Previous Article | Next Article ![]()
Journal of Bacteriology, May 2001, p. 3108-3116, Vol. 183, No. 10
Department of Microbiology, The University of
Alabama at Birmingham, Birmingham, Alabama
35294,1 and Department of Molecular
Biosciences, Adelaide University, Adelaide, South Australia 5005, Australia2
Received 2 November 2000/Accepted 7 March 2001
It was previously proposed that autolysin's primary role in the
virulence of pneumococci was to release pneumolysin to an extracellular
location. This interpretation came into question when pneumolysin was
observed to be released in significant amounts from some pneumococci
during log-phase growth, because autolysis was not believed to occur at
this time. We have reexamined this phenomenon in detail for one such
strain, WU2. This study found that the extracellular release of
pneumolysin from WU2 was not dependent on autolysin action. A mutant
lacking autolysin showed the same pattern of pneumolysin release as the
wild-type strain. Addition of mitomycin C to a growing WU2 culture did
not induce lysis, indicating the absence of resident bacteriophages
that could potentially harbor lytA-like genes. Furthermore,
release of pneumolysin was unaltered by growth in 2% choline, a
condition which is reported to inactivate autolysin, as well as most
known pneumococcal phage lysins. Profiles of total proteins in the
cytoplasm and in the supernatant media supported the hypothesis that
release of pneumolysin is independent of pneumococcal lysis. Finally, under some infection conditions, mutations in pneumolysin and autolysin
had different effects on virulence.
Pneumococci elaborate a variety of
factors that contribute to virulence. These include the capsule,
surface proteins like PspA, PspC, and PsaA, and proteins like
pneumolysin (Ply), which must be released into the extracellular
environment in order to affect host cells (10, 11, 28,
32). In addition, cell wall degradation products released as a
result of the action of the enzyme autolysin (LytA) are known to
mediate inflammation and toxicity in several animal models. LytA, the
major pneumococcal lysin, is an
N-acetylmuramoyl-L-alanine amidase
(27). It can be activated to cause lysis of the bacteria
in the stationary phase or upon penicillin treatment (25).
Autolysin mutants have attenuated virulence in animal models compared
to that of isogenic wild-type pneumococci. This suggests a role for
autolysin and possibly for the inflammation that follows autolysis in
pneumococcal virulence and pathogenesis (4, 5, 12).
Previous studies demonstrated that immunity to pneumolysin and
autolysin provide similar degrees of protection against intraperitoneal
(i.p.) challenge (5, 12). Immunity to both factors did not
result in greater protection than immunity to either one alone
(22). It has been suggested that autolysin plays its role
in pathogenesis in two ways: (i) by generating inflammatory cell wall
degradation products and (ii) by releasing the pneumococcal cytoplasmic
contents, including virulence factors such as pneumolysin
(25).
Pneumolysin is a multifunctional cytolysin. It belongs to a family of
related thiol-activated toxins synthesized by gram-positive bacteria of
different genera. Pneumolysin is capable of a variety of detrimental
effects on the components of the host immune system, and its role in
pathogenesis has been established in several ways. Antibody titers to
pneumolysin rise in humans following pneumococcal infection, indicating
that the protein is synthesized by the bacteria while they are growing
in the host (20). This conclusion is also supported by the
fact that mutants lacking the ability to make pneumolysin are less
virulent (6). Antibodies to pneumolysin confer partial
protection against infection following intranasal or i.p. inoculation
in mice (22). Pneumolysin has been implicated as playing a
particularly important role in pneumococcal pneumonia (12). Immunofluorescence data on tissue sections show the
presence of pneumolysin in the lungs of infected mice. Pneumolysin is
produced by virtually all known strains of Streptococcus
pneumoniae, although there appears to be some differential
hemolytic activity among pneumolysins from different strains
(23).
Earlier reports have shown that pneumolysin is located in the cytoplasm
of pneumococci (21). The pneumolysin protein, unlike the
other thiol-activated toxins, lacks an N-terminal signal sequence for
transport out of the cytoplasm (36). This observation led to the hypothesis that pneumolysin is released upon autolysin-dependent autolysis of pneumococci (28). We have previously observed
two patterns of extracytoplasmic release of pneumolysin
(2). In a majority of the strains, including capsule type
2 strain D39, extracellular pneumolysin is not evident until late log
phase. However, for strains WU2, A66.1, GB05 (capsular type 3), EF3296, EF5668 (capsular type 4), and DBL6A (capsular type 6A), the presence of
extracellular pneumolysin could be detected in early log phase, much
before generalized cell lysis. This early-log-phase release pattern may
occur in one of two ways: (i) a specific autolysin-dependent nonlytic
release of pneumolysin may occur prior to stationary phase and
generalized cell lysis or (ii) pneumolysin may be released in an
autolysin-independent manner.
In the present study, we evaluated the potential role of autolysin in
pneumolysin release in two ways. One approach used autolysin-negative mutants of the virulent type 3 pneumococcus WU2 in which the autolysin gene was interrupted by insertion duplication mutagenesis
(30). In the second approach, WU2 was grown in broth
containing 2% choline chloride to suppress autolysin activity. Neither
test supported a requirement for autolysis in pneumolysin release.
Pneumococcal strains and growth conditions.
Pneumococcal
strains used in this study are listed in Table
1. The bacteria were routinely grown in
Todd-Hewitt broth containing 0.5% yeast extract (THY) or on blood agar
base (Difco Laboratories, Detroit, Mich.) supplemented with sterile 5%
defibrinated sheep blood (Colorado Serum Company, Denver, Colo.). THY
and blood agar plates were supplemented with erythromycin (0.3 µg/ml)
for strains carrying an erythromycin resistance marker. When required,
2% choline chloride was added to THY.
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.10.3108-3116.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
The Autolytic Enzyme LytA of Streptococcus
pneumoniae Is Not Responsible for Releasing Pneumolysin
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Strains used in this study
Transformation. Competent WU2 cells were transformed with chromosomal lysates from AL-2 and PLN-A as previously described (38). The transformants were selected on blood agar plates supplemented with erythromycin (0.3 µg/ml). Each transformant was backcrossed three times into the wild-type WU2 background.
Southern blot analyses. Chromosomal DNAs were extracted from the indicated pneumococcal strains and digested with HindIII or ClaI under conditions described by the manufacturer (Promega, Madison, Wis.). The digests were loaded on a 1.0% agarose gel and separated by electrophoresis in Tris-borate-EDTA buffer. The DNAs were transferred to a nylon membrane (Micron Separations Inc., Westborough, Mass.) and then detected by hybridization with a PCR-generated autolysin-specific (primers 5' TTTCTCGCACATTGTTGGGAAC 3' and 5' CGCTGACTGGATAAAGGCATTTG 3'; 709-bp PCR product) or pneumolysin-specific (primers 5' TCTGTAACAGCTACCAAC 3' and 5' CAGAAATTCCTCTCTGTT 3'; 508-bp PCR product) DNA probe labeled with digoxigenin (Roche Molecular Biochemicals, Indianapolis, Ind.).
In vitro growth curves. Colonies from overnight growth on blood agar plates were inoculated into 5 ml of THY. The cultures were allowed to grow under static conditions to early log phase and then, based on their optical densities at 600 nm (OD600), were diluted into 250 ml of fresh THY such that the density of the cells in the new medium was about 105 CFU/ml. The lytA mutant strains were grown without added antibiotics. The stability of the lytA mutation under these conditions was confirmed by plating on blood agar plates containing 0.3 µg of erythromycin per ml.
Samples were withdrawn at various time points between 0 and 10 h. At each time point, 5-ml aliquots were taken. One milliliter was used to determine the OD600, and 50 µl of this sample was used to determine the viable counts. The remaining 4 ml was centrifuged at 7,000 rpm for 10 min in a Sorvall RC-5B superspeed centrifuge. The top 1 ml of the supernatant was taken to determine the extracellular pneumolysin hemolytic titer. The pellet was lysed with lysis buffer (0.01% sodium dodecyl sulfate, 0.1% sodium deoxycholate, 0.015 M sodium citrate) and incubated at 37°C for 30 min. The final volume of the lysed pellet was 400 µl (1/10 of that of the original sample of 4 ml). The cytoplasmic hemolytic titers, described below, were divided by 10 so as to normalize the titers for the pellets and the supernatants so that both represented pneumolysin from the same number of cells. When the samples were collected for Western blotting, 15-ml aliquots were taken at each time point. After centrifugation, the top 7 ml of the supernatant was recovered for total protein analysis. The supernatant proteins were concentrated by precipitation with 10% trichloroactetic acid (TCA) overnight at 4°C. The precipitated proteins were collected by centrifugation. The pellets were washed twice with acetone and resuspended in distilled water. The pellet was lysed as described above (final volume, 1.5 ml). For Western blotting, the samples were concentrated with 10% TCA as described above for supernatant proteins. The lysed pellets and the culture supernatants were frozen at
70°C until the hemolytic assay was performed.
Autolysin-deficient mutants are resistant to detergent lysis.
Therefore, these strains were lysed using the FastPrep system (Bio 101, Vista, Calif.). Bacteria in the lysis buffer were shaken with silica
and ceramic spheres for 20 s at 6,000 vibrations/min. This lysate
was stored at
70°C until the assay was performed. The same
procedure was followed for cells grown in choline-containing media.
Pneumolysin hemolytic assay. The hemolytic assay was performed as previously described (2). This semiquantitative endpoint assay measures the hemolytic activity of pneumolysin. The values reported are reciprocal titers (hemolytic units) and represent the highest threefold dilutions at which all the sheep red blood cells lysed. The maximum dilution of the lysed pneumococcal pellet that caused lysis of sheep red blood cells was designated the cytoplasmic pneumolysin titer. The hemolytic titer of the supernatant was designated the extracellular titer. The negative controls were a ply mutant strain (UB1122/UB2271), lysis buffer alone, THY alone, or phosphate-buffered saline alone. None of these controls caused lysis of sheep red blood cells under the assay conditions.
Western blot analysis. The amounts of total protein in the TCA-precipitated pellets and supernatant were determined by the Lowry method. Volumes containing 10 µg of total protein were mixed with 5× sample buffer, boiled for 5 min, and loaded on a Tris-HCl-10% polyacrylamide gel. The proteins in the gel were transferred to a nitrocellulose membrane, and the blot was probed with rabbit antisera to pneumolysin. The secondary antibody, goat anti-rabbit (H+L)-biotin, was used in conjunction with streptavidin-alkaline phosphatase (Southern Biotechnology Associates, Inc., Birmingham, Ala.). The blots were developed using 1 M Tris, pH 8.8, containing Nitro Blue Tetrazolium and 5-bromo-4-chloro-3-indolylphosphate (Fisher Scientific, Springfield, N.J.).
Coomassie blue staining of total proteins. WU2 was grown at 37°C in THY. Samples (50 ml) were withdrawn at different times during growth. The bacteria were pelleted. The pelleted proteins were released by incubating them in lysis buffer as described above. The supernatant and pellet proteins were precipitated with 10% TCA overnight at 4°C, separated on a 10% polyacrylamide gel, and visualized by staining with Coomassie brilliant blue R-250.
Effect of mitomycin C on growing pneumococcal cultures. WU2 was grown as three sets of cultures at 37°C up to an OD600 of approximately 0.3. To one set, mitomycin C was then added to a final concentration of 0.1 µg/ml to induce possible lysogenic bacteriophages (31). Penicillin was added at 0.1 µg/ml to another set of culture as a positive control for lysis. The third set received nothing and served as a negative control for lysis. Incubation of all three cultures was continued, and growth was monitored by determinations of OD over the next 5 h.
Infections of mice. Female CBA/CaHN-XID/J and BALB/cByJ mice, 6 to 8 weeks old, were obtained from Jackson Laboratories (Bar Harbor, Maine). Pneumococci for infections were from frozen stock cultures containing a known concentration of viable bacteria. Aliquots were diluted with lactated Ringer's solution as required to achieve the desired challenge dose. The reported number of CFU injected into the mice was based on quantitation on blood agar plates. CBA/N mice were challenged i.p. with 300 CFU or intravenously (i.v.) with 200 CFU of pneumococci per mouse in 100 µl of Ringer's solution. The BALB/cByJ mice were challenged i.p. with 3 × 106 CFU per mouse in 200 µl of Ringer's solution or i.v. with 2.5 × 107 CFU per mouse in 200 µl of Ringer's solution.
| |
RESULTS |
|---|
|
|
|---|
Construction of autolysin- and pneumolysin-negative type 3 strains of pneumococci.
Competent WU2 cells were transformed
with chromosomal DNAs isolated from pneumolysin-negative (PLN-A) and
autolysin-negative (AL-2) mutant strains of the D39 background
(4-6, 38). Two independent transformants were
obtained in each case. The transfer of the mutations was confirmed by
Southern blot analysis of restriction endonuclease-digested chromosomal
DNAs from the relevant strains (Fig. 1).
The inactivation of ply and lytA was also
confirmed by Western blot analyses using immune sera against autolysin
and pneumolysin, respectively (data not shown). The mutation in the autolysin gene also resulted in a reduced ability of pneumococci to
lyse when they were grown into stationary phase. As previously observed
(8), the mutation in lytA also caused the
pneumococci to grow in short chains with few or no free diplococci
(data not shown). The cell lysates of the pneumolysin mutants were also confirmed to lack hemolytic activity (data not shown).
|
In vitro growth kinetics and pneumolysin production in THY.
WU2 releases pneumolysin into the extracellular environment well before
the cell lysis that occurs during stationary phase (2). To
determine if the extracellular release of pneumolysin was dependent on
the presence of autolysin, we compared the release of pneumolysin from
WU2 with that of its isogenic autolysin mutant SM121.10 (Fig.
2). The data shown are representative of
the results obtained with the two independent WU2 lytA
mutants. Autolysin mutants show minimal autolysis and are resistant to
lysis by deoxycholate-containing lysis buffer (4, 5, 33).
A lysing matrix containing silica and ceramic spheres was used to
efficiently lyse the autolysin-negative cells. The results with
wild-type WU2 confirmed the release of pneumolysin to the medium, as
reported previously (2). Like WU2, autolysin-negative
SM121.10 also expressed detectable extracellular hemolytic activity
within about 4 h of growth in vitro.
|
|
Effect of mitomycin C on growing pneumococcal cultures.
It has
been reported that many pneumococcal isolates contain prophages
(31). The prophages of pneumococci encode lytic enzymes, a
majority of which show a high homology to the host lytA
(31, 37). Mitomycin C induces the lytic cycles of some
bacterial prophages (31). It was important to determine if
WU2 carried prophages which might be able to cause lysis of host cells
and release pneumolysin. To test for prophage presence, mitomycin C was
added to a growing culture of WU2. The culture was then monitored over
the next 5 h (Fig. 4). Positive
control tubes containing penicillin showed lysis of the cultures over
the incubation period, with the OD600 dropping from 0.4 to
0.069. The test culture containing mitomycin C, however, did not show
this drop in OD600 and was always comparable in OD to the
culture without mitomycin C. We also failed to observe any effect of
mitomycin C on the amounts of pneumolysin in the supernatants and
pellets of the growing cultures (data not shown). These results failed
to reveal any functional prophage in WU2 that could have led to lysis
and pneumolysin release during growth.
|
Growth in the presence of choline.
High concentrations of
choline in the broth inhibit the action of LytA (8, 19) as
well as the action of all but one bacteriophage-encoded lytic enzymes
responsible for phage-mediated lysis. Like autolysin, the
phage-encoded enzymes must be able to bind choline of the host pneumococcal cell wall teichoic acid for activity (13, 15,
31). WU2 was grown in THY containing 2% choline chloride, and
samples were collected at various times to determine cytoplasmic and
supernatant pneumolysin activity. WU2 grown in THY without added
choline served as a control (Fig. 5). As
expected, the choline-grown cells grew in short chains (data not shown)
and displayed a loss of the autolytic property during the entire 24-h
period of growth. Under both growth conditions, the cell-associated
hemolytic activity due to pneumolysin was first detected by 4 h of
growth (THY OD600 = 0.3; THY plus choline
OD600 = 0.1), with a subsequent rise over the period
of logarithmic growth (Fig. 5). At the 10- and 24-h time points, low
cytoplasmic activity was recorded in the choline-treated culture,
presumably due to degradation following cell death. The fact that lower
cytoplasmic pneumolysin levels were observed at 24 h in the
absence than in the presence of choline is consistent with the cell
lysis that occurs without added choline. Hemolytic titers in the
supernatants indicated that pneumolysin was released in both
the THY- and the choline-grown cultures as early as 4 h into the
growth cycle, at which time the cultures were in early-to-mid-log phase. The supernatant hemolytic titers of the choline-grown culture were remarkably similar to those of the culture grown in the absence of
choline. As previously observed in Fig. 2, the levels in the supernatant increased over time under both conditions. The highest titer attained under both growth conditions was 243. Also, as previously observed, the extracellular pneumolysin titer rose between
10 and 24 h in the THY-grown culture (titer, 729), presumably due
to cell lysis. The choline-grown culture behaved like the lytA mutant SM121.10, with the 24-h extracellular titer of
pneumolysin (titer, 243) being similar to that attained at the end of
the first 10 h of growth. Unlike with the lytA mutant, which
showed a slight reduction in overall pneumolysin levels compared to
those of the wild-type strain, growth in a high concentration of
choline did not affect pneumolysin levels. This might be explained by the fact that ply is 7 kb downstream from lytA.
Thus, the insertion into lytA may have had a polar effect on
ply expression.
|
Analyses of total protein synthesis and secretion during
growth.
In order to further test the possibility that limited
lysis associated with early and mid-exponential phase might explain the
presence of extracellular pneumolysin, we examined the total protein
profiles of whole-cell lysates and supernatants at different times
during growth. The proteins were separated on a polyacrylamide gel and
visualized by Coomassie blue staining (Fig.
6). The comparison of cytoplasmic and
supernatant protein profiles did not provide any evidence for autolysis
occurring during log-phase growth. The protein profiles of the
whole-cell lysates were distinct from the corresponding profiles of the
supernatant proteins. Major bands present in the whole-cell lysates
were not represented among those proteins in the concentrated
supernates, as would have occurred if cytoplasmic proteins had entered
the supernatant through cell lysis. The supernatant profile also
differed from that of samples from an identically concentrated sterile
medium, indicating that it depicts a group of transported proteins. A
semiquantitative dye reduction assay was also performed to check for
the presence of lactate dehydrogenase, a cytoplasmic marker, in the
supernatant samples. The levels of lactate dehydrogenase in the pellet
samples were approximately sixfold more than the levels in the
supernatants (which were equal to that of the negative control in
medium alone). The assay was also performed with the autolysin mutant
SM121.10, as well as with WU2 grown in THY containing choline. The
results in both these cases were essentially the same as that obtained with wild-type WU2, indicating no evidence of lysis during growth (data
not shown).
|
Mouse virulence studies.
Since the autolysin mutants behaved
similarly to wild-type WU2 with respect to pneumolysin release, we
examined the relative effects of the autolysin and pneumolysin
mutations on virulence in this strain. Some of these experiments were
conducted with CBA/N mice, which are highly susceptible to infection
with pneumococci and lack the partially protective levels of antibodies
to phosphocholine (26). When CBA/N mice were challenged
i.v. with 200 CFU of bacteria, it was observed that wild-type WU2 and
both of the autolysin-deficient mutants, SM121.10 and SM321.3,
exhibited similar high levels of virulence (the median time to death
being 48 h in all three cases). In contrast, the two pneumolysin
null mutants, UB1122 and UB2271, which were used as controls, showed
highly significant attenuations of virulence. In previous studies where
immunologically normal mice were challenged by the i.p. route, it was
observed that autolysin and pneumolysin-negative mutants had similar
effects on virulence. Thus, we also challenged BALB/cByJ mice i.v. and
i.p. with wild-type and mutant strains. By both routes of infection
(Fig. 7b and d), a loss of LytA or
pneumolysin caused an attenuation in virulence. This result was
consistent with published results for immunologically normal mice
(4-6, 12). To determine if the difference in the effect of a
lytA null mutation in CBA/N mice compared to that in BALB/c mice was specific to the route of infection (i.v.), we challenged CBA/N
mice with 300 CFU by the i.p. route. (Fig. 7c). In this case, we
observed a partial attenuation of both mutants. However, the mice
challenged with the lytA mutant strains died sooner (median time to death = 48 h) than the mice challenged with the
ply mutant strains (median time to death = 96 h).
This difference was significant (P = 0.0032; Rank test)
and confirms the i.v. results with CBA/N mice which indicated that
pneumolysin and autolysin have different effects on virulence.
|
| |
DISCUSSION |
|---|
|
|
|---|
Unlike the thiol-activated toxins produced by other gram-positive pathogens, pneumolysin lacks an N-terminal export signal sequence for transport to the extracellular environment (36). However, two findings make it clear that pneumolysin acts extracellularly (1, 12). Antibody to pneumolysin is able to inhibit pneumolysin-dependent virulence in vivo (22). Pneumolysin-deficient strains can be complemented during coinfection with pneumolysin-sufficient strains, again indicating the importance of extracellular pneumolysin (1). It was thus assumed that the extracellular presence of pneumolysin was due to autolysin-mediated lysis of the pneumococci in the stationary phase of bacterial growth (4). Several lines of experimental evidence supported this idea. Autolysin-negative mutants of D39 created by insertion duplication mutagenesis did not release intracellular pneumolysin unless purified autolysin was supplied exogenously (4). Moreover, mutagenesis of lytA did not result in an additive attenuation of virulence in the ply deletion background, consistent with a common pathway (3, 5, 12). However, unlike strain D39, strain WU2 and a few other strains express extracellular pneumolysin prior to stationary phase (2). This finding raised the possibility that pneumolysin might be able to be released by a nonlytic mechanism. In the present study we observed that lytA mutants of WU2 were capable of secreting pneumolysin in a manner comparable to that of the wild-type WU2 parent. Although the LytA amidase is the major pneumococcal autolysin, S. pneumoniae also encodes other lytic enzymes. These include a glucosaminidase, a murein hydrolase, LytB, and an autolytic lysozyme, LytC (14, 17, 18). Although the exact roles of these enzymes are as yet unknown, it has been hypothesized that they may function in cell division and release of DNA during competence (14, 17, 18). All of these enzymes are purified on the basis of their ability to bind to choline. In this regard, they function like LytA in requiring an attachment to choline-containing cell wall teichoic acid for their activity and in being inhibited by high levels of choline present in the growth medium. Our results indicated that pneumolysin activity was detected at remarkably similar levels for strains grown in the presence or absence of 2% choline chloride, at which concentration LytA and other known autolytic enzymes are completely inhibited (8, 17). Thus, the release of pneumolysin into the extracellular environment did not require the activity of any known pneumococcal autolysin.
The log-phase release of pneumolysin from WU2 also did not appear to be dependent on a lysogenic bacteriophage. Pneumococcal phages contain genes that encode lysins required for the liberation of phage progeny. All but one of the known pneumococcal phage lysins display an absolute requirement for choline on the cell wall teichoic acid for their activity, as does LytA. Mitomycin C, which often induces phage lytic cycles, did not cause lysis of the cells in a growing WU2 culture, indicating that this strain was not host to functional phages. While this study did not rule out the possibility that WU2 was carrying a defective phage particle, lysis by the lysin of such a particle should still have been inhibited by the choline-containing medium described above.
It has been reported that the Cp17 lysin from the pneumococcal bacteriophage Cp-7 functions independently of choline (16). As a result, such an activity will not be inhibited by growth in the presence of choline. However, if in an exponentially growing culture a significant number of bacteria were undergoing autolysis, then one would expect to find cytoplasmic proteins in the supernatant. Our results showed that the cytoplasmic and the extracellular protein profiles were very different from each other.
Previous in vivo data demonstrated that the absence of functional pneumolysin could alter the net growth kinetics of pneumococci in a mouse model of bacteremia (1). The growth of wild-type strain D39 increases exponentially from 105 to ~ 1010 CFU in the blood at the time of death of the mice. In contrast, the net growth of the pneumolysin-negative strain PLN-A increases like that of wild-type D39 until it reaches 106 to 107 CFU/ml of blood and then results in a chronic infection at ~106 CFU/ml. In a mixed infection with D39, PLN-A follows the same growth kinetics as D39 (1). This result and the observation that antibody to pneumolysin can protect against sepsis (29) demonstrate that the effect of pneumolysin on pathogenesis must be mediated extracellularly and that pneumolysin is secreted by some mechanism at levels in blood as low as 106 CFU/ml (1). This bacterial density of PLN-A is comparable to that attained by in vitro-grown WU2 at about the time that the extracellular pneumolysin is first detected.
BALB/cByJ mice are relatively resistant to pneumococcal sepsis, and fatal infection requires a high challenge dose. In these mice mutations in lytA and ply had similar effects on virulence. In the highly susceptible CBA/N mice, however, the situation was different. At the low challenge doses used in these mice, the loss of pneumolysin had a large effect on virulence. In contrast, the loss of autolysin had no effect in i.v. infection and had significantly less effect than the loss of pneumolysin on the virulence of an i.p. infection. This observation makes it clear that autolysin and pneumolysin have different effects on virulence and that autolysin is not a requirement for pneumolysin's effect on virulence in WU2. The ability of actively growing pneumococci to release pneumolysin may be necessary for optimal infection. Indeed, it has been observed that pneumolysin facilitates the multiplication of pneumococci and the spread of the bacterium from the lungs to the blood. Pneumolysin is thought to play a role in enhancing the survival of the bacteria in vivo (12). It has been demonstrated that live D39 cells can induce concentration- and time-dependent nitric oxide (NO) production by murine macrophages (7). This role has been attributed to pneumolysin, since the pneumolysin-negative mutant of D39, PLN-A, was unable to induce the production of NO under similar conditions (7). In those experiments, care was taken to demonstrate that the stimulation of NO production did not require bacterial lysis and so could not be due to the cell wall, which is also known to be a mediator of NO production (7). From those results, one could also conclude that bacterial autolysis is not required for the release of pneumolysin in vivo. If this is the case, then the attenuated virulence of the AL-2 strain (the autolysin-negative mutant of D39) must be attributable to a pneumolysin-independent mechanism. However, it is also possible that different strains of pneumococci have evolved distinct mechanisms for the release of pneumolysin.
In Helicobacter pylori it had been shown that the urease subunits UreA and UreB, as well as HspA and HspB, are released into the extracytoplasmic space via a process of specific secretion and not via autolysis, as previously thought. These proteins, like pneumolysin, also lack any known secretory signals (35).
Since the extracellular secretion of pneumolysin by D39 is not observed in vitro, it appears that the in vitro expression kinetics of pneumolysin by D39 might be quite different from that seen in vivo. One could speculate that some factor(s) in the blood acts as an environmental cue for the release of pneumolysin. In the presence of such a factor strains like D39 might release pneumolysin at low cell densities. As a part of this scenario, it could be assumed that WU2 has lost its ability to regulate the release of pneumolysin and thus that it releases it extracellularly even in an in vitro culture in the absence of an in vivo stimulus. Alternatively, it is possible that regulation of pneumolysin release occurs by different mechanisms in D39 and WU2. Although we have not compared genomic sequences of D39 and WU2 ply genes, the high structural and antigenic conservation at this locus has been well established (23).
Since the pneumococcal genome does not harbor any known sequences indicative of a type III secretory pathway (34), it would then appear that pneumolysin is released by a non-type II, non-type III mechanism.
| |
ACKNOWLEDGMENTS |
|---|
We thank Amy Swift and Orlanda Thomas for assistance in performing the animal experiments.
This work was supported by National Institute of Allergy and Infectious Diseases (National Institutes of Health) grants AI21548 and AI406645.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology, BBRB 658, University of Alabama at Birmingham, Birmingham, AL 35294. Phone: (205) 934-1880. Fax: (205) 934-0605. E-mail: PriyaB{at}microbio.uab.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Benton, K. A., M. P. Everson, and D. E. Briles. 1995. A pneumolysin-negative mutant of Streptococcus pneumoniae causes chronic bacteremia rather than acute sepsis in mice. Infect. Immun. 63:448-455[Abstract]. |
| 2. | Benton, K. A., J. C. Paton, and D. B. Briles. 1997. Differences in virulence of mice among Streptococcus pneumoniae strains of capsular types 2, 3, 4, 5, and 6 are not attributable to differences in pneumolysin production. Infect. Immun. 65:1237-1244[Abstract]. |
| 3. |
Berry, A., and J. Paton.
2000.
Additive attenuation of virulence of Streptococcus pneumoniae by mutation of genes encoding pneumolysin and other putative pneumococcal virulence proteins.
Infect. Immun.
68:133-140 |
| 4. |
Berry, A. M.,
R. A. Lock,
D. Hansman, and J. C. Paton.
1989.
Contribution of autolysin to virulence of Streptococcus pneumoniae.
Infect. Immun.
57:2324-2330 |
| 5. | Berry, A. M., J. C. Paton, and D. Hansman. 1992. Effect of insertional inactivation of the genes encoding pneumolysin and autolysin on the virulence of Streptococcus pneumoniae type 3. Microb. Pathog. 12:87-93[CrossRef][Medline]. |
| 6. |
Berry, A. M.,
J. Yother,
D. E. Briles,
D. Hansman, and J. C. Paton.
1989.
Reduced virulence of a defined pneumolysin-negative mutant of Streptococcus pneumoniae.
Infect. Immun.
57:2037-2042 |
| 7. |
Braun, J. S.,
R. Novak,
G. Gao,
P. J. Murray, and J. L. Shenep.
1999.
Pneumolysin, a protein toxin of Streptococcus pneumoniae, induces nitric oxide production from macrophages.
Infect. Immun.
67:3750-3756 |
| 8. | Briese, T., and R. Hakenbeck. 1985. Interaction of the pneumococcal amidase with lipoteichoic acid and choline. Eur. J. Biochem. 146:417-427[Medline]. |
| 9. |
Briles, D. E.,
M. Nahm,
K. Schroer,
J. Davie,
P. Baker,
J. Kearney, and R. Barletta.
1981.
Antiphosphocholine antibodies found in normal mouse serum are protective against intravenous infection with type 3 Streptococcus pneumoniae.
J. Exp. Med.
153:694-705 |
| 10. | Briles, D. E., J. Yother, and L. S. McDaniel. 1988. Role of pneumococcal surface protein A in the virulence of Streptococcus pneumoniae. Rev. Infect. Dis. 10:S372-S374. |
| 11. |
Brooks-Walter, A.,
D. E. Briles, and S. K. Hollingshead.
1999.
The pspC gene of Streptococcus pneumoniae encodes a polymorphic protein, PspC, which elicits cross-reactive antibodies to PspA and provides immunity to pneumococcal bacteremia.
Infect Immun.
67:6533-6542 |
| 12. | Canvin, J. R., A. P. Marvin, M. Sivakumaran, J. C. Paton, G. J. Boulonois, P. W. Andrew, and T. J. Mitchell. 1995. The role of pneumolysin and autolysin in the pathology of pneumonia and septicemia in mice infected with a type 2 pneumococcus. J. Infect. Dis. 172:119-123[Medline]. |
| 13. |
Garcia, P.,
E. Garcia,
C. Ronda,
R. Lopez, and A. Tomasz.
1983.
A phage-associated murein hydrolase in Streptococcus pneumoniae infected with bacteriophage Dp-1.
J. Gen. Microbiol.
129:489-497 |
| 14. | Garcia, P., J. L. Garcia, E. Garcia, and R. Lopez. 1989. Purification and characterization of the autolytic glycosidase of Streptococcus pneumoniae. Biochem. Biophys. Res. Commun. 158:251-256[CrossRef][Medline]. |
| 15. |
Garcia, P.,
R. Lopez,
C. Ronda,
E. Garcia, and A. Tomasz.
1983.
Mechanism of phage-induced lysis in pneumococci.
J. Gen. Microbiol.
129:479-487 |
| 16. | Garcia, P., A. C. Martin, and R. Lopez. 1997. Bacteriophages of Streptococcus pneumoniae: a molecular approach. Microb. Drug Resist. 3:165-176[Medline]. |
| 17. | Garcia, P., M. Paz Gonzales, E. Garcia, J. Garcia, and R. Lopez. 1999. The molecular characterization of the first autolytic lysozyme of Streptococcus pneumoniae reveals evolutionary mobile domains. Mol. Microbiol. 33:128-138[CrossRef][Medline]. |
| 18. | Garcia, P., M. Paz Gonzales, E. Garcia, R. Lopez, and J. Garcia. 1999. LytB, a novel pneumococcal murein hydrolase essential for cell separation. Mol. Microbiol. 31:1275-1281[CrossRef][Medline]. |
| 19. |
Giudicelli, S., and A. Tomasz.
1984.
Attachment of pneumococcal autolysin to wall teichoic acids, an essential step in enzymatic wall degradation.
J. Bacteriol
160:1188-1190 |
| 20. |
Jalonen, E.,
J. C. Paton,
M. Koskela,
Y. Kerttula, and M. Leinonen.
1989.
Measurement of antibody responses to pneumolysin a promising method for the presumptive aetiological diagnosis of pneumococcal pneumonia.
J. Infect.
19:127-134[CrossRef][Medline].
|
| 21. | Johnson, M. K. 1977. Cellular location of pneumolysin. FEMS Microbiol. Lett. 2:243-245[CrossRef]. |
| 22. | Lock, R. A., D. Hansman, and J. C. Paton. 1992. Comparative efficacy of autolysin and pneumolysin as immunogens protecting mice against infection by Streptococcus pneumoniae. Microb. Pathog. 12:137-143[CrossRef][Medline]. |
| 23. | Lock, R. A., Q. Y. Zhang, A. M. Berry, and J. C. Paton. 1996. Sequence variation in the Streptococcus pneumoniae pneumolysin gene affecting haemolytic activity and electrophoretic mobility of the toxin. Microb. Pathog. 21:71-83[CrossRef][Medline]. |
| 24. |
McDaniel, L. S.,
J. Yother,
M. Vijayakumar,
L. McGarry,
W. R. Guild, and D. E. Briles.
1987.
Use of insertional inactivation to facilitate studies of biological properties of pneumococcal surface protein A (PspA).
J. Exp. Med.
165:381-394 |
| 25. | Mitchell, T. J., J. E. Alexander, P. J. Morgan, and P. W. Andrew. 1997. Molecular analysis of virulence factors of Streptococcus pneumoniae. J. Appl. Microbiol. 83:S62-S71[CrossRef]. |
| 26. |
Mond, J. J.,
J. R. Lieberman,
J. K. Inman,
D. E. Moiser, and W. E. Paul.
1977.
Inability of mice with defect in B-lymphocyte maturation to respond to phosphocholine on immunogenic carriers.
J. Exp. Med.
146:1138-1142 |
| 27. |
Mosser, J. L., and A. Tomasz.
1970.
Choline-containing teichoic acid as a structural component of pneumococcal cell wall and its role in sensitivity to lysis by an autolytic enzyme.
J. Biol. Chem.
245:287-297 |
| 28. | Paton, J. C., P. W. Andrew, G. J. Boulnois, and T. J. Mitchell. 1993. Molecular analysis of the pathogenicity of Streptococcus pneumoniae: the role of pneumococcal proteins. Annu. Rev. Microbiol. 47:89-115[Medline]. |
| 29. |
Paton, J. C.,
R. A. Lock, and D. Hansman.
1983.
Effect of immunization with pneumolysin on survival time of mice challenged with Streptococcus pneumoniae.
Infect. Immun.
40:548-552 |
| 30. |
Pozzi, G., and W. R. Guild.
1985.
Modes of integration of heterologous plasmid DNA into the chromosome of Streptococcus pneumoniae.
J. Bacteriol.
161:909-912 |
| 31. |
Ramirez, M.,
E. Severina, and A. Tomasz.
1999.
A high incidence of prophage carriage among natural isolates of Streptococcus pneumoniae.
J. Bacteriol.
181:3618-3625 |
| 32. |
Sampson, J. S.,
S. P. O'Connor,
A. R. Stinson,
J. A. Tharpe, and H. Russell.
1994.
Cloning and nucleotide sequence analysis of psaA, the Streptococcus pneumoniae gene encoding a 37-kilodalton protein homologous to previously reported Streptococcus sp. adhesins.
Infect. Immun.
62:319-324 |
| 33. |
Tomasz, A.,
P. Moreillon, and G. Pozzi.
1988.
Insertional inactivation of the major autolysin gene of Streptococcus pneumoniae.
J. Bacteriol.
170:5931-5934 |
| 34. | Tuomanen, E. 1999. Molecular and cellular biology of pneumococcal infection. Curr. Opin. Microbiol. 2:35-39[CrossRef][Medline]. |
| 35. |
Vanet, A., and A. Labigna.
1998.
Evidence for specific secretion rather than autolysis in the release of some Helicobacter pylori proteins.
Infect. Immun.
66:1023-1027 |
| 36. |
Walker, J. A.,
R. L. Allen,
P. Falmagne,
M. K. Johnson, and G. J. Boulnois.
1987.
Molecular cloning, characterization, and complete nucleotide sequence of the gene for pneumolysin, the sulfhydryl-activated toxin of Streptococcus pneumoniae.
Infect. Immun.
55:1184-1189 |
| 37. |
Whatmore, A. M., and C. G. Dowson.
1999.
The autolysin-encoding gene (lytA) of Streptococcus pneumoniae displays restricted allelic variation despite localized recombination events with genes of pneumococcal bacteriophage encoding cell wall lytic enzymes.
Infect. Immun.
67:4551-4556 |
| 38. |
Yother, J.,
L. S. McDaniel, and D. E. Briles.
1986.
Transformation of encapsulated Streptococcus pneumoniae.
J. Bacteriol.
168:1463-1465 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»