than on P-limited media, suggesting that different steps are involved in the different nutrient-limited conditions.

In Synechococcus sp. strain PCC 7942, several mutations with a nonbleaching (Nbl) phenotype have been described. Most of them map to nblA, a gene encoding a small polypeptide of 59 amino acids, only transcribed in N- or S-limiting growth conditions and to a lesser extent in P-limiting conditions (6). Another nonbleaching mutation was isolated and mapped to the nblR locus (25), a gene which encodes a response regulator belonging to a two-component signal transduction pathway that controls general acclimation responses (nutrients and light). Another nbl mutation mapped to a third locus, nblB (8), encoding a polypeptide with similarities to phycobilin lyases, enzymes that catalyze covalent-bound formation between linear tetrapyrroles and PBPs. Transcription of nblA (unlike nblB) is controlled by the response regulator NblR.

Other nblA genes that all originate from PBS-containing organisms, cyanobacteria or red algae, are found in sequence data banks. In the genome of Synechocystis strain PCC 6803 (14), two tandem copies of nblA are present. For this species, PBS degradation has only been studied under conditions of N starvation (10). In this report, we present data concerning the cloning, inactivation, and regulation of expression of the Synechocystis strain PCC 6803 nblA cluster. We demonstrate that N starvation leads to nblA induction, followed by PBS degradation, while S starvation does not. This is in contrast to the results reported for Synechococcus strain PCC 7942. Thus, different signal transduction pathways must exist for these two cyanobacteria.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

Cyanobacterial strain and growth conditions. Synechocystis sp. strain PCC 6803 was grown in BG-11 medium (1) at 30°C under continuous illumination provided by fluorescent white lamps, giving an intensity of 70 µE m-2 s-1. Cultures were either continuously bubbled with sterile air or kept under a 5% (vol/vol) CO2-enriched atmosphere in a rotary shaker (120 rpm).

Nutrient deprivation. Cells in the log phase (approximately 1 × 107 to 2 × 107/ml) were harvested by centrifugation at 7,000 × g for 5 min at 20°C, resuspended in a one-half volume of BG-11 medium -N (devoid of NaNO3) or BG-11 medium -S (devoid of MgSO4). Controls consisted of washed cells resuspended in complete BG-11 medium and inoculated at the same densities.

Spectroscopic studies. Absorption spectra were recorded on a DW2 Aminco spectrophotometer. Growth rates were routinely monitored by optical density at 750 nm (9). Estimation of chlorophyll and PBP content was performed using the expressions A680 - A750 and A620 - A750, respectively, as index values.

PBS isolation. Typically, log-phase cells (A750, approximately 0.1 to 0.2) from 200-ml (for replete or -S medium) or 400-ml (for -N medium) volumes were collected by centrifugation, and PBSs were isolated by the procedure of Yamanaka et al. (35) with the modifications described by Thomas and Passaquet (30). Polypeptides were separated on polyacrylamide slab gels under denaturing conditions according to the procedure of Laemmli (15). Stained gels were digitalized with a scanner (Studio ScanIIsi; Agfa) calibrated for optical density measurements with a Kodak Scanner Transmission Tablet (grey scale). The quantification of beta -PC (beta PC) and beta -allophycocyanin (beta AP) (nomenclature according to reference 29) was performed with the public-access NIH Image software program. Values obtained after three measurements were weighted by their respective molecular masses.

DNA manipulation. All molecular techniques were performed according to standard procedures (23).

A 2-kb DNA fragment containing the nblA region was obtained by PCR amplification with oligonucleotides designed from the sequences available in Cyanobase, Nbl2 (5'CGGATCCCCATCAAAATATAGTTC3') and Nbl3 (5'CGGAATTCGCATAATCTGAACAATTCC3'). PCR amplification was performed with 0.1 µg of purified Synechocystis strain PCC 6803 DNA under the following conditions: 1 cycle of 94°C denaturation for 5 min; 35 cycles at 94°C (30 s), 55°C (30 s), and 72°C (2 min); and 1 elongation cycle of 10 min at 72°C using Tfl polymerase (Promega Corp., Madison Wis.). The 2-kb fragment was cloned via BamHI and EcoRI sites added at the ends of the oligonucleotides Nbl2 and Nbl3, respectively, into the pBluescript SK(+) vector, giving plasmid pBSN2000.

Interposon inactivation. The two open reading frames (ORFs) identified in the DNA sequence of Synechocystis strain PCC 6803 were first inactivated on the plasmid by the insertion of a cartridge containing the aphI gene, which confers kanamycin resistance (Fig. 1B and C), from pUC-4K (Pharmacia). The kan cartridge was inserted via PstI-flanking sites into the unique PstI site of nblA2 in plasmid pBSN2000. Inactivation of nblA1 was performed by insertion of a DNA fragment carrying, besides the kan cartridge (1.3 kb), a 2.5-kb SalI-PvuII fragment from pAM1583 (Susan Golden), encoding the promoterless luxAB operon from Vibrio harveyi (17). This 3.7-kb fragment was inserted into the unique SphI site of nblA1 in plasmid pBSN2000. The constructs are schematized in Fig. 1B and C. Synechocystis strain PCC 6803 was transformed by both constructs and repeatedly subcultured on kanamycin (25 µg/ml) to select for clones that had segregated. Complete segregation was verified by PCR analysis using different pairs of relevant primers. The nblA1-inactive mutant was designated N1LuxKm and the nblA2-inactive one was called N2Km.


View larger version (28K):
[in this window]
[in a new window]
 
FIG. 1.   (A) Map of the region of the Synechocystis strain PCC 6803 genome encompassing nblA genes and of the insertional inactivation performed in nblA1 and nblA2 leading to N1luxKm (B) and N2Km (C) mutants, respectively. In panel A, Nb12 and Nb13 indicate the position of oligonucleotides used for amplifying the wt 2-kb region cloned into plasmid pBSN2000. Nb3 and Nb2 were used for amplifying nblA1; Nb5 and Nb4 were used for amplifying nblA2. Nb2 and Nb4 were used as primers for 5' extension experiments. Insertions luxkan (3.7 kb) (B) and kan (1.2 kb) (C) are not represented on the same scale. (D) Primer extension mapping of the in vivo nblA transcript was performed on 30 µg of total RNA isolated from Synechocystis strain PCC 6803 wt cells after 6 h of N starvation with either Nb2 or Nb4 as a primer. The RNA-cDNA hybrid is calibrated (228 nt) with a standard sequence (the 5' region of the nblA noncoding strand is presented in the experiment). (E) Organization of the promoter region of the nblA cluster showing the transcriptional start site (*) and the upstream putative NtcA box.

RNA methods. Samples of culture (100 to 200 ml with an A750 value of approximately 0.2) were pelleted at 7,000 × g for 5 min, dipped in liquid N2, and stored at -80°C until processed. Total RNA was isolated as described in reference 21. A total of 5 µg of RNA was subjected to electrophoresis on 1.2% denaturing agarose gels in 0.5 M HEPES, 10 mM EDTA, and 16% formaldehyde and then transferred to nylon membranes (Hybond-N; Amersham Pharmacia Biotech). Hybridization was carried out at 42°C in 50% formamide with nbl DNA probes obtained by PCR amplification with the following oligonucleotides: Nb3 (5'TTGGAGGGGCAACAGCTATGAA3') and Nb4 (5'GGGGAGGAGTGAATTTTTCATC3') for the probe containing nblA1 and nblA2, Nb3 and Nb2 (5'ACCTAGGGGCTCCAGGGGAGCC3') for the nblA1-specific probe, and Nb5 (5'ATGATCAACAACGAAGCC3') and Nb4 for the nblA2-specific probe. The rnpB probe was a 500-bp EcoRI-HindIII fragment from plasmid pT76803 (31) encoding the Rnase P RNA.

5' mRNA determination. Primer extension was performed to map the 5' end of the nblA mRNA using oligonucleotides Nb2 and Nb4 as primers. A total of 30 µg of total RNA from Synechocystis strain PCC 6803 N-starved culture was used and treated as described in reference 23, with modifications as described in reference 22. To determine the size of the hybrid, the sample was loaded onto a sequencing gel with a standard sequencing reaction run in parallel.


    RESULTS AND DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

The two nblA coding sequences of Synechocystis strain PCC 6803. In the Genome Database, two ORFs in Synechocystis strain PCC 6803 designated sll0452 (nblA1) and sll0453 (nblA2) encode 62- and 60-amino-acid-long polypeptides, respectively, that are homologous to NblA. This protein is implicated in PBS degradation in Synechococcus strain PCC 7942 (6). The distance between the translation end codon of nblA1 and the translation-initiating codon of nblA2 is 76 nucleotides (nt). Flanking ORFs are oriented in the opposite direction, 584 nt upstream (slr0271, unknown) from nblA1 and 217 nt downstream (slr0270, unknown) from nblA2. The organization of the 2-kb sequence of the nblA region cloned into plasmid pBSN2000 is presented in Fig. 1A.

The transcription of the nblA cluster was studied under different nutrient (N and S) states using a DNA probe containing both nblA1 and nblA2 (Fig. 2). No transcript could be detected from cells grown in complete medium or after 4 h of S starvation (Fig. 2B). Under conditions of N starvation, a smear of transcripts ranging from approximately 1,000 to 600 nt was obtained, which increased within 2 h and remained high several hours after initiating nitrogen deprivation (Fig. 2A). Using the nblA1-specific probe, the same smear was obtained (Fig. 2C) as well as for the nblA2-specific probe (data not shown). These results are consistent with a dicistronic operon for nblA1 and nblA2 expression. A smear of transcripts has also been observed in the case of Synechocystis strain PCC 6803 nblA induced under iron starvation (27) and in the case of Synechococcus strain PCC 7942 nblA induced under S starvation (6).


View larger version (58K):
[in this window]
[in a new window]
 
FIG. 2.   NblA Northern analysis of transcripts of wt Synechocystis strain PCC 6803 under different growth conditions as indicated, using nbl1 and nbl2 (A and B) as a probe. (A) Samples taken at various times after N starvation. (B) Samples taken after 4 h of growth on complete, -N, or -S medium. (C) Analysis of nblA-encoding transcripts of mutant strains N1LuxKm and N2Km compared to that of the wt, from 4 h of growth for cells grown in -N; nbl1 was used as a probe. The same blots were used for hybridization with the rnpB probe. Probes are described in Materials and Methods.

The 5' end of the nblA mRNA was mapped by primer extension, using total RNA from N-starved cells and oligonucleotides Nb2 or Nb4 as primers hybridizing, respectively, with the end of the nblA1 and nblA2 coding sequences (Fig. 1A). A unique 5' extension product was identified with Nb2 as a primer (Fig. 1D) at the A, 43 nt before the initiating ATG (Fig. 1E). With Nb4 as a primer, no extension product could be detected, which strongly suggests the absence of a transcription start in front of nblA2; the expected extension product from Nb4 to the 5' mRNA end identified with Nb2 primer would be 480 nt long at the limit of the method. The sequence GTAN8TAC, a putative binding site for the transcriptional activator NtcA (19) can be found centered 48 nt before the identified 5' mRNA end, strengthening this site as a putative transcription start (Fig. 1E).

Inactivation of nblA1 and nblA2. The two ORFs nblA1 and nblA2 were each inactivated by interposon mutagenesis, leading to strains N1LuxKm and N2Km, respectively.

For both strains, growth and pigment contents were compared to those of the wild type (wt) after culturing either strain in complete medium or under N starvation conditions. The two mutants grew at a rate slightly slower than that of the wt strain (doubling time in complete medium of 18 h for the mutants compared to 16 h for the wt). The increase in chlorophyll content, estimated by A680 - A750, followed the increase in cell number for the wt and the mutants in complete medium, while with -N medium, the three strains almost immediately stopped chlorophyll synthesis (data not shown). The PBP content as estimated by A620 - A750 is presented in Fig. 3: for the wt strain and the mutants, the PBP concentration in complete medium increased, following cell division and chlorophyll synthesis; under N starvation, the level of PBP in the wt strain clearly decreased; in contrast, the two mutants presented a constant level of PBP, indicating a block in PBP synthesis but no degradation.


View larger version (18K):
[in this window]
[in a new window]
 
FIG. 3.   A representative experiment showing evolution of the PBP content estimated by A620 - A750 of Synechocystis strain PCC 6803 wt, N1LuxKm, and N2Km strains in BG-11 or -N medium.

PBSs were isolated from the three strains (wt, N1LuxKm, and N2Km) from the three different culture media (complete BG-11, -N, or -S) harvested 34 h after nutrient deprivation. The PBS polypeptide components were resolved by lithium dodecyl sulfate-polyacrylamide gel electrophoresis (LiDS-PAGE) and stained with Coomassie blue (Fig. 4). A clear degradation of PC and associated linkers (LR34.5 and LR33) was observed for wt PBS under N starvation, while PBSs isolated from the two mutants were stable under all the conditions tested (90 h of starvation had no added effect). Thus, insertion in either of the two nblA coding sequences prevents PBS degradation.


View larger version (55K):
[in this window]
[in a new window]
 
FIG. 4.   Polypeptide composition of PBSs determined by LiDS-PAGE of wt, N1LuxKm, and N2Km strains grown either -N, complete, or -S medium for 34 h. The ratio beta PC/beta AP has been calculated as described in Materials and Methods. The nomenclature of PC and AP subunits is derived from reference 29.

To further characterize the two mutants, we performed a transcriptional analysis using nblA1 as a specific probe after 4 h of N starvation, under which conditions nblA mRNA was fully induced in the wt. No significant transcripts were detected in the mutants (Fig. 2C). The same results were obtained using an nblA2-specific probe (data not shown). The absence of signal using RNA extracted from N2Km mutant cells grown in -N medium with the nblA1 probe (Fig. 2C) is rather surprising, as we expected transcripts running from the putative tsp (upstream nblA1) until the end of the kan gene (Fig. 1C). This result leads us to postulate that the insertion of the kanamycin cartridge in nblA2 destabilizes the transcripts.

Comparison of Synechocystis strain PCC 6803 under nutrient (N or S) limitation. wt Synechocystis strain PCC 6803 was grown in replete BG11 medium as well as in -N and -S media. Growth in N- or S-starved culture compared to replete culture was followed by A750 analysis during several days (Fig. 5); over 2 days, the doubling time estimated by increasing A750 from cells grown in N-starved or S-starved medium was not affected by either treatment. While chlorophyll synthesis follows cell division in complete medium, in N- or S-deprived cultures, chlorophyll accumulation stopped almost immediately (data not shown). This behavior has already been observed in Synechococcus strain PCC 7942 (5). Estimation of the pigment content can be provided by whole-cell absorption spectra (see Materials and Methods). In Fig. 6 spectra are presented for wt Synechocystis strain PCC 6803 either grown in complete BG-11 medium or after 17 h of N or S starvation. The value (A620 - A750)/(A680 - A750) is indicative of the PBP/Chl ratio. This ratio is lower for cells grown under conditions of N starvation (0.78), while for the cells grown under 17 h of S starvation this ratio is almost indistinguishable (1.05) from that of cells grown in nutrient-replete medium.


View larger version (13K):
[in this window]
[in a new window]
 
FIG. 5.   A representative experiment showing growth rate (estimated by A750) of the Synechocystis strain PCC 6803 wt strain grown in BG-11 (------), -N (---), or -S (. . . . .) medium.


View larger version (14K):
[in this window]
[in a new window]
 
FIG. 6.   Whole-cell absorption spectra for wt cells grown 17 h on nitrogen-deprived (---) and sulfur-deprived (. . . . .) cultures, compared to those grown on complete BG-11 (------) culture.

The absence of an effect of S starvation and the effect of N starvation on PBP content is confirmed after 34 h by the resolution of PBS components by LiDS-PAGE (Fig. 4). Under N starvation, the decrease in PC and associated linkers occurs within 8 h of N starvation (data not shown), the PC/AP ratio being 2.7, 2.2, 2.0, and 1.3 after 8, 13, 17, and 34 hours of starvation, respectively. This phenomenon of sequential degradation of PBS has already been described for Synechococcus strain PCC 7942 (5).

Conclusion. We have shown that Synechocystis strain PCC 6803 PBSs are not degraded under S starvation, whereas they are with N starvation. In the latter case, this degradation was correlated with the expression of the nblA cluster. In Synechocystis strain PCC 6803, the only putative transcriptional start site detected as a 5' end of mRNA was that present 43 bp before the initiating nblA1 ATG.

Fourteen NblA sequences are now available in the data banks. Their sizes range from 54 to 62 amino acids, and significant homologies are found along the 50 central residues (data not shown). Synechocystis strain PCC 6803 NblA1 and NblA2 are 30% identical and 68% similar, taking into account conservative amino acid substitutions. Other cyanobacterial genomes like Anabaena strain PCC 7120 or Nostoc punctiforme contain more than one nblA gene, but Synechocystis strain PCC 6803 is the sole organism as yet described containing two copies in tandem. We have shown that an insertion in each of the coding sequences prevents the presence of stable transcripts inducible under conditions of N starvation, consistent with the nbl-deficient phenotype of both mutants. A question remains: what is the active form of the NblA protein---NblA1, NblA2, or a heterodimer (NblA1-NblA2)? The sequence NblA1 appears more divergent than NblA2 from the consensus NblA or from any other NblA (for instance, NblA1 is 21% identical to Synechococcus strain PCC 7942 compared to 25% for NblA2). The mechanism by which NblA may act in PBS degradation has not yet been elucidated. Different hypotheses were proposed for its role: it could be a specific protease, it could affect the synthesis or the specificity of a molecule involved in PBS degradation, or it might be tightly associated to PBSs to mark them for degradation (6).

The responses of Synechocystis strain PCC 6803 and Synechococcus strain PCC 7942 are different in S starvation, as the latter degrades its PBS and the former does not. The absence of growth of Synechocystis strain PCC 6803 after 2 days of S starvation seems to indicate that needs of Synechocystis strain PCC 6803 for S should be as those of Synechococcus strain PCC 7942. What is the program of responses triggered by S starvation in Synechocystis strain PCC 6803? Specific responses involved in other photosynthetic organisms in acclimation to S starvation have not been studied in strain PCC 6803: activation of sulfate transport, acquisition or utilization of diverse S compounds (4), and increase of the carotenoid zeaxanthin for thermal dissipation of energy (18). Different sulfur deprivation regulatory proteins have been characterized in photosynthetic organisms. (i) CysR, identified in Synechococcus strain PCC 7942 (16), is similar to prokaryotic DNA-binding proteins Fnr, Crp, and FixK; no homologue of CysR is present in the genome of Synechocystis strain PCC 6803. (ii) Sac1, a putative sensor of the sulfur status of the environment, is required in Chlamydomonas reinhardtii for survival of sulfur-deprived cells in the light (7); a homologue (sll0640) present in Synechocystis strain PCC 6803 is of particular interest. (iii) NblR, identified in Synechococcus strain PCC 7942 (25), is homologous to response regulators of two-component signal transduction systems and controls general acclimation responses for survival during nutrient (N, S, and P) and high-light stresses; NblR controls PBS degradation via induction of nblA and probably controls additional functions critical for cell survival. Study of the nblR equivalent (sll0396) in Synechocystis strain PCC 6803, an organism responding differently to S starvation, could provide new information concerning the pivotal role of NblR, and differences in the regulatory and signal transduction pathways of Synechocystis strain PCC 6803 and Synechococcus strain PCC 7942 are predicted.


    ACKNOWLEDGMENTS

We are grateful to Anne-Lise Etienne for comments throughout this work and to Jean Houmard and Andy Pascal for critical reading of the manuscript.

This work was supported by Aquasense (EU contract ENV4-CT97-0493).


    ADDENDUM

During the revision of the manuscript, an independent study (K., Baier, S. Nicklisch, C. Grundner, J. Reinecke, and W. Lockau, FEMS Microbiol. Lett. 195:35-39, 2001) presented data in agreement with part of our results.


    FOOTNOTES

* Corresponding author. Mailing address: Unité Mixte de Recherche 8543, Centre National de la Recherche Scientifique, "Photorégulation et Dynamique des Membranes Végétales," Ecole Normale Supérieure, 46 rue d'Ulm, 75230 Paris cedex 05, France. Phone: 33 1 44 32 35 40. Fax: 33 1 44 32 39 35. E-mail: richaud{at}wotan.ens.fr.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

1. Allen, M. M. 1968. Simple conditions for growth of unicellular blue-green algae on plates. J. Phycol. 4:1-4.
2. Allen, M. M., and A. J. Smith. 1969. Nitrogen chlorosis in blue-green algae. Arch. Mikrobiol. 69:114-120[CrossRef][Medline].
3. Apt, K. E., and A. R. Grossman. 1993. The phycobilisome beta 18 subunit gene of allophycocyanin is located on the plastid genome in Aglaothamnion neglectum (Rhodophyta) and cotranscribed with an unidentified open reading frame. J. Phycol. 29:716-718[CrossRef].
4. Bhaya, D., R. Schwarz, and A. R. Grossman. 2000. Molecular responses to environmental stress, p. 397-442. In B. A. Whitton, and M. Potts (ed.), The ecology of cyanobacteria. Kluwer Academic Publishers, Dordrecht, The Netherlands.
5. Collier, J. L., and A. R. Grossman. 1992. Chlorosis induced by nutrient deprivation in Synechococcus sp. strain PCC 7942: not all bleaching is the same. J. Bacteriol. 174:4718-4726[Abstract/Free Full Text].
6. Collier, J. L., and A. R. Grossman. 1994. A small polypeptide triggers complete degradation of light-harvesting phycobiliproteins in nutrient-deprived cyanobacteria. EMBO J. 13:1039-1047[Medline].
7. Davies, J. P., F. Yildiz, and A. R. Grossman. 1994. Mutants of Chlamydomonas with aberrant responses to sulfur deprivation. Plant Cell 6:53-63[Abstract].
8. Dolganov, N., and A. R Grossman. 1999. A polypeptide with similarity to phycocyanin alpha -subunit phycocyanobilin lyase involved in degradation of phycobilisomes. J. Bacteriol. 181:610-617[Abstract/Free Full Text].
9. Duke, C. S., A. Cezeaux, and M. M. Allen. 1989. Changes in polypeptide composition of Synechocystis sp. strain 6308 phycobilisomes induced by nitrogen starvation. J. Bacteriol. 160:1960-1966.
10. Elmorjani, K., and M. Herdman. 1987. Metabolic control of phycocyanin degradation in the cyanobacterium Synechocystis PCC 6803: a glucose effect. J. Gen. Microbiol. 133:1685-1694.
11. Foulds, I. J., and N. G. Carr. 1977. A proteolytic enzyme degrading phycocyanin in the cyanobacterium Anabaena cylindrica. FEMS Microbiol. Lett. 2:117-119.
12. Ihlenfeldt, M. J. A., and J. Gibson. 1975. Phosphate utilization and alkaline phosphatase activity in Anacystis nidulans (Synechococcus). Arch. Microbiol. 102:23-28[CrossRef][Medline].
13. Jensen, T. E., and J. W. Rachlin. 1984. Effect of varying sulfur deficiency on structural components of a cyanobacterium Synechococcus leopoliensis: a morphometric study. Cytobios 41:35-46.
14. Kaneko, T., S. Sato, H. Kotani, A. Tanaka, E. Asamizu, Y. Nakamura, N. Miyajima, H. Hirosawa, M. Sugiura, S. Sasamoto, T. Kimura, T. Hosouchi, A. Matsuno, A. Muraki, N. Nakazaki, K. Naruo, S. Okumura, S. Shimpo, C. Takeuchi, T. Wada, A. Watanabe, M. Yamada, M. Yasuda, and S. Tabata. 1996. Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC6803. II. Sequence determination of the entire genome and assignment of potential protein coding regions. DNA Res. 2:153-166.
15. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:660-685[Medline].
16. Laudenbach, D. E., and A. R. Grossman. 1991. Characterization and mutagenesis of sulfur-regulated genes in a cyanobacterium: evidence for function in sulfate transport. J. Bacteriol. 173:2739-2750[Abstract/Free Full Text].
17. Legocki, R. P., M. Legocki, T. O. Baldwin, and A. A Szalay. 1986. Bioluminescence in soybean root nodules: demonstration of a general approach to assay gene expression in vivo by using bacterial luciferase. Proc. Natl. Acad. Sci. USA 83:9080-9084[Abstract/Free Full Text].
18. Levy, H., T. Tal, A. Shaish, and A. Zamir. 1993. Cbr, an algal homolog of plant early light-induced proteins, is a putative zeaxanthin binding protein. J. Biol. Chem. 268:20892-20896[Abstract/Free Full Text].
19. Luque, I., F. Flores, and A. Herrero. 1994. Molecular mechanism for the operation of nitrogen control in cyanobacteria. EMBO J. 13:2862-2869[Medline].
20. Miller, L. S., and S. C. Holt. 1977. Effect of carbon dioxide on pigment and membrane content in Synechococcus lividus. Arch. Microbiol. 115:185-198[CrossRef][Medline].
21. Mohamed, A., and C. Jansson. 1989. Influence of light on accumulation of photosynthesis-specific transcripts in the cyanobacterium Synechocystis PCC 6803. Plant Mol. Biol. 13:693-700[CrossRef][Medline].
22. Richaud, C., and G. Zabulon. 1997. The heme oxygenase gene (pbsA) in the red alga Rhodella violacea is discontinuous and transcriptionally activated during iron limitation. Proc. Natl. Acad. Sci. USA 94:11736-11741[Abstract/Free Full Text].
23. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1986. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
24. Schmidt, A., I. Erdle, and H.-P. Kost. 1982. Changes of c-phycocyanin in Synechococcus 6301 in relation to growth on various sulfur compounds. Z. Naturforsch. Teil C 37:870-876.
25. Schwarz, R., and A. R. Grossman. 1998. A response regulator of cyanobacteria integrates diverse environmental signals and is critical for survival under extreme conditions. Proc. Natl. Acad. Sci. USA 95:1108-1113[Abstract/Free Full Text].
26. Sherman, D. M., and L. A. Sherman. 1983. Effect of iron deficiency and iron restoration on ultrastructure of Anacystis nidulans. J. Bacteriol. 156:393-401[Abstract/Free Full Text].
27. Singh, A. B., and L. A Sherman. 2000. Identification of iron-responsive, differential gene expression in the cyanobacterium Synechocystis sp. strain PCC 6803 with a customized amplification library. J. Bacteriol. 182:3536-3543[Abstract/Free Full Text].
28. Stevens, S. E., D. L. Balkwill, and D. A. M. Paone. 1981. The effects of nitrogen limitation on the ultrastructure of the cyanobacterium Agmenellum quadruplicatum. Arch. Microbiol. 130:204-212[CrossRef].
29. Su, X., P. G. Fraenkel, and L. Bogorad. 1992. Excitation energy transfer from phycocyanin to chlorophyll in an apcA-defective mutant of Synechocystis sp. PCC 6803. J. Biol. Chem. 267:22944-22950[Abstract/Free Full Text].
30. Thomas, J.-C., and C. Passaquet. 1999. Characterization of a phycoerythrin without alpha -subunits from a unicellular red alga. J. Biol. Chem. 274:2472-2482[Abstract/Free Full Text].
31. Vioque, A. 1992. Analysis of the gene encoding the RNA subunit of ribonuclease P from cyanobacteria. Nucleic Acid Res. 20:6333-6337.
32. Wanner, G., Henkelmann, A. Schmidt, and H.-P. Kost. 1986. Nitrogen and sulfur starvation of the cyanobacterium Synechococcus 6301. An ultrastructural, morphological and biochemical comparison. Z. Naturforsch. Teil C 41:741-750.
33. Wood, N. B., and R. H. Haselkorn. 1980. Control of phycobiliprotein proteolysis and heterocyst differentiation in Anabaena. J. Bacteriol. 141:1375-1385[Abstract/Free Full Text].
34. Yamanaka, G., and A. N. Glazer. 1980. Dynamic aspects of phycobilisome structure. Phycobilisome turnover during nitrogen starvation in Synechococcus sp. Arch. Microbiol. 124:39-47[CrossRef].
35. Yamanaka, G., A. N. Glazer, and R. C. Williams. 1978. Cyanobacterial phycobilisomes. Characterization of the phycobilisomes of Synechococcus sp. 6301. J. Biol. Chem. 253:8303-8310[Abstract/Free Full Text].


Journal of Bacteriology, May 2001, p. 2989-2994, Vol. 183, No. 10
0021-9193/01/$04.00+0   DOI: 10.1128/JB.183.10.2989-2994.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Karradt, A., Sobanski, J., Mattow, J., Lockau, W., Baier, K. (2008). NblA, a Key Protein of Phycobilisome Degradation, Interacts with ClpC, a HSP100 Chaperone Partner of a Cyanobacterial Clp Protease. J. Biol. Chem. 283: 32394-32403 [Abstract] [Full Text]  
  • Dines, M., Sendersky, E., David, L., Schwarz, R., Adir, N. (2008). Structural, Functional, and Mutational Analysis of the NblA Protein Provides Insight into Possible Modes of Interaction with the Phycobilisome. J. Biol. Chem. 283: 30330-30340 [Abstract] [Full Text]  
  • Thomas, J.-C., Ughy, B., Lagoutte, B., Ajlani, G. (2006). A second isoform of the ferredoxin:NADP oxidoreductase generated by an in-frame initiation of translation. Proc. Natl. Acad. Sci. USA 103: 18368-18373 [Abstract] [Full Text]  
  • Lahmi, R., Sendersky, E., Perelman, A., Hagemann, M., Forchhammer, K., Schwarz, R. (2006). Alanine Dehydrogenase Activity Is Required for Adequate Progression of Phycobilisome Degradation during Nitrogen Starvation in Synechococcus elongatus PCC 7942.. J. Bacteriol. 188: 5258-5265 [Abstract] [Full Text]  
  • Ashby, M. K., Houmard, J. (2006). Cyanobacterial Two-Component Proteins: Structure, Diversity, Distribution, and Evolution. Microbiol. Mol. Biol. Rev. 70: 472-509 [Abstract] [Full Text]  
  • Takatani, N., Omata, T. (2006). Effects of PII Deficiency on Expression of the Genes Involved in Ammonium Utilization in the Cyanobacterium Synechocystis sp. Strain PCC 6803. Plant Cell Physiol 47: 679-688 [Abstract] [Full Text]  
  • Sakuragi, Y., Maeda, H., DellaPenna, D., Bryant, D. A. (2006). {alpha}-Tocopherol Plays a Role in Photosynthesis and Macronutrient Homeostasis of the Cyanobacterium Synechocystis sp. PCC 6803 That Is Independent of Its Antioxidant Function. Plant Physiol. 141: 508-521 [Abstract] [Full Text]  
  • Bienert, R., Baier, K., Volkmer, R., Lockau, W., Heinemann, U. (2006). Crystal Structure of NblA from Anabaena sp. PCC 7120, a Small Protein Playing a Key Role in Phycobilisome Degradation. J. Biol. Chem. 281: 5216-5223 [Abstract] [Full Text]  
  • Osanai, T., Sato, S., Tabata, S., Tanaka, K. (2005). Identification of PamA as a PII-binding Membrane Protein Important in Nitrogen-related and Sugar-catabolic Gene Expression in Synechocystis sp. PCC 6803. J. Biol. Chem. 280: 34684-34690 [Abstract] [Full Text]  
  • Schwarz, R., Forchhammer, K. (2005). Acclimation of unicellular cyanobacteria to macronutrient deficiency: emergence of a complex network of cellular responses. Microbiology 151: 2503-2514 [Abstract] [Full Text]  
  • Zhbanko, M., Zinchenko, V., Gutensohn, M., Schierhorn, A., Klosgen, R. B. (2005). Inactivation of a Predicted Leader Peptidase Prevents Photoautotrophic Growth of Synechocystis sp. Strain PCC 6803. J. Bacteriol. 187: 3071-3078 [Abstract] [Full Text]  
  • Ughy, B., Ajlani, G. (2004). Phycobilisome rod mutants in Synechocystis sp. strain PCC6803. Microbiology 150: 4147-4156 [Abstract] [Full Text]  
  • Baier, K., Lehmann, H., Stephan, D. P., Lockau, W. (2004). NblA is essential for phycobilisome degradation in Anabaena sp. strain PCC 7120 but not for development of functional heterocysts. Microbiology 150: 2739-2749 [Abstract] [Full Text]  
  • Stowe-Evans, E. L., Ford, J., Kehoe, D. M. (2004). Genomic DNA Microarray Analysis: Identification of New Genes Regulated by Light Color in the Cyanobacterium Fremyella diplosiphon. J. Bacteriol. 186: 4338-4349 [Abstract] [Full Text]  
  • de Alda, J. A. G. O., Lichtle, C., Thomas, J.-C., Houmard, J. (2004). Immunolocalization of NblA, a protein involved in phycobilisome turnover, during heterocyst differentiation in cyanobacteria. Microbiology 150: 1377-1384 [Abstract] [Full Text]  
  • Muro-Pastor, M. I., Reyes, J. C., Florencio, F. J. (2001). Cyanobacteria Perceive Nitrogen Status by Sensing Intracellular 2-Oxoglutarate Levels. J. Biol. Chem. 276: 38320-38328 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Richaud, C.
Right arrow Articles by Thomas, J.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Richaud, C.
Right arrow Articles by Thomas, J.-C.