Previous Article | Next Article ![]()
Journal of Bacteriology, May 2001, p. 3117-3126, Vol. 183, No. 10
Department of Bacteriology, University of
Wisconsin, Madison, Wisconsin 53706
Received 3 August 2000/Accepted 28 February 2001
The bacterium Photorhabdus luminescens is a symbiont
of the entomopathogenic nematode Heterorhabditis
bacteriophora. The nematode requires the bacterium for
infection of insect larvae and as a substrate for growth and
reproduction. The nematodes do not grow and reproduce in insect hosts
or on artificial media in the absence of viable P.
luminescens cells. In an effort to identify bacterial factors
that are required for nematode growth and reproduction, transposon-induced mutants of P. luminescens were
screened for the loss of the ability to support growth and reproduction
of H. bacteriophora nematodes. One mutant, NGR209,
consistently failed to support nematode growth and reproduction. This
mutant was also defective in the production of siderophore and
antibiotic activities. The transposon was inserted into an open reading
frame homologous to Escherichia coli EntD, a
4'-phosphopantetheinyl (Ppant) transferase, which is required for the
biosynthesis of the catechol siderophore enterobactin. Ppant
transferases catalyze the transfer of the Ppant moiety from coenzyme A
to a holo-acyl, -aryl, or -peptidyl carrier protein(s) required for the
biosynthesis of fatty acids, polyketides, or nonribosomal peptides.
Possible roles of a Ppant transferase in the ability of P.
luminescens to support nematode growth and reproduction are discussed.
Photorhabdus
luminescens (Enterobacteriaceae) bacteria are symbiotic
with entomopathogenic rhabditid nematodes of the family Heterorhabditidae, with which they cooperate in infecting a
wide variety of insect larvae (38, 45; for reviews, see
references 25 and 26). The nematode requires P. luminescens for insect pathogenicity (34), while the
bacteria depend on the nematodes for transmission between insect prey.
The infective juvenile (IJ)-stage nematodes specifically retain
symbiotic P. luminescens cells in their gut mucosa, and
transmission of the bacteria is a requisite for insect pathogenicity
(31, 32, 34). The nematodes require P. luminescens cells as a substrate for growth and reproduction (2, 21, 22, 30). It was suggested previously that
symbiotic P. luminescens cells provide favorable nutritional
conditions for Heterorhabditis bacteriophora nematodes to
grow and reproduce (45).
During prolonged laboratory culture, P. luminescens strains
show a tendency to undergo an apparent phase variation phenomenon (8, 9, 36). The native form of the bacteria, termed
primary phase, is isolated from the IJ stage of the nematode. The
secondary-phase variants appear at high frequency during prolonged
culturing, while more rare is the generation of primary-phase cells
from secondary phase (6). The secondary-phase cells differ
from the primary-phase cells in colony morphology, cell size, and dye uptake characteristics (6, 7, 9, 52). Also, typical primary-phase characteristics such as bioluminescence, pigment synthesis, phospholipase and siderophore activities, and production of
intracellular crystalline inclusion proteins are depressed or absent in
secondary-phase cells. The mechanism and role of phase variation in
P. luminescens are unknown. Particularly significant for the
subject of this investigation is the inability of secondary-phase variant cells to support nematode growth and reproduction (22, 30).
Because H. bacteriophora nematodes have a strict requirement
for P. luminescens for growth and reproduction, it seems
likely that P. luminescens provides some nutrients and/or
other factors to the nematode. Dead cells or culture supernatants of
P. luminescens cells do not provide the nutrients and/or
factors required for nematode growth and reproduction (34;
T. A. Ciche, personal observation), suggesting that actively
metabolizing P. luminescens cells are required. To better
understand the contribution of P. luminescens to nematode
growth and reproduction, we developed a genetic screen to identify
P. luminescens genes necessary for nematode growth and reproduction.
Genetic studies of P. luminescens have been limited,
probably because of a low frequency of transformation (7)
and the current inability to introduce recombinant DNA into P. luminescens by conjugation (52). Success has been
achieved in using allelic exchange to construct disruptions in the
genes encoding intracellular inclusion proteins CipA and CipB
(7) and insecticidal toxin genes tca, tcb, tcc,
and tcd (10) of P. luminescens.
Here we describe the construction of a mini-Tn5-based
transposon and a delivery vector for efficient mutagenesis and gene characterization in P. luminescens. We used this system to
identify genes that are required for P. luminescens to
support growth and reproduction of its nematode host, H. bacteriophora. We identified a transposon mutant that has lost the
ability to support nematode growth and reproduction, and we describe
the analyses of the disrupted gene region.
Microbiological methods.
Sources of strains and plasmids are
listed in Table 1. Dye reagents, Tween
types, and antibiotics were purchased from Sigma Chemical Corp. (St.
Louis, Mo.), and bacteriological growth media were purchased from Difco
(Detroit, Mich.). Cells of P. luminescens were grown in 2%
Proteose Peptone 3 (PP3), with 1.5% agar added when required, at
28°C in the dark. Kanamycin (15 µg/ml), streptomycin (25 µg/ml),
spectinomycin (25 µg/ml), and sucrose (7.5% [wt/vol]) were added
when required. Escherichia coli strains were grown in
Luria-Bertani (LB) broth or on LB agar (1.5% agar) at 37°C with
ampicillin (100 µg/ml), kanamycin (50 µg/ml), streptomycin (25 µg/ml), spectinomycin (25 µg/ml),
5-bromo-4-chloro-3-indolyl-
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.10.3117-3126.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
A Phosphopantetheinyl Transferase Homolog Is
Essential for Photorhabdus luminescens To Support Growth
and Reproduction of the Entomopathogenic Nematode
Heterorhabditis bacteriophora


![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-D-galactopyranoside (X-Gal) (40 µg/ml), chloramphenicol (35 µg/ml), and sucrose (5% [wt/vol]) added when required.
TABLE 1.
Strains and plasmids used in this study
Nematode propagation. IJ nematodes were propagated by infecting greater wax moth larvae, Galleria mellonella (Ja-Da Bait Co., Antigo, Wis.), or by adding approximately 20 IJ nematodes to lawns of P. luminescens cells on lipid agar (LA) (53) (2.5% nutrient broth, 1.5% agar, 1% corn oil), nematode growth medium (12), or liquid culture medium (LCM) (22) as described previously (7).
The IJ nematodes were collected by flooding the LA plates or infected larvae at the time of IJ release and separated from adult nematodes by the water trap method of Wouts (53). Alternatively, IJ nematodes were grown on P. luminescens cells that were seeded onto LA or nematode growth medium contained on one side of a divided petri dish (Fisher Scientific, Pittsburgh, Pa.). After 14 days, newly formed IJ nematodes migrated into the sterile saline contained on the other side. IJ nematodes were surface sterilized as described previously (41).Axenic nematodes. Axenic nematodes were obtained using a modification of the procedure of Han and Ehlers (33). H. bacteriophora nematodes were propagated on a P. luminescens strain, Meg/1, that was isolated from Heterorhabditis megidis nematodes. The H. bacteriophora nematodes grow and reproduce normally on Meg/1 bacteria, but the resulting surface-sterilized IJ nematodes do not retain Meg/1 bacteria and are therefore axenic (33).
Retention of bacteria by nematodes. The numbers of P. luminescens cells in the intestine of IJ nematodes were determined. For some experiments, 50 to 100 surface-sterilized nematodes were disrupted using an 0.1-ml microtissue grinder (Kontes, Vineland, N.J.). The homogenate was then serially diluted and plated on PP3 agar. Alternatively, a 10-µl sample of a water suspension containing 10 to 50 IJ nematodes was placed in the depression of a sterile hanging drop slide and dried in a laminar flow hood for 5 to 10 min, and then each nematode was disrupted with a sterile scalpel while being examined under a 40× dissecting microscope. The disrupted nematodes were suspended in 0.1 ml of PP3 broth, and the scalpel blade was rinsed in this suspension. The material was then transferred to a tube containing 0.9 ml of PP3 broth. The slide depression and scalpel were rinsed three times before plating serial dilutions of the tube onto PP3 agar. Colonies were counted following incubation at 28°C for 3 days.
DNA manipulations. Plasmid purification from P. luminescens and E. coli was carried out using Wizard Mini and Midi preps (Promega Corp., Madison, Wis.). Restriction enzymes and T4 ligase were used according to the manufacturer's instructions (Promega Corp.). When required, DNA fragments were extracted from agarose gels using the Qiagen Gel extraction kit (Qiagen Inc., Valencia, Calif.). The bacterial DNA was purified using a modified cetyltrimethylammonium bromide (CTAB) method (14). Southern hybridization was performed under high-stringency conditions using the Genius kit (Boehringer Mannheim Corp., Indianapolis, Ind.). Transformation of E. coli and P. luminescens was done by electroporation using a Bio-Rad gene pulser according to the conditions suggested for E. coli by the supplier (Bio-Rad Laboratories, Hercules, Calif.).
Construction of pUB394.
The structure of the transposon
delivery vector, pUB394, is shown in Fig.
1A. A pSU39 plasmid (5, 43)
was inserted between the I and O ends that define the termini of the
mini-Tn5 by removing the chloramphenicol resistance gene
from the mini-Tn5 of pUT-mTnCm (24) by
digesting it with SmaI and replacing it with a
HincII and SmaI fragment of pSU39. The resulting
plasmid is named pUS39. The correct orientation of the insert was
determined. Because P. luminescens organisms are resistant
to ampicillin and conjugation techniques have not been established with
these bacteria, the ampicillin resistance and Mob RP4 genes were
removed by BamHI and SfiI digestion of pUS39
followed by self-ligation, resulting in pUSF39. pGTn, pGHP, and pGHS
were constructed to isolate the transposase, streptomycin and
spectinomycin resistance, and levansucrase genes, respectively. Plasmid
pGTn was constructed by removing a 1.5-kb SalI fragment
containing the transposase gene from pUT-mTn5Cm (19,
35) and inserting it into pGEM-7Zf(+) (Promega). The orientation
of the insert was verified. The transposase-encoding gene was inserted
into the XbaI site located outside the I-end inverted repeat
of the mini-Tn5 of pUB39 as a XbaI fragment from plasmid pGTn. The resulting plasmid is named pUGS394. The orientation of the insert was verified. pUGS394 was digested with BamHI
to remove the ampicillin resistance and Mob RP4 genes and self-ligated. The resulting plasmid is named pUS394. The streptomycin and
spectinomycin resistance gene was removed as a 2.0-kb
HindIII fragment from pHP45
(24) and
inserted into pGEM-7Zf(+). The resulting plasmid is named pGHP. Plasmid
pGHS was constructed by inserting a 2.6-kb XbaI fragment
from pBS101 (7) containing sacB/sacR (27,
47) into XbaI-digested pGHP. The orientation of the
insert was verified. The streptomycin and spectinomycin resistance and
the sacB/sacR sucrose sensitivity genes were removed as a
4.6-kb BamHI fragment from pGHS and inserted into a
BamHI site of pUS394, yielding pUB394. A second, alternative
O end was located 1.7 kb 5' to the O end of the mini-Tn5.
Between the two O ends are the R6K ori and DNA encoding the
N-terminal (amino acids 1 to 202) region of the Tn5 transposase-encoding genes. No difference was observed in the stability
of these and normal O-end mini-Tn5 insertions.
|
Transposon mutagenesis.
The use of pUB394 for transposon
mutagenesis and retrieval of DNA containing mini-Tn5
insertions is shown in Fig. 1B. Low transformation efficiency and the
inability to conjugate or transduce DNA in P. luminescens
make the standard transposon mutagenesis techniques utilizing suicide
plasmids inefficient. The sacB gene, conferring sucrose
sensitivity, allows selection against cells containing pUB394 and, when
used with selection for the transposon (resistance to kanamycin),
allows cells containing insertions, but not pUB394, to be selected.
Cells of P. luminescens NC1/1 were transformed with the
transposon delivery vector pUB394 to create strain NP394. As a
consequence of pUB394 replication in NP394, mini-Tn5
insertions may accumulate. NP394 containing a mini-Tn5
insertion and pUB394 will cause, at high frequency
(10
3), kanamycin- and sucrose-resistant cells
by loss of pUB394. To select mini-Tn5 mutants that have lost
pUB394, cells of NP394 (checked for the absence of a
mini-Tn5 insertion prior to mutant generation) were grown
overnight in PP3 containing kanamycin, and 10
1
and 10
2 dilutions were plated on PP3 agar
containing kanamycin and sucrose to select for cells containing the
mini-Tn5 but not pUB394. The mutants were transferred to PP3
agar containing kanamycin to verify the resistance to kanamycin, PP3
agar containing streptomycin and spectinomycin to verify the absence of
pUB394, M9 minimal medium to determine auxotrophy, and eosin-methylene
blue to determine the phase state of the mutants. Mutant cells
unable to grow on M9 medium were assumed to be auxotrophs, and those
not accumulating dye on eosin-methylene blue were assumed to be
secondary-phase cells. Secondary-phase cells do not support nematode
growth and reproduction and were not characterized, because they are
likely to be spontaneous phase variants of NP394 and not
transposon-induced secondary-phase cells.
Screening for the ability of mutants to support growth and
reproduction of H. bacteriophora
nematodes
The screen for the ability of bacteria
to support nematode growth and reproduction is shown in Fig.
2A. Individual colonies of
transposon-induced mutants of P. luminescens were
inoculated into 0.25 ml of PP3 with 10 µg of kanamycin/ml and were
incubated statically overnight at 28°C. Samples of 0.05 ml were added
to individual wells of 24-well tissue culture plates (Falcon 1143; Becton Dickinson Labware, Lincoln Park, N.J.) with 1.5 ml of
LA-containing kanamycin. Following incubation overnight at 28°C, an
average of 12 axenic IJ nematodes was added to each well. Bacteria able to support nematode growth and reproduction were detected by the appearance of a white mass of nematodes 21 days later. NP394 and secondary-phase (NC1/2) P. luminescens containing pUB394
were included in the assay as positive and negative controls,
respectively. Putative nematode growth and reproduction mutants were
verified by repeating the nematode growth and reproduction experiments twice, each with 12 replicates. Mutants were named NGR for nematode growth and reproduction mutants.
|
Retrieval of DNA flanking the mini-Tn5 of
NGR209.
DNA from mutant NGR209 was purified, restriction enzyme
digested with NsiI (the mini-Tn5 contains no
NsiI site), intramolecularly and ethanol precipitated, and
transformed by electroporation into E. coli DH5
(Fig.
1B). Transformants containing the mini-Tn5 were selected by
being resistant to kanamycin. The retrieved plasmid, p209, was purified
and restriction enzyme digested with NsiI and SfiI to verify that the plasmid contained a single
NsiI restriction fragment and the mini-Tn5
(determined by the presence of a 2.9-kb SfiI restriction
fragment), respectively.
Causality determination of the mini-Tn5 insertions. A 4.6-kb PstI fragment from pG325 (Table 1) containing the sacB/sacR genes and a gene conferring resistance to streptomycin and spectinomycin was ligated into the NsiI site of the retrieved mini-Tn5 plasmids to create the allelic-exchange plasmid p209C. The plasmid was transformed into wild-type NC1/1 cells. Allelic exchange was selected for by growing NC1/1 cells containing the allelic-exchange plasmid overnight in PP3 containing kanamycin and then plating the cells on PP3 containing kanamycin and sucrose. The mutants were tested for sensitivity to streptomycin and spectinomycin to verify the loss of the allelic-exchange plasmid. The phenotype of the allelic-exchange mutant, NGR209A, was compared to that of the original mini-Tn5 mutant, NGR209.
Sequence analysis of p209. The sequence of DNA flanking the transposon insertion of p209 was obtained by using M13 forward and reverse primers located 60 or 40 bp from the inverted repeat termini of the transposon and by primer walking. If the sequence obtained from the M13 forward primer revealed the alternative O-end insertion, the DNA sequence flanking the alternative O end was obtained by using the oligonucleotide primer (5' TAAGCGCCTTCCTGCATGGCTT 3'). Dye terminator cycle sequencing using ABI terminator mix was performed using the conditions suggested by the supplier (Perkin-Elmer Corp., Foster City, Calif.), and then the reaction products were analyzed on an ABI 377 automated sequencer (Perkin-Elmer Corp.) at the University of Wisconsin Biotechnology Center. Comparison of the DNA sequence to database sequences was done using BLAST programs using nonredundant databases (4).
Complementation of NGR209 with pNgrA.
The disrupted allele
of NGR209 was designated ngrA. Intact ngrA was
obtained by PCR amplification using the oligonucleotide primers Edf
(5' ATTAAGTATAGACTGTAGGATA 3') and Edr (5'
TGATCAGGGACGGTATCAGCT 3') and Pfu polymerase
(Stratagene Cloning Systems, La Jolla, Calif.). The Edf primer was
designed to include the intergenic region between ngrA and
the phfB gene that might contain a promoter element (see
Fig. 4). An 0.8-kb band was extracted from an agarose gel and blunt end
ligated into pBC SK
(Stratagene) that had been treated with
HincII and shrimp alkaline phosphatase (United States Biochemical Corp., Cleveland, Ohio). Clones containing intact ngrA were obtained by screening transformants on LB
medium containing chloramphenicol and X-Gal. Plasmid
preparations were made on white colonies, resulting in a clone
containing an 0.8-kb insert with a sequence identical to
ngrA of p209 and in the same orientation as the
lacZ gene to allow the lac promoter to be
utilized for transcription of ngrA. The resulting plasmid,
pNgrA, was transformed into NGR209, and the phenotype of the
resulting clone was determined.
Phenotypic characterization. Analyses of phase-dependent characteristics and the ability of the cells to support nematode growth and reproduction or to be retained by IJ nematodes were performed as described above. The pathogenicity of bacteria for insects was determined as described previously (11). Positive insect pathogenicity was defined 72 h postinjection as 50% mortality of insect larvae resulting from a dose of less than 30 cells. To test for oral insecticidal activity (11), growth liquors from 72-h PP3 cultures were filter sterilized and concentrated 15 times using a Microcon 40 (Amicon, Inc., Beverly, Mass.) microconcentrator. An 0.05-ml sample of retentate was added to a 1.0-g portion of gypsy moth diet (ICN Pharmaceuticals Inc., Costa Mesa, Calif.), and a single first- or second-instar larva of Manduca sexta was then added. Larvae were observed for weight gain and/or death following 72 h of incubation. Experiments were performed twice with 12 replicates each.
Nucleotide sequence accession number. The GenBank accession number for DNA sequence flanking the mini-Tn5 insertion of mutant NGR209 is AF288077.
| |
RESULTS |
|---|
|
|
|---|
Transposon mutagenesis.
The frequency of transposition and
loss of the pUB394 delivery vector, defined as the ratio of cells
resistant to kanamycin and sucrose to total cells present, was 1.7 × 10
7. A large number of strains with putative
mini-Tn5 insertions were obtained. Southern analysis of 20 randomly picked mutants showed that more than 90% of the putative
transposon mutants contained single insertions on different locations
of DNA (data not shown). Less than 2% of the strains with putative
insertions were resistant to streptomycin and spectinomycin. This
suggests that resistance to sucrose in these rare strains occurred by a
mechanism other than loss of the delivery vector pUB394. Approximately
1 to 3% of the mutants were auxotrophic. This frequency would be
expected if the mini-Tn5 was inserted randomly into the
genome of P. luminescens, assuming the genome to be
approximately the same size as that of E. coli.
Mutant screening. Of 2,800 transposon-induced mutants screened, a mutant (NGR209) was obtained that consistently failed to support nematode growth and reproduction. A white mass of nematodes is evident when nematodes are grown on lawns of NC1/1 (Fig. 2B), while no adult nematodes are seen on lawns of NGR209 (Fig. 2C).
Cloning and analyses of DNA flanking the mini-Tn5
insertion of mutant NGR209.
A 10.6-kb plasmid containing the
mini-Tn5 was retrieved from NGR209. The ngrA
gene, disrupted by the mini-Tn5 in mutant NGR209, appears to
encode a 4'-phosphopantetheinyl (Ppant) transferase enzyme. The deduced
protein product shows a significant degree of similarity to the two
Ppant transferase motifs (boxed residues) characteristic of these
proteins (39) (Fig. 3). NgrA
is most similar to the Ppant transferases EntD from Salmonella
enterica serovar Typhimurium and E. coli and VibD from
Vibrio cholerae, which are required for the biosynthesis of
the catechol siderophores enterobactin (16, 39) and
vibriobactin (54), respectively (residues identical to
NgrA are shaded). Ppant transferases transfer the Ppant moiety from
coenzyme A to acyl carrier proteins (ACP), aryl carrier proteins, and
peptidyl carrier proteins (39). The Ppant-modified carrier
proteins are required for the biosynthesis of lipids, lipoproteins,
polyketide, and nonribosomal peptides, many with siderophore,
antibiotic, or pharmacological activities (37, 42).
|
|
Phenotypic characterization of mutant NGR209.
The phenotype of
NGR209 was compared to those of the primary (NC1/1)- and secondary
(NC1/2)-phase cells and to NGR209 reconstituted with pNgrA
(complementation of NGR209 with intact ngrA) (Table 2). NGR209 is identical to NC1/1 in all
properties except in not supporting nematode growth and reproduction or
producing siderophore and antibiotic activities. Complementation of
NGR209 with pNgrA restored these properties. The restoration of these
properties was not due to gene replacement of the
mini-Tn5-disrupted ngrA with intact
ngrA, because NGR209 cured of pNgrA reverted to the NGR209
phenotype.
|
Km, also had a phenotype identical to
that of NGR209 (data not shown).
The results of the analyses of growth, reproduction, and mortality of
nematodes when grown on cells of NC1/1 and NGR209 and retention of
NC1/1 and NGR209 by nematodes are shown in Table 3. Nematode development from the IJ to
the J4 stage was reduced significantly when nematodes were grown on LA
medium seeded with cells of NGR209 compared to the equivalent nematodes
propagated on NC1/1 cells. The inability of nematodes to reproduce on
NGR209 cells was shown by the observation that no IJ nematodes were
present after 20 days of growth on the NGR209 cells. In contrast, large numbers of nematodes were produced by nematodes propagated on NC1/1
cells. The NGR209 cells are not toxic to the nematodes, as indicated by
a similar percent mortality of IJ nematodes after incubation for 3 days
with NGR209 or NC1/1 cells. Also, the numbers of IJ nematodes were
essentially the same following 10 to 14 days of growth on 1:1 mixtures
of NGR209 and NC1/1 or NGR209 and Meg/1 cells, again indicating that
NGR209 cells are not inhibitory for nematode growth and reproduction.
|
| |
DISCUSSION |
|---|
|
|
|---|
The entomopathogenic nematode H. bacteriophora will grow and reproduce only when feeding on living cells of its symbiotic bacterium, P. luminescens. Spontaneous phase variants of the bacterium that have lost expression of multiple characteristics will not support nematode growth. A screen of 2,800 transposon mutants of P. luminescens yielded only one mutant, NGR209, which lost the ability to support nematode growth and reproduction while retaining most primary-phase characteristics. The transposon is inserted into a gene, ngrA, which database analyses show to be most similar to the entD gene that encodes the enzyme Ppant transferase. The enzyme transfers the Ppant moiety from coenzyme A to EntB and EntF, which are required for the biosynthesis of the siderophore enterobactin (16, 28, 39).
The nematode growth and reproduction mutation also caused loss of detectable antibiotic and siderophore production. It is unlikely that loss of these properties is involved in the nematode growth phenotype, because adding growth liquor from a P. luminescens culture, which contained both activities, to the nematode growth medium did not overcome the growth defect. In addition, we isolated a transposon mutant of P. luminescens producing no detectable siderophore activity, and this mutant supports nematode growth and reproduction (15).
The ngrA gene is more likely to be involved in biosynthesis of a hormone or signal regulator of nematode development than in that of a nutritional factor. The gene is probably not involved in the biosynthesis of fatty acids or lipids because the Ppant transferase of E. coli that activates ACP required for fatty acid biosynthesis is essential (40, 51). Other possible functions of NgrA are the biosynthesis of polyketide or nonribosomally synthesized peptide molecules (39) that are good candidates for hormonal or signal molecules. One possible candidate is the quorum-sensing homoserine lactone molecules that require ACP and ACP synthase (ACPS) for biosynthesis (44). It is unlikely that NgrA is involved in homoserine lactone biosynthesis because NgrA is not equivalent to ACPS based on amino acid similarity.
The NgrA product might be very unstable or active at a critical threshold level, since adding growth liquor of exponential- or stationary-phase cultures of P. luminescens to LA does not restore nematode growth. It is also possible that the putative signal molecule is produced by the bacteria only when they are grown in the presence of the nematode.
The ngrA mutant cells retain most of the characteristics of the parent and have clearly not been converted to the secondary-phase variant. The parent and ngrA mutant cells produce two crystalline inclusion proteins, CipA and CipB (7). The secondary-phase cells do not produce them. Inactivation of either cipA or cipB by omega cassettes resulted in cells exhibiting secondary-phase characteristics (7). These mutants did not support nematode growth and reproduction. It thus seems clear that the ngrA mutant is specifically related to nematode growth and is not involved in the secondary-phase variation phenomenon.
The genes located near ngrA, having putative functions involving fimbrial biogenesis and adhesion and the iron boxes (Fig. 4), might be relevant to the nematode-bacterium symbiosis. Fur is a global regulator in E. coli and regulates some virulence genes (17). Fimbriae are often responsible for specific binding of bacterial cells to eukaryotic cells (20), which can signal changes in gene expression in both bacteria and host cells (1). Knowing the nucleotide sequence of these genes will allow us to specifically disrupt the genes to determine their possible roles in the symbiotic association. Our isolation of the mini-Tn5 insertion in the ngrA gene provides a starting point for genetic and physiological analysis of this symbiotic relationship.
| |
ACKNOWLEDGMENTS |
|---|
This research was partially supported by the S. C. Johnson
Wax Distinguished Scientist Fellowship awarded to T.A.C. and funds from
DowAgroSciences and the College of Agriculture and Life Sciences at the
University of Wisconsin
Madison.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Bacteriology, University of Wisconsin, Madison, WI 53706. Phone: (608) 262-7877. Fax: (608) 262-9865. E-mail: jcensign{at}facstaff.wisc.edu.
Present address: Hopkins Marine Station of Stanford
University, Pacific Grove, CA 93950.
Present address: DowAgroSciences, Indianapolis, IN 46268-1054.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Abraham, S., A. B. Jonsson, and S. Normark. 1998. Fimbriae-mediated host-pathogen cross-talk. Curr. Opin. Microbiol. 1:75-81[CrossRef][Medline]. |
| 2. | Akhurst, R. J., R. G. Mourant, L. Baud, and N. E. Boemare. 1996. Phenotypic and DNA relatedness study between nematode-symbiotic and clinical strains of the genus Photorhabdus (Enterobacteriaceae). Int. J. Syst. Bacteriol. 43:249-255. |
| 3. |
Allen, B. L.,
G. F. Gerlach, and S. Clegg.
1991.
Nucleotide sequence and functions of mrk determinants necessary for expression of type 3 fimbriae in Klebsiella pneumoniae.
J. Bacteriol.
173:916-920 |
| 4. | Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410[CrossRef][Medline]. |
| 5. | Bartolome, B., Y. Jubete, E. Martinez, and F. de la Cruz. 1991. Construction and properties of a family of pACYC184-derived cloning vectors compatible with pBR322 and its derivatives. Gene 102:75-78[CrossRef][Medline]. |
| 6. | Bintrim, S. B. 1994. A study of the crystalline inclusion proteins of Photorhabdus luminescens. Ph.D. thesis. University of Wisconsin, Madison. |
| 7. |
Bintrim, S. B., and J. C. Ensign.
1998.
Insertional inactivation of genes encoding the crystalline inclusion proteins of Photorhabdus luminescens results in mutants with pleiotropic phenotypes.
J. Bacteriol.
180:1261-1269 |
| 8. | Bleakley, B., and K. H. Nealson. 1988. Characterization of primary and secondary forms of Xenorhabdus luminescens strain Hm. FEMS Microbiol. Ecol. 53:241-250. |
| 9. |
Boemare, N. E., and R. J. Akhurst.
1988.
Biochemical and physiological characterization of colony form variants in Xenorhabdus spp. (Enterobacteriaceae).
J. Gen. Microbiol.
134:1835-1845 |
| 10. |
Bowen, D.,
T. A. Rocheleau,
M. Blackburn,
O. Andreev,
E. Golubeva,
R. Bhartia, and R. H. ffrench-Constant.
1998.
Insecticidal toxins from the bacterium Photorhabdus luminescens.
Science
280:2129-2132 |
| 11. |
Bowen, D. J., and J. C. Ensign.
1998.
Purification and characterization of a high-molecular-weight insecticidal protein complex produced by the entomopathogenic bacterium Photorhabdus luminescens.
Appl. Environ. Microbiol.
64:3029-3055 |
| 12. |
Brenner, S.
1974.
The genetics of Caenorhabditis elegans.
Genetics
77:71-94 |
| 13. |
Calderwood, S. B., and J. J. Mekalanos.
1988.
Confirmation of the Fur operator site by insertion of a synthetic oligonucleotide into an operator fusion plasmid.
J. Bacteriol.
170:1015-1017 |
| 14. | Chan, J. W. Y. F., and P. H. Goodwin. 1994. Extraction of genomic DNA from extracellular polysaccharide-synthesizing Gram-negative bacteria. BioTechniques 18:419-422. |
| 15. | Ciche, T. A. 2000. Symbiotic interactions between the bacterium Photorhabdus luminescens and the entomopathogenic nematode Heterorhabditis bacteriophora. Ph.D. thesis. University of Wisconsin, Madison. |
| 16. |
Coderre, P. E., and C. F. Earhart.
1989.
The entD gene of the Escherichia coli K12 enterobactin gene cluster.
J. Gen. Microbiol.
135:3043-3055 |
| 17. | Crosa, J. H. 1997. Signal transduction and transcriptional and posttranscriptional control of iron-regulated genes in bacteria. Microbiol. Mol. Biol. Rev. 61:319-336[Abstract]. |
| 18. |
de Lorenzo, V.,
S. Wee,
M. Herrero, and J. B. Neilands.
1987.
Operator sequences of the aerobactin operon of plasmid ColV-K30 binding the ferric uptake regulator (fur) repressor.
J. Bacteriol.
169:2624-2630 |
| 19. |
de Lorenzo, V.,
M. Herrero,
U. Jakubzik, and K. H. Timmis.
1990.
Mini-Tn5 transposon derivatives for the insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in gram-negative eubacteria.
J. Bacteriol.
172:6568-6572 |
| 20. | Edwards, R. A., and J. L. Puente. 1998. Fimbrial expression in enteric bacteria: a critical step in intestinal pathogenesis. Trends Microbiol. 6:282-287[CrossRef][Medline]. |
| 21. | Ehlers, R. D., S. Lunau, K. Krasomil-Osterfeld, and J. H. Osterfeld. 1998. Liquid culture of the entomopathogenic nematode-bacterium-complex Heterorhabditis megidis/Photorhabdus luminescens. BioControl 43:77-86[CrossRef]. |
| 22. | Ehlers, R. D., S. Stoessel, and U. Whyss. 1990. The influence of phase variants of Xenorhabdus spp. and Escherichia coli (Enterobacteriaceae) on the propagation of entomopathogenic nematodes of the genera Steinernema and Heterorhabditis. Rev. Nematol. 13:417-424. |
| 23. | Escolar, L., J. Pèrez-Martìn, and V. de Lorenzo. 1998. Binding of Fur (ferric uptake regulator) repressor of Escherichia coli to arrays of GATAAT sequence. J. Mol. Biol. 283:537-547[CrossRef][Medline]. |
| 24. | Fellay, R., J. Frey, and H. Krisch. 1987. Interposon mutagenesis of soil and water bacteria: a family of DNA fragments designed for in vitro insertional mutagenesis of Gram-negative bacteria. Gene 52:147-154[CrossRef][Medline]. |
| 25. |
Forst, S., and K. H. Nealson.
1996.
Molecular biology of the symbiotic-pathogenic bacteria Xenorhabdus spp. and Photorhabdus spp.
Microbiol. Rev.
60:21-43 |
| 26. | Forst, S., B. Dowds, N. Boemare, and E. Stackebrandt. 1997. Xenorhabdus spp. and Photorhabdus spp.: bugs that kill bugs. Annu. Rev. Microbiol. 51:47-72[CrossRef][Medline]. |
| 27. |
Gay, R.,
D. Le Coq,
M. Steinmetz,
T. Berkelman, and C. I. Kado.
1985.
Positive selection procedure for entrapment of insertion sequence elements in gram-negative bacteria.
J. Bacteriol.
164:918-921 |
| 28. | Gehring, A. M., K. A. Bradley, and C. T. Walsh. 1997. Enterobactin biosynthesis in Escherichia coli: isochorismate lyase (EntB) is a bifunctional enzyme that is phosphopantetheinylated by EntD and then acylated by EntE using ATP and 2,3-dihydroxybenzoate. Biochemistry 36:8495-8503[CrossRef][Medline]. |
| 29. |
Gerlach, G. F.,
S. Clegg, and B. L. Allen.
1989.
Identification and characterization of the genes encoding type 3 and type 1 fimbrial adhesin of Klebsiella pneumoniae.
J. Bacteriol.
171:1262-1270 |
| 30. | Gerritsen, L. J. M., and P. H. Smits. 1993. Variation in pathogenicity of recombinations of Heterorhabditis and Xenorhabdus luminescens strains. Fundam. Appl. Nematol. 16:367-373. |
| 31. | Han, R., W. M. Wouts, and L. Li. 1990. Development of Heterorhabditis spp. strains as characteristics of possible Xenorhabdus luminescens subspecies. Rev. Nematol. 13:411-415. |
| 32. | Han, R., W. M. Wouts, and L. Li. 1991. Development and virulence of Heterorhabditis spp. strains associated with different Xenorhabdus luminescens isolates. J. Invertebr. Pathol. 58:27-32. |
| 33. | Han, R. C., and R.-U. Ehlers. 1998. Cultivation of axenic Heterorhabditis spp. dauer juveniles and their response to non-specific Photorhabdus luminescens food signals. Nematologica 44:425-435. |
| 34. | Han, R. C., and R.-U. Ehlers. 2000. Pathogenicity, development, and reproduction of Heterorhabditis and Steinernema carpocapsae under axenic in vivo conditions. J. Invertebr. Pathol. 75:55-58[CrossRef][Medline]. |
| 35. |
Herrero, M.,
V. de Lorenzo, and K. H. Timmis.
1990.
Transposon vectors containing non-antibiotic resistance selection markers for cloning and stable chromosomal insertion of foreign genes in gram-negative bacteria.
J. Bacteriol.
172:6557-6567 |
| 36. |
Hurlbert, R. E.,
J. Xu, and C. L. Small.
1989.
Colonial and cellular polymorphism in Xenorhabdus luminescens.
Appl. Environ. Microbiol.
55:1136-1143 |
| 37. | Keating, T. A., and C. T. Walsh. 1999. Initiation, elongation, and termination strategies in polyketide and polypeptide antibiotics. Curr. Opin. Chem. Biol. 3:598-606[CrossRef][Medline]. |
| 38. | Khan, A., and W. M. Brooks. 1976. A chromogenic bioluminescent bacterium associated with the entomophilic nematode Chromonema heliothidis. J. Invertebr. Pathol. 29:253-261[CrossRef]. |
| 39. |
Lambalot, R. H.,
A. M. Gehring,
R. S. Flugel,
P. Zuber,
M. LaCelle,
M. A. Marahiel,
R. Reid,
C. Khosla, and C. T. Walsh.
1996.
A new enzyme superfamily the phosphopantetheinyl transferases.
Chem. Biol.
3:923-936[CrossRef][Medline].
|
| 40. |
Lambalot, R. H., and C. T. Walsh.
1995.
Cloning, overproduction, and characterization of the Escherichia coli holo-acyl carrier protein synthase.
J. Biol. Chem.
270:24658-24661 |
| 41. | Lunau, S., S. Stoessal, A. J. Schmidt-Peisker, and R.-U. Ehlers. 1993. Establishment of monoxenic inocula for scaling up in vitro cultures of the entomopathogenic nematodes Steinernema spp. and Heterorhabditis spp. Nematologica 39:385-399. |
| 42. | Marahiel, M. A., T. Stachelhaus, and H. D. Mootz. 1997. Modular peptide synthetases involved in nonribosomal peptide synthesis. Chem. Rev. 97:2651-2674[CrossRef][Medline]. |
| 43. |
Martinez, E.,
B. Bartomole, and F. de la Cruz.
1988.
pACYC184-derived cloning vectors containing the multiple cloning site and lacZ reporter gene of pUC8/9 and pUC18/19 plasmids.
Gene
68:159-162[CrossRef][Medline].
|
| 44. | More, M. I., L. Finger, L. David, J. L. Stryker, C. Fuqua, A. Eberhard, and S. C. Winans. 1998. Enzymatic synthesis of a quorum-sensing autoinducer through use of defined substrates. Science 272:1655-1658[Abstract]. |
| 45. | Poinar, G. O., Jr., G. M. Thomas, and R. Hess. 1977. Characteristics of the specific bacterium associated with Heterorhabditis bacteriophora (Heterorhabditidae: Rhabditida). Nematologica 23:97-102. |
| 46. | Poinar, G. O., T. Jackson, and M. Klein. 1987. Heterorhabditis megidis sp. n. (Heterorhabditae: Rhabditida), parasitic in the japanese beetle, Popillia japonica (Scarabaeidae: Coleoptera), in Ohio. Proc. Helminthol. Soc. Wash. 54:53-59. |
| 47. | Reid, J. L., and A. Collmer. 1987. An nptI-sacB-sacR cartridge for constructing directed, unmarked mutations in Gram-negative bacteria by marker exchange-eviction mutagenesis. Gene 57:239-246[CrossRef][Medline]. |
| 48. | Schmoll, T., J. Morschhaeuser, J. M. Ott, B. Ludwig, I. Van Die, and J. Hacker. 1990. Complete genetic organization and functional aspects of the Escherichia coli S fimbrial adhesin determinant. Nucleotide sequence of genes sfaB, C, D, E, F. Microb. Pathol. 9:331-343. |
| 49. | Schwyn, B., and J. B. Neilands. 1987. Universal chemical assay for the detection and determination of siderophores. Anal. Biochem. 160:47-56[CrossRef][Medline]. |
| 50. | Sierra, G. 1957. A simple method for the detection of lipolytic activity of microorganisms and some observations on the influence of the contact between cells and fatty acid substrates. J. Microbiol. Serol. 23:15-22. |
| 51. |
Takiff, H. E.,
T. Baker,
T. Copeland,
S. M. Chen, and D. L. Court.
1992.
Locating essential Escherichia coli genes by using mini-Tn10 transposons: the pdxJ operon.
J. Bacteriol.
174:1544-1553 |
| 52. |
Wang, H., and B. C. A. Dowds.
1993.
Phase variation in Xenorhabdus luminescens: cloning and sequencing of the lipase gene and analysis of its expression in the primary and secondary phases of the bacterium.
J. Bacteriol.
175:1665-1673 |
| 53. | Wouts, W. M. 1981. Mass production of the entomogenous nematode Heterorhabditis bacteriophora on artificial media. J. Nematol. 13:467-469[Medline]. |
| 54. |
Wyckoff, E. E.,
J. A. Stoebner,
K. E. Reed, and S. M. Payne.
1997.
Cloning of a Vibrio cholerae gene cluster: identification of genes required for early steps in siderophore biosynthesis.
J. Bacteriol.
179:7055-7062 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»