![[Feedback]](/icons/banner/feedbackACT.gif)
![[For Subscribers]](/icons/banner/subscriberACT.gif)
![[Archive]](/icons/banner/archiveACT.gif)
![[Search]](/icons/banner/searchACT.gif)
![[Contents]](/icons/banner/tocACT.gif)
Previous Article | Next Article 
Journal of Bacteriology, May 2001, p. 2989-2994, Vol. 183, No. 10
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.10.2989-2994.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Nitrogen or Sulfur Starvation Differentially Affects
Phycobilisome Degradation and Expression of the nblA Gene
in Synechocystis Strain PCC 6803
Catherine
Richaud,*
Gérald
Zabulon,
Annette
Joder, and
Jean-Claude
Thomas
Unité Mixte de Recherche 8543, Centre
National de la Recherche Scientifique, "Photorégulation et
Dynamique des Membranes Végétales," Ecole Normale
Supérieure, 75230 Paris cedex 05, France
Received 7 November 2000/Accepted 6 March 2001
 |
ABSTRACT |
Nitrogen (N) limitation in cyanobacteria is well documented: a
reduced growth rate is observed, accompanied by a cessation of
phycobiliprotein synthesis and an ordered degradation of phycobilisomes (PBS). This leads to a dramatic bleaching phenomenon known as chlorosis. In Synechococcus strain PCC 7942, bleaching due
to PBS degradation is also observed under sulfur (S) or phosphorus (P)
limitation, and all three are under the control of the nblA gene product, a 59-amino-acid polypeptide which is overexpressed under
N, S, and P starvation (J. L. Collier, and A. R. Grossman, EMBO J. 13:1039-1047, 1994). Cyanobase sequence data for
Synechocystis strain PCC 6803 indicate the presence of two
tandem open reading frames (sll0452 and sll0453) homologous to
nblA. We cloned the two genes, identified a unique 5' mRNA
end suggestive of a single transcription start site, and studied
nblA expression under conditions of N or S starvation by
Northern hybridization: transcripts were detected only under N
starvation (no signal is detected in replete medium or with S
starvation), whether nblA1 or nblA2 was used as
a probe. Mutations in nblA1 and nblA2 were
constructed by insertion of a kanamycin cassette; both mutations were
nonbleaching under N starvation. Synechocystis strain PCC
6803 does not bleach under S starvation, consistent with the absence of
nblA induction in these conditions. These results were
confirmed by analysis of the PBS components: sequential degradation of
phycocyanin and associated linkers was observed only under conditions
of N starvation. This indicates differences between
Synechocystis strain PCC 6803 and Synechococcus
strain PCC 7942 in their regulatory and signaling pathways leading to
N- and S-starved phenotypes.
| |
INTRODUCTION |
Nutrient-limited growth of
non-N2-fixing cyanobacteria induces a set of general
responses, including cessation of cell division and important
morphological and physiological alterations such as loss of
photosynthetic membranes, increase of glycogen and inclusion bodies,
and loss of pigments (chlorophyll, phycobiliproteins [PBPs], and all
carotenoids except zeaxanthin). Besides these general effects,
certain nutrient-specific responses have been described, such as
increased synthesis of high-affinity transport systems, synthesis of
more readily transported metabolites, and synthesis of a new type of
phycocyanin (PC) (for a review, see reference 4).
The effect of nitrogen (N) starvation on the abundance of pigment
molecules in several cyanobacteria has been well documented, in
Anacystis nidulans (2),
Synechococcus sp. (34), Anabaena (11, 33), Synechococcus strain PCC 7002 (28), and Synechocystis strain PCC 6803 (10). The resulting decrease in chlorophyll and
phycobilisome (PBS) content leads to a dramatic change in cell color
from the normal blue-green to yellow-green, which is known as bleaching
or chlorosis. PBS, which can constitute up to 50% of the total
cellular protein, is progressively, rapidly, and almost completely
degraded; the chlorophyll content also declines. In this sense, PC, the
major constituant of PBS, acts as a nitrogen store; the material
released by protein degradation may provide substrates for the
synthesis of polypeptides required for acclimation to new N status
(2). In some Synechococcus species, bleaching also occurs in response to nutrient starvation for sulfur (S) (13, 24, 32), phosphorus (P) (12), carbon
(20), and iron (26). For starvation under
such nutrient conditions, as PBSs are a poor source of S-containing
amino acids and do not contain P or Fe, their degradation would be
rather for minimizing the absorption of excess excitation energy under
stress conditions (25). The most thoroughly documented
study of PBS degradation in response to environmental conditions is
that for Synechococcus sp. strain PCC 7942. Collier and
Grossman demonstrated that bleaching is different for N or S versus P
starvation (5). On growth media devoid of N or S, the
decrease in PBPs (due to blocked synthesis and a breakdown of existing
molecules) is much more rapid and complete than on P-limited media,
suggesting that different steps are involved in the different
nutrient-limited conditions.
In Synechococcus sp. strain PCC 7942, several mutations with
a nonbleaching (Nbl) phenotype have been described. Most of
them map to nblA, a gene encoding a small polypeptide of 59 amino acids, only transcribed in N- or S-limiting growth conditions and
to a lesser extent in P-limiting conditions (6). Another
nonbleaching mutation was isolated and mapped to the nblR
locus (25), a gene which encodes a response regulator
belonging to a two-component signal transduction pathway that controls
general acclimation responses (nutrients and light). Another
nbl mutation mapped to a third locus, nblB
(8), encoding a polypeptide with similarities to
phycobilin lyases, enzymes that catalyze covalent-bound formation between linear tetrapyrroles and PBPs. Transcription of nblA
(unlike nblB) is controlled by the response regulator NblR.
Other nblA genes that all originate from PBS-containing
organisms, cyanobacteria or red algae, are found in sequence data banks. In the genome of Synechocystis strain PCC 6803 (14), two tandem copies of nblA are present.
For this species, PBS degradation has only been studied under
conditions of N starvation (10). In this report, we
present data concerning the cloning, inactivation, and regulation of
expression of the Synechocystis strain PCC 6803 nblA cluster. We demonstrate that N starvation leads to
nblA induction, followed by PBS degradation, while S
starvation does not. This is in contrast to the results reported for
Synechococcus strain PCC 7942. Thus, different signal
transduction pathways must exist for these two cyanobacteria.
| |
MATERIALS AND METHODS |
Cyanobacterial strain and growth conditions.
Synechocystis sp. strain PCC 6803 was grown in BG-11 medium
(1) at 30°C under continuous illumination provided by
fluorescent white lamps, giving an intensity of 70 µE
m
2 s1. Cultures were either continuously
bubbled with sterile air or kept under a 5% (vol/vol)
CO2-enriched atmosphere in a rotary shaker (120 rpm).
Nutrient deprivation.
Cells in the log phase (approximately
1 × 107 to 2 × 107/ml) were
harvested by centrifugation at 7,000 × g for 5 min at
20°C, resuspended in a one-half volume of BG-11 medium 
N (devoid of NaNO3) or BG-11 medium S (devoid of MgSO4).
Controls consisted of washed cells resuspended in complete BG-11 medium
and inoculated at the same densities.
Spectroscopic studies.
Absorption spectra were recorded on a
DW2 Aminco spectrophotometer. Growth rates were routinely monitored by
optical density at 750 nm (9). Estimation of chlorophyll
and PBP content was performed using the expressions
A680 A750 and
A620 A750,
respectively, as index values.
PBS isolation.
Typically, log-phase cells (A750,
approximately 0.1 to 0.2) from 200-ml (for replete or S medium) or
400-ml (for N medium) volumes were collected by centrifugation, and
PBSs were isolated by the procedure of Yamanaka et al.
(35) with the modifications described by Thomas and
Passaquet (30). Polypeptides were separated on
polyacrylamide slab gels under denaturing conditions according to the
procedure of Laemmli (15). Stained gels were digitalized with a scanner (Studio ScanIIsi; Agfa) calibrated for optical density
measurements with a Kodak Scanner Transmission Tablet (grey scale). The
quantification of 
-PC (PC) and -allophycocyanin (AP)
(nomenclature according to reference 29) was performed with the public-access NIH Image software program. Values obtained after three measurements were weighted by their respective molecular masses.
DNA manipulation.
All molecular techniques were performed
according to standard procedures (23).
A 2-kb DNA fragment containing the nblA region was obtained
by PCR amplification with oligonucleotides designed from the sequences available in Cyanobase, Nbl2 (5'CGGATCCCCATCAAAATATAGTTC3')
and Nbl3 (5'CGGAATTCGCATAATCTGAACAATTCC3'). PCR
amplification was performed with 0.1 µg of purified
Synechocystis strain PCC 6803 DNA under the following
conditions: 1 cycle of 94°C denaturation for 5 min; 35 cycles at
94°C (30 s), 55°C (30 s), and 72°C (2 min); and 1 elongation
cycle of 10 min at 72°C using Tfl polymerase (Promega Corp., Madison
Wis.). The 2-kb fragment was cloned via BamHI and
EcoRI sites added at the ends of the oligonucleotides Nbl2
and Nbl3, respectively, into the pBluescript SK(+) vector, giving
plasmid pBSN2000.
Interposon inactivation.
The two open reading frames (ORFs)
identified in the DNA sequence of Synechocystis strain PCC
6803 were first inactivated on the plasmid by the insertion of a
cartridge containing the aphI gene, which confers kanamycin
resistance (Fig. 1B and C), from pUC-4K
(Pharmacia). The kan cartridge was inserted via
PstI-flanking sites into the unique PstI site of
nblA2 in plasmid pBSN2000. Inactivation of nblA1
was performed by insertion of a DNA fragment carrying, besides the
kan cartridge (1.3 kb), a 2.5-kb
SalI-PvuII fragment from pAM1583 (Susan Golden),
encoding the promoterless luxAB operon from Vibrio
harveyi (17). This 3.7-kb fragment was inserted into
the unique SphI site of nblA1 in plasmid
pBSN2000. The constructs are schematized in Fig. 1B and C. Synechocystis strain PCC 6803 was transformed by both
constructs and repeatedly subcultured on kanamycin (25 µg/ml) to
select for clones that had segregated. Complete segregation was
verified by PCR analysis using different pairs of relevant primers. The
nblA1-inactive mutant was designated N1LuxKm and the
nblA2-inactive one was called N2Km.
View larger version (28K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Map of the region of the Synechocystis
strain PCC 6803 genome encompassing nblA genes and of the
insertional inactivation performed in nblA1 and
nblA2 leading to N1luxKm (B) and N2Km (C) mutants,
respectively. In panel A, Nb12 and Nb13 indicate the position of
oligonucleotides used for amplifying the wt 2-kb region cloned into
plasmid pBSN2000. Nb3 and Nb2 were used for amplifying
nblA1; Nb5 and Nb4 were used for amplifying
nblA2. Nb2 and Nb4 were used as primers for 5' extension
experiments. Insertions luxkan (3.7 kb) (B) and kan (1.2 kb) (C) are
not represented on the same scale. (D) Primer extension mapping of the
in vivo nblA transcript was performed on 30 µg of total
RNA isolated from Synechocystis strain PCC 6803 wt cells
after 6 h of N starvation with either Nb2 or Nb4 as a primer. The
RNA-cDNA hybrid is calibrated (228 nt) with a standard sequence (the 5'
region of the nblA noncoding strand is presented in the
experiment). (E) Organization of the promoter region of the
nblA cluster showing the transcriptional start site (*)
and the upstream putative NtcA box.
|
|
RNA methods.
Samples of culture (100 to 200 ml with an
A750 value of approximately 0.2) were pelleted
at 7,000 × g for 5 min, dipped in liquid
N2, and stored at 80°C until processed. Total RNA was isolated as described in reference 21. A total of 5 µg
of RNA was subjected to electrophoresis on 1.2% denaturing agarose
gels in 0.5 M HEPES, 10 mM EDTA, and 16% formaldehyde and then
transferred to nylon membranes (Hybond-N; Amersham Pharmacia Biotech).
Hybridization was carried out at 42°C in 50% formamide with
nbl DNA probes obtained by PCR amplification with the
following oligonucleotides: Nb3 (5'TTGGAGGGGCAACAGCTATGAA3')
and Nb4 (5'GGGGAGGAGTGAATTTTTCATC3') for the probe
containing nblA1 and nblA2, Nb3 and Nb2
(5'ACCTAGGGGCTCCAGGGGAGCC3') for the
nblA1-specific probe, and Nb5 (5'ATGATCAACAACGAAGCC3') and Nb4 for the nblA2-specific probe. The
rnpB probe was a 500-bp EcoRI-HindIII fragment from plasmid pT76803
(31) encoding the Rnase P RNA.
5' mRNA determination.
Primer extension was performed to map
the 5' end of the nblA mRNA using oligonucleotides Nb2 and
Nb4 as primers. A total of 30 µg of total RNA from
Synechocystis strain PCC 6803 N-starved culture was used and
treated as described in reference 23, with modifications
as described in reference 22. To determine the size of the
hybrid, the sample was loaded onto a sequencing gel with a standard
sequencing reaction run in parallel.
| |
RESULTS AND DISCUSSION |
The two nblA coding sequences of
Synechocystis strain PCC 6803.
In the Genome Database,
two ORFs in Synechocystis strain PCC 6803 designated sll0452
(nblA1) and sll0453 (nblA2) encode 62- and
60-amino-acid-long polypeptides, respectively, that are homologous to
NblA. This protein is implicated in PBS degradation in
Synechococcus strain PCC 7942 (6). The distance
between the translation end codon of nblA1 and the
translation-initiating codon of nblA2 is 76 nucleotides
(nt). Flanking ORFs are oriented in the opposite direction, 584 nt
upstream (slr0271, unknown) from nblA1 and 217 nt downstream
(slr0270, unknown) from nblA2. The organization of the 2-kb
sequence of the nblA region cloned into plasmid pBSN2000 is
presented in Fig. 1A.
The transcription of the nblA cluster was studied under
different nutrient (N and S) states using a DNA probe containing both nblA1 and nblA2 (Fig.
2). No transcript could be detected from cells grown in complete medium or after 4 h of S starvation (Fig. 2B).
Under conditions of N starvation, a smear of transcripts ranging from
approximately 1,000 to 600 nt was obtained, which increased within
2 h and remained high several hours after initiating nitrogen
deprivation (Fig. 2A). Using the nblA1-specific probe, the
same smear was obtained (Fig. 2C) as well as for the
nblA2-specific probe (data not shown). These results are
consistent with a dicistronic operon for nblA1 and
nblA2 expression. A smear of transcripts has also been
observed in the case of Synechocystis strain PCC 6803 nblA induced under iron starvation (27) and in
the case of Synechococcus strain PCC 7942 nblA
induced under S starvation (6).
View larger version (58K):
[in this window]
[in a new window]
|
FIG. 2.
NblA Northern analysis of transcripts of wt
Synechocystis strain PCC 6803 under different growth
conditions as indicated, using nbl1 and nbl2 (A
and B) as a probe. (A) Samples taken at various times after N
starvation. (B) Samples taken after 4 h of growth on complete, N, or
S medium. (C) Analysis of nblA-encoding transcripts of
mutant strains N1LuxKm and N2Km compared to that of the wt, from 4 h of
growth for cells grown in N; nbl1 was used as a probe. The
same blots were used for hybridization with the rnpB probe.
Probes are described in Materials and Methods.
|
|
The 5' end of the nblA mRNA was mapped by primer extension,
using total RNA from N-starved cells and oligonucleotides Nb2 or Nb4 as
primers hybridizing, respectively, with the end of the nblA1
and nblA2 coding sequences (Fig. 1A). A unique 5' extension product was identified with Nb2 as a primer (Fig. 1D) at the A, 43 nt
before the initiating ATG (Fig. 1E). With Nb4 as a primer, no extension
product could be detected, which strongly suggests the absence of a
transcription start in front of nblA2; the expected extension product from Nb4 to the 5' mRNA end identified with Nb2
primer would be 480 nt long at the limit of the method. The sequence
GTAN8TAC, a putative binding site for the transcriptional activator NtcA (19) can be found centered 48 nt before the
identified 5' mRNA end, strengthening this site as a putative
transcription start (Fig. 1E).
Inactivation of nblA1 and nblA2.
The
two ORFs nblA1 and nblA2 were each inactivated by
interposon mutagenesis, leading to strains N1LuxKm and N2Km, respectively.
For both strains, growth and pigment contents were compared to those of
the wild type (wt) after culturing either strain in complete medium or
under N starvation conditions. The two mutants grew at a rate slightly
slower than that of the wt strain (doubling time in complete medium of
18 h for the mutants compared to 16 h for the wt). The
increase in chlorophyll content, estimated by
A680 A750,
followed the increase in cell number for the wt and the mutants in
complete medium, while with N medium, the three strains almost
immediately stopped chlorophyll synthesis (data not shown). The PBP
content as estimated by A620 A750 is presented in Fig.
3: for the wt strain and the mutants, the PBP concentration in complete medium increased, following cell division
and chlorophyll synthesis; under N starvation, the level of PBP in the
wt strain clearly decreased; in contrast, the two mutants presented a
constant level of PBP, indicating a block in PBP synthesis but no
degradation.
View larger version (18K):
[in this window]
[in a new window]
|
FIG. 3.
A representative experiment showing evolution of the PBP
content estimated by A620 A750 of Synechocystis strain PCC 6803 wt, N1LuxKm, and N2Km strains in BG-11 or N medium.
|
|
PBSs were isolated from the three strains (wt, N1LuxKm, and N2Km) from
the three different culture media (complete BG-11, N, or S)
harvested 34 h after nutrient deprivation. The PBS polypeptide
components were resolved by lithium dodecyl sulfate-polyacrylamide gel
electrophoresis (LiDS-PAGE) and stained with Coomassie blue (Fig.
4). A clear degradation of PC and
associated linkers (LR34.5 and LR33) was
observed for wt PBS under N starvation, while PBSs isolated from the
two mutants were stable under all the conditions tested (90 h of
starvation had no added effect). Thus, insertion in either of the two
nblA coding sequences prevents PBS degradation.
View larger version (55K):
[in this window]
[in a new window]
|
FIG. 4.
Polypeptide composition of PBSs determined by LiDS-PAGE
of wt, N1LuxKm, and N2Km strains grown either N, complete, or S
medium for 34 h. The ratio PC/AP has been calculated as
described in Materials and Methods. The nomenclature of PC and AP
subunits is derived from reference 29.
|
|
To further characterize the two mutants, we performed a transcriptional
analysis using nblA1 as a specific probe after 4 h of N
starvation, under which conditions nblA mRNA was fully
induced in the wt. No significant transcripts were detected in the
mutants (Fig. 2C). The same results were obtained using an
nblA2-specific probe (data not shown). The absence of signal
using RNA extracted from N2Km mutant cells grown in N medium with the
nblA1 probe (Fig. 2C) is rather surprising, as we expected
transcripts running from the putative tsp (upstream nblA1)
until the end of the kan gene (Fig. 1C). This result leads
us to postulate that the insertion of the kanamycin cartridge in
nblA2 destabilizes the transcripts.
Comparison of Synechocystis strain PCC 6803 under
nutrient (N or S) limitation.
wt Synechocystis strain
PCC 6803 was grown in replete BG11 medium as well as in N and S
media. Growth in N- or S-starved culture compared to replete culture
was followed by A750 analysis during several
days (Fig. 5); over 2 days, the doubling
time estimated by increasing A750 from cells
grown in N-starved or S-starved medium was not affected by either
treatment. While chlorophyll synthesis follows cell division in
complete medium, in N- or S-deprived cultures, chlorophyll accumulation
stopped almost immediately (data not shown). This behavior has already
been observed in Synechococcus strain PCC 7942 (5). Estimation of the pigment content can be provided by
whole-cell absorption spectra (see Materials and Methods). In Fig.
6 spectra are presented for wt
Synechocystis strain PCC 6803 either grown in complete BG-11
medium or after 17 h of N or S starvation. The value
(A620 A750)/(A680 A750) is indicative of the PBP/Chl ratio. This
ratio is lower for cells grown under conditions of N starvation (0.78),
while for the cells grown under 17 h of S starvation this ratio is
almost indistinguishable (1.05) from that of cells grown in
nutrient-replete medium.
View larger version (13K):
[in this window]
[in a new window]
|
FIG. 5.
A representative experiment showing growth rate
(estimated by A750) of the
Synechocystis strain PCC 6803 wt strain grown in BG-11
( ), N (---), or S (. . . . .)
medium.
|
|
View larger version (14K):
[in this window]
[in a new window]
|
FIG. 6.
Whole-cell absorption spectra for wt cells grown 17 h on nitrogen-deprived (---) and sulfur-deprived
(. . . . .) cultures, compared to those grown on
complete BG-11 () culture.
|
|
The absence of an effect of S starvation and the effect of N starvation
on PBP content is confirmed after 34 h by the resolution of PBS
components by LiDS-PAGE (Fig. 4). Under N starvation, the decrease in
PC and associated linkers occurs within 8 h of N starvation (data
not shown), the PC/AP ratio being 2.7, 2.2, 2.0, and 1.3 after 8, 13, 17, and 34 hours of starvation, respectively. This phenomenon of
sequential degradation of PBS has already been described for
Synechococcus strain PCC 7942 (5).
Conclusion.
We have shown that Synechocystis strain
PCC 6803 PBSs are not degraded under S starvation, whereas they are
with N starvation. In the latter case, this degradation was correlated
with the expression of the nblA cluster. In
Synechocystis strain PCC 6803, the only putative
transcriptional start site detected as a 5' end of mRNA was that
present 43 bp before the initiating nblA1 ATG.
Fourteen NblA sequences are now available in the data banks. Their
sizes range from 54 to 62 amino acids, and significant homologies are
found along the 50 central residues (data not shown). Synechocystis strain PCC 6803 NblA1 and NblA2 are 30%
identical and 68% similar, taking into account conservative amino acid
substitutions. Other cyanobacterial genomes like Anabaena
strain PCC 7120 or Nostoc punctiforme contain more than one
nblA gene, but Synechocystis strain PCC 6803 is
the sole organism as yet described containing two copies in tandem. We
have shown that an insertion in each of the coding sequences prevents
the presence of stable transcripts inducible under conditions of N
starvation, consistent with the nbl-deficient phenotype of
both mutants. A question remains: what is the active form of the NblA
proteinNblA1, NblA2, or a heterodimer (NblA1-NblA2)? The sequence
NblA1 appears more divergent than NblA2 from the consensus NblA or from
any other NblA (for instance, NblA1 is 21% identical to
Synechococcus strain PCC 7942 compared to 25% for NblA2).
The mechanism by which NblA may act in PBS degradation has not yet been
elucidated. Different hypotheses were proposed for its role: it could
be a specific protease, it could affect the synthesis or the
specificity of a molecule involved in PBS degradation, or it might be
tightly associated to PBSs to mark them for degradation
(6).
The responses of Synechocystis strain PCC 6803 and
Synechococcus strain PCC 7942 are different in S starvation,
as the latter degrades its PBS and the former does not. The absence of
growth of Synechocystis strain PCC 6803 after 2 days of S
starvation seems to indicate that needs of Synechocystis
strain PCC 6803 for S should be as those of Synechococcus
strain PCC 7942. What is the program of responses triggered by S
starvation in Synechocystis strain PCC 6803? Specific
responses involved in other photosynthetic organisms in acclimation to
S starvation have not been studied in strain PCC 6803: activation of
sulfate transport, acquisition or utilization of diverse S compounds
(4), and increase of the carotenoid zeaxanthin for thermal
dissipation of energy (18). Different sulfur deprivation
regulatory proteins have been characterized in photosynthetic
organisms. (i) CysR, identified in Synechococcus strain PCC
7942 (16), is similar to prokaryotic DNA-binding proteins
Fnr, Crp, and FixK; no homologue of CysR is present in the genome of
Synechocystis strain PCC 6803. (ii) Sac1, a putative sensor
of the sulfur status of the environment, is required in Chlamydomonas reinhardtii for survival of sulfur-deprived
cells in the light (7); a homologue (sll0640) present in
Synechocystis strain PCC 6803 is of particular interest.
(iii) NblR, identified in Synechococcus strain PCC 7942 (25), is homologous to response regulators of
two-component signal transduction systems and controls general
acclimation responses for survival during nutrient (N, S, and P) and
high-light stresses; NblR controls PBS degradation via induction of
nblA and probably controls additional functions critical for
cell survival. Study of the nblR equivalent (sll0396) in
Synechocystis strain PCC 6803, an organism responding
differently to S starvation, could provide new information concerning
the pivotal role of NblR, and differences in the regulatory and signal transduction pathways of Synechocystis strain PCC 6803 and
Synechococcus strain PCC 7942 are predicted.
| |
ACKNOWLEDGMENTS |
We are grateful to Anne-Lise Etienne for comments throughout this
work and to Jean Houmard and Andy Pascal for critical reading of the manuscript.
This work was supported by Aquasense (EU contract ENV4-CT97-0493).
| |
ADDENDUM |
During the revision of the manuscript, an independent study (K.,
Baier, S. Nicklisch, C. Grundner, J. Reinecke, and W. Lockau, FEMS
Microbiol. Lett. 195:35-39, 2001) presented data in agreement with part of our results.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Unité
Mixte de Recherche 8543, Centre National de la Recherche Scientifique,
"Photorégulation et Dynamique des Membranes
Végétales," Ecole Normale Supérieure, 46 rue
d'Ulm, 75230 Paris cedex 05, France. Phone: 33 1 44 32 35 40. Fax: 33 1 44 32 39 35. E-mail: richaud{at}wotan.ens.fr.
| |
REFERENCES |
| 1.
|
Allen, M. M.
1968.
Simple conditions for growth of unicellular blue-green algae on plates.
J. Phycol.
4:1-4.
|
| 2.
|
Allen, M. M., and A. J. Smith.
1969.
Nitrogen chlorosis in blue-green algae.
Arch. Mikrobiol.
69:114-120[CrossRef][Medline].
|
| 3.
|
Apt, K. E., and A. R. Grossman.
1993.
The phycobilisome 18 subunit gene of allophycocyanin is located on the plastid genome in Aglaothamnion neglectum (Rhodophyta) and cotranscribed with an unidentified open reading frame.
J. Phycol.
29:716-718[CrossRef].
|
| 4.
|
Bhaya, D.,
R. Schwarz, and A. R. Grossman.
2000.
Molecular responses to environmental stress, p. 397-442.
In
B. A. Whitton, and M. Potts (ed.), The ecology of cyanobacteria. Kluwer Academic Publishers, Dordrecht, The Netherlands.
|
| 5.
|
Collier, J. L., and A. R. Grossman.
1992.
Chlorosis induced by nutrient deprivation in Synechococcus sp. strain PCC 7942: not all bleaching is the same.
J. Bacteriol.
174:4718-4726[Abstract/Free Full Text].
|
| 6.
|
Collier, J. L., and A. R. Grossman.
1994.
A small polypeptide triggers complete degradation of light-harvesting phycobiliproteins in nutrient-deprived cyanobacteria.
EMBO J.
13:1039-1047[Medline].
|
| 7.
|
Davies, J. P.,
F. Yildiz, and A. R. Grossman.
1994.
Mutants of Chlamydomonas with aberrant responses to sulfur deprivation.
Plant Cell
6:53-63[Abstract].
|
| 8.
|
Dolganov, N., and A. R Grossman.
1999.
A polypeptide with similarity to phycocyanin  -subunit phycocyanobilin lyase involved in degradation of phycobilisomes.
J. Bacteriol.
181:610-617[Abstract/Free Full Text].
|
| 9.
|
Duke, C. S.,
A. Cezeaux, and M. M. Allen.
1989.
Changes in polypeptide composition of Synechocystis sp. strain 6308 phycobilisomes induced by nitrogen starvation.
J. Bacteriol.
160:1960-1966.
|
| 10.
|
Elmorjani, K., and M. Herdman.
1987.
Metabolic control of phycocyanin degradation in the cyanobacterium Synechocystis PCC 6803: a glucose effect.
J. Gen. Microbiol.
133:1685-1694.
|
| 11.
|
Foulds, I. J., and N. G. Carr.
1977.
A proteolytic enzyme degrading phycocyanin in the cyanobacterium Anabaena cylindrica.
FEMS Microbiol. Lett.
2:117-119.
|
| 12.
|
Ihlenfeldt, M. J. A., and J. Gibson.
1975.
Phosphate utilization and alkaline phosphatase activity in Anacystis nidulans (Synechococcus).
Arch. Microbiol.
102:23-28[CrossRef][Medline].
|
| 13.
|
Jensen, T. E., and J. W. Rachlin.
1984.
Effect of varying sulfur deficiency on structural components of a cyanobacterium Synechococcus leopoliensis: a morphometric study.
Cytobios
41:35-46.
|
| 14.
|
Kaneko, T.,
S. Sato,
H. Kotani,
A. Tanaka,
E. Asamizu,
Y. Nakamura,
N. Miyajima,
H. Hirosawa,
M. Sugiura,
S. Sasamoto,
T. Kimura,
T. Hosouchi,
A. Matsuno,
A. Muraki,
N. Nakazaki,
K. Naruo,
S. Okumura,
S. Shimpo,
C. Takeuchi,
T. Wada,
A. Watanabe,
M. Yamada,
M. Yasuda, and S. Tabata.
1996.
Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC6803. II. Sequence determination of the entire genome and assignment of potential protein coding regions.
DNA Res.
2:153-166.
|
| 15.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:660-685[Medline].
|
| 16.
|
Laudenbach, D. E., and A. R. Grossman.
1991.
Characterization and mutagenesis of sulfur-regulated genes in a cyanobacterium: evidence for function in sulfate transport.
J. Bacteriol.
173:2739-2750[Abstract/Free Full Text].
|
| 17.
|
Legocki, R. P.,
M. Legocki,
T. O. Baldwin, and A. A Szalay.
1986.
Bioluminescence in soybean root nodules: demonstration of a general approach to assay gene expression in vivo by using bacterial luciferase.
Proc. Natl. Acad. Sci. USA
83:9080-9084[Abstract/Free Full Text].
|
| 18.
|
Levy, H.,
T. Tal,
A. Shaish, and A. Zamir.
1993.
Cbr, an algal homolog of plant early light-induced proteins, is a putative zeaxanthin binding protein.
J. Biol. Chem.
268:20892-20896[Abstract/Free Full Text].
|
| 19.
|
Luque, I.,
F. Flores, and A. Herrero.
1994.
Molecular mechanism for the operation of nitrogen control in cyanobacteria.
EMBO J.
13:2862-2869[Medline].
|
| 20.
|
Miller, L. S., and S. C. Holt.
1977.
Effect of carbon dioxide on pigment and membrane content in Synechococcus lividus.
Arch. Microbiol.
115:185-198[CrossRef][Medline].
|
| 21.
|
Mohamed, A., and C. Jansson.
1989.
Influence of light on accumulation of photosynthesis-specific transcripts in the cyanobacterium Synechocystis PCC 6803.
Plant Mol. Biol.
13:693-700[CrossRef][Medline].
|
| 22.
|
Richaud, C., and G. Zabulon.
1997.
The heme oxygenase gene (pbsA) in the red alga Rhodella violacea is discontinuous and transcriptionally activated during iron limitation.
Proc. Natl. Acad. Sci. USA
94:11736-11741[Abstract/Free Full Text].
|
| 23.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1986.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 24.
|
Schmidt, A.,
I. Erdle, and H.-P. Kost.
1982.
Changes of c-phycocyanin in Synechococcus 6301 in relation to growth on various sulfur compounds.
Z. Naturforsch. Teil C
37:870-876.
|
| 25.
|
Schwarz, R., and A. R. Grossman.
1998.
A response regulator of cyanobacteria integrates diverse environmental signals and is critical for survival under extreme conditions.
Proc. Natl. Acad. Sci. USA
95:1108-1113[Abstract/Free Full Text].
|
| 26.
|
Sherman, D. M., and L. A. Sherman.
1983.
Effect of iron deficiency and iron restoration on ultrastructure of Anacystis nidulans.
J. Bacteriol.
156:393-401[Abstract/Free Full Text].
|
| 27.
|
Singh, A. B., and L. A Sherman.
2000.
Identification of iron-responsive, differential gene expression in the cyanobacterium Synechocystis sp. strain PCC 6803 with a customized amplification library.
J. Bacteriol.
182:3536-3543[Abstract/Free Full Text].
|
| 28.
|
Stevens, S. E.,
D. L. Balkwill, and D. A. M. Paone.
1981.
The effects of nitrogen limitation on the ultrastructure of the cyanobacterium Agmenellum quadruplicatum.
Arch. Microbiol.
130:204-212[CrossRef].
|
| 29.
|
Su, X.,
P. G. Fraenkel, and L. Bogorad.
1992.
Excitation energy transfer from phycocyanin to chlorophyll in an apcA-defective mutant of Synechocystis sp. PCC 6803.
J. Biol. Chem.
267:22944-22950[Abstract/Free Full Text].
|
| 30.
|
Thomas, J.-C., and C. Passaquet.
1999.
Characterization of a phycoerythrin without -subunits from a unicellular red alga.
J. Biol. Chem.
274:2472-2482[Abstract/Free Full Text].
|
| 31.
|
Vioque, A.
1992.
Analysis of the gene encoding the RNA subunit of ribonuclease P from cyanobacteria.
Nucleic Acid Res.
20:6333-6337.
|
| 32.
|
Wanner, G.,
Henkelmann,
A. Schmidt, and H.-P. Kost.
1986.
Nitrogen and sulfur starvation of the cyanobacterium Synechococcus 6301. An ultrastructural, morphological and biochemical comparison.
Z. Naturforsch. Teil C
41:741-750.
|
| 33.
|
Wood, N. B., and R. H. Haselkorn.
1980.
Control of phycobiliprotein proteolysis and heterocyst differentiation in Anabaena.
J. Bacteriol.
141:1375-1385[Abstract/Free Full Text].
|
| 34.
|
Yamanaka, G., and A. N. Glazer.
1980.
Dynamic aspects of phycobilisome structure. Phycobilisome turnover during nitrogen starvation in Synechococcus sp.
Arch. Microbiol.
124:39-47[CrossRef].
|
| 35.
|
Yamanaka, G.,
A. N. Glazer, and R. C. Williams.
1978.
Cyanobacterial phycobilisomes. Characterization of the phycobilisomes of Synechococcus sp. 6301.
J. Biol. Chem.
253:8303-8310[Abstract/Free Full Text].
|
Journal of Bacteriology, May 2001, p. 2989-2994, Vol. 183, No. 10
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.10.2989-2994.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Thomas, J.-C., Ughy, B., Lagoutte, B., Ajlani, G.
(2006). A second isoform of the ferredoxin:NADP oxidoreductase generated by an in-frame initiation of translation. Proc. Natl. Acad. Sci. USA
103: 18368-18373
[Abstract]
[Full Text]
-
Lahmi, R., Sendersky, E., Perelman, A., Hagemann, M., Forchhammer, K., Schwarz, R.
(2006). Alanine Dehydrogenase Activity Is Required for Adequate Progression of Phycobilisome Degradation during Nitrogen Starvation in Synechococcus elongatus PCC 7942.. J. Bacteriol.
188: 5258-5265
[Abstract]
[Full Text]
-
Ashby, M. K., Houmard, J.
(2006). Cyanobacterial Two-Component Proteins: Structure, Diversity, Distribution, and Evolution. Microbiol. Mol. Biol. Rev.
70: 472-509
[Abstract]
[Full Text]
-
Takatani, N., Omata, T.
(2006). Effects of PII Deficiency on Expression of the Genes Involved in Ammonium Utilization in the Cyanobacterium Synechocystis sp. Strain PCC 6803. Plant Cell Physiol
47: 679-688
[Abstract]
[Full Text]
-
Sakuragi, Y., Maeda, H., DellaPenna, D., Bryant, D. A.
(2006). {alpha}-Tocopherol Plays a Role in Photosynthesis and Macronutrient Homeostasis of the Cyanobacterium Synechocystis sp. PCC 6803 That Is Independent of Its Antioxidant Function. Plant Physiol.
141: 508-521
[Abstract]
[Full Text]
-
Bienert, R., Baier, K., Volkmer, R., Lockau, W., Heinemann, U.
(2006). Crystal Structure of NblA from Anabaena sp. PCC 7120, a Small Protein Playing a Key Role in Phycobilisome Degradation. J. Biol. Chem.
281: 5216-5223
[Abstract]
[Full Text]
-
Osanai, T., Sato, S., Tabata, S., Tanaka, K.
(2005). Identification of PamA as a PII-binding Membrane Protein Important in Nitrogen-related and Sugar-catabolic Gene Expression in Synechocystis sp. PCC 6803. J. Biol. Chem.
280: 34684-34690
[Abstract]
[Full Text]
-
Schwarz, R., Forchhammer, K.
(2005). Acclimation of unicellular cyanobacteria to macronutrient deficiency: emergence of a complex network of cellular responses. Microbiology
151: 2503-2514
[Abstract]
[Full Text]
-
Zhbanko, M., Zinchenko, V., Gutensohn, M., Schierhorn, A., Klosgen, R. B.
(2005). Inactivation of a Predicted Leader Peptidase Prevents Photoautotrophic Growth of Synechocystis sp. Strain PCC 6803. J. Bacteriol.
187: 3071-3078
[Abstract]
[Full Text]
-
Ughy, B., Ajlani, G.
(2004). Phycobilisome rod mutants in Synechocystis sp. strain PCC6803. Microbiology
150: 4147-4156
[Abstract]
[Full Text]
-
Baier, K., Lehmann, H., Stephan, D. P., Lockau, W.
(2004). NblA is essential for phycobilisome degradation in Anabaena sp. strain PCC 7120 but not for development of functional heterocysts. Microbiology
150: 2739-2749
[Abstract]
[Full Text]
-
Stowe-Evans, E. L., Ford, J., Kehoe, D. M.
(2004). Genomic DNA Microarray Analysis: Identification of New Genes Regulated by Light Color in the Cyanobacterium Fremyella diplosiphon. J. Bacteriol.
186: 4338-4349
[Abstract]
[Full Text]
-
de Alda, J. A. G. O., Lichtle, C., Thomas, J.-C., Houmard, J.
(2004). Immunolocalization of NblA, a protein involved in phycobilisome turnover, during heterocyst differentiation in cyanobacteria. Microbiology
150: 1377-1384
[Abstract]
[Full Text]
-
Muro-Pastor, M. I., Reyes, J. C., Florencio, F. J.
(2001). Cyanobacteria Perceive Nitrogen Status by Sensing Intracellular 2-Oxoglutarate Levels. J. Biol. Chem.
276: 38320-38328
[Abstract]
[Full Text]
Top
Abstract
Introduction
