Previous Article | Next Article 
Journal of Bacteriology, May 2001, p. 3160-3168, Vol. 183, No. 10
Laboratory of Bacterial Pathogenesis and
Immunology, The Rockefeller University, New York, New York 10021
Received 23 January 2001/Accepted 27 February 2001
Neisseria gonorrhoeae is naturally able to take up
exogenous DNA and undergo genetic transformation. This ability
correlates with the presence of functional type IV pili, and uptake of
DNA is dependent on the presence of a specific 10-bp sequence. Among the known competence factors in N. gonorrhoeae, none has
been shown to interact with the incoming DNA. Here we describe ComE, a
DNA-binding protein involved in neisserial competence. The gene comE was identified through similarity searches in the
gonococcal genome sequence, using as the query ComEA, the DNA receptor
in competent Bacillus subtilis. The gene comE
is present in four identical copies in the genomes of both N. gonorrhoeae and Neisseria meningitidis, located
downstream of each of the rRNA operons. Single-copy deletion of
comE in N. gonorrhoeae did not have a measurable effect on competence, whereas serial deletions led to
gradual decrease in transformation frequencies, reaching a 4 × 104-fold reduction when all copies were deleted.
Transformation deficiency correlated with impaired ability to take up
exogenous DNA; however, the mutants presented normal piliation and
twitching motility phenotype. The product of comE has 99 amino acids, with a predicted signal peptide; by immunodetection, a
8-kDa protein corresponding to processed ComE was observed in different
strains of N. gonorrhoeae and N. meningitidis.
Recombinant His-tagged ComE showed DNA binding activity, without any
detectable sequence specificity. Thus, we identified a novel gonococcal
DNA-binding competence factor which is necessary for DNA uptake and
does not affect pilus biogenesis or function.
Transformation plays a major role in
the biology of pathogenic Neisseria species: it is their
only known way to exchange genetic material, since neither conjugative
plasmids capable of mobilizing chromosomal elements nor bacteriophages
have been found in these organisms (27). Neisseriae are
naturally competent (39), and the high level of horizontal
genetic exchange that occurs in these bacteria is reflected in their
panmictic population structure, in which gene mosaicism and allelic
linkage equilibrium are observed (25, 37).
Transformation can be described as a multistep process, where the first
event is binding of exogenous DNA to the bacterial surface. This is
followed by DNA uptake, i.e., its transport into a DNase-resistant
state. In neisseriae and other gram-negative organisms, DNA uptake is
usually regarded as passage across the outer membrane
(11). After uptake, the DNA molecule must cross the murein
layer and the cytoplasmic membrane in order to gain access to the
cytoplasm, where it may undergo recombination and integration into the
host chromosome, in a RecA-dependent process (21).
Neisseria binds and takes up DNA in an efficient and yet
largely uncharacterized way. Uptake is dependent on the presence of a
10-bp sequence, 5'GCCGTCTGAA3' (DNA uptake sequence [DUS]) (12, 17). Neisseria has type IV pili (TFP), and
it was early observed that piliation is necessary for DNA uptake
(3), but it is still not known whether pili themselves
participate in the process, since DNA-binding activity has not been
detected in pilus components (26). Among the genes known
to be necessary for competence are those encoding components of the
TFP, such as pilE (pilin) and pilC (tip adhesin)
(34), and those encoding proteins involved in pilus
biogenesis (pilD, pilG, pilF, and pilQ) or
function, such as twitching motility (pilT) (10, 14,
42, 44). Mutations in these genes result in the absence of pili
or in nonfunctional pili. Few identified competence factors are not
involved in Tfp: comL and tpc products
participate in the remodelling of the cell wall (15, 16),
whereas comA encodes a protein involved in transport of DNA
across the cytoplasmic membrane (13). A gene encoding a
pilin-like protein, comP, has been recently described as
essential for competence, but not for pilus assembly or function; localization of its product, however, remains unknown
(45).
The process of DNA uptake has been examined in several systems, and
there is abundant evidence of the conservation of the machinery
involved in this process across different species of naturally
competent bacteria (for a review, see reference 11). Factors involved in competence in different bacteria show sequence homology; remarkably, orthologs of proteins which participate in TFP
structure, biogenesis, or function are necessary for competence, although piliation is not observed in some naturally competent bacteria, such as Bacillus subtilis.
In this work, we decided to explore the similarities between different
DNA uptake systems and the availability of genomic sequence data to
identify new genes involved in competence in Neisseria
gonorrhoeae (gonococcus [GC]). The sequence from GC strain
FA1090 is available from the ongoing Gonococcal Genome Sequencing
Project at the University of Oklahoma
(http://dna1.chem.ou.edu/gono.html). Thus, we searched the neisserial
genome database, using as queries competence factors of other bacteria
which lacked a described ortholog in Neisseria.
Bacterial strains and growth.
N. gonorrhoeae MS11
(43) and derivatives used in this work are listed in Table
1. Piliated (P+) and
transparent (Opa
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.10.3160-3168.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
ComE, a Competence Protein from Neisseria
gonorrhoeae with DNA-Binding Activity
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
) bacteria were grown on gonococcal (GC)
agar at 37°C with 5% CO2, with the following antibiotics
when necessary: erythromycin (2.5 µg/ml), kanamycin (50 µg/ml),
spectinomycin (40 µg/ml), and chloramphenicol (10 µg/ml). Plasmids
were hosted routinely in Escherichia coli XL-1 Blue, with
exception of pSY6 (40), which was hosted in E. coli DH5
. Antibiotic concentrations used for E. coli
were 100 µg of ampicillin, 200 µg of erythromycin, 25 µg of
kanamycin, 50 µg of spectinomycin, and 100 µg of
chloramphenicol/ml.
TABLE 1.
N. gonorrhoeae strains used in this work
Construction of deletion mutants.
Plasmid pGCx1 is a
derivative of pBluescript II SK(
) (Stratagene) containing one copy of
the GC DUS. It was constructed by inserting a pair of annealed
complementary 33-bp oligonucleotides (MutIII
[5'TCACTGGCCGTCTGAATACAACGTCGTGACTGG3'] and
MutIV
[5'CCAGTCACGACGTTGTATTCAGACGGCCAGTGA3']; DUS is underlined) into the EcoRV site of the vector.
Chromosomal DNA from GC strain MS11 was used as the template for PCR amplifications.
) element containing the cassette for spectinomycin and
streptomycin resistance was excised from pHP45 (31) by EcoRI digestion and cloned into pUPD1 linearized with
EcoRI, yielding p
1.
A second construct was made for comE1 deletion by inserting
an erythromycin resistance cassette into pUPD1. The erythromycin resistance cassette, originally from pIM13 (32), was
previously subcloned into pBluescript II SK() (E. C. Gotschlich,
unpublished data), from which it was excised by digestion with
NsiI (site immediately downstream of the stop codon of the
ermC gene) and EcoRI. This fragment was ligated
into pUPD1 digested with EcoRI (from vector polylinker) and
NsiI (site in the region downstream of comE1
[see Fig. 4A]), yielding p1Erm.
For deletion of comE2, a 362-bp fragment containing the 3'
end of comE2 and the sequence downstream was amplified by
PCR using Vent polymerase and the primers comE-dwn and com2
(5'ACACTCGAGCCTAATCTGTACCTGCGTCTGT3'). This product was
digested with EcoRI (site inside primer comE-dwn) and
ligated to pUP24 digested with SmaI and EcoRI,
generating pUPD2. The element was excised from pHP45 as a 2-kb
EcoRI fragment and cloned into pUPD2 linearized with
EcoRI, yielding p2.
For deletion of comE3, a 436-bp fragment containing the 3'
end of comE3 and the sequence downstream was amplified by
PCR using Vent polymerase and the primers comE-dwn and com3
(5'TAACTCGAGGCCCGGATGCCTGATTAT3'). This product was digested
with EcoRI (site inside primer comE-dwn) and ligated to
pUP24 digested with SmaI and EcoRI, generating pUPD3. A 1.1-kb fragment containing the chloramphenicol
acetyltransferase gene (cat) was excised from pHSS6-Cat2.9
(a gift from H. S. Seifert) by NotI digestion, treated
with the Klenow fragment of E. coli DNA polymerase I, and
cloned into pUPD3 linearized with EcoRI and treated with
Klenow fragment, yielding p3Clm.
For deletion of comE4, a 631-bp fragment containing the 3'
end of comE4 and the sequence downstream was amplified by
PCR using Vent polymerase and the primers comE-dwn and com4
(5'TAACTCGAGTGCTGCCTTTTCCCATTT3'). This product was digested
with EcoRI (site inside primer comE-dwn) and ligated to
pUP24 digested with SmaI and EcoRI, generating pUPD4. A 1.2-kb fragment containing a kanamycin resistance cassette was
excised from pCR2.1-kan/DUS (a gift from Stuart Hill) and cloned into
pUPD4 linearized with EcoRI, yielding p4Kan.
The plasmids p1, p1Erm, p2, p3Clm, and p4Kan were
used to transform N. gonorrhoeae MS11 and derivatives.
Southern blot analysis. Total DNA from GC strains was digested with HindIII, subjected to electrophoresis in a 0.8% agarose gel and transferred to a nylon membrane (Hybond N+; AP Biotech) using standard techniques. Probe labeling, hybridization, and detection were performed with AlkPhos system (AP Biotech). A PCR product corresponding to an internal fragment of the comE gene was used as a probe; it was amplified using the oligonucleotides com-S (5'CCATGAAAAAAATGTTTGTATTG3') and com-RT (5'GCCGGACCGATGCCCTTC3') as primers and plasmid pGC-comE1 as the template. The latter was constructed by inserting a PCR fragment containing the comE1 gene into plasmid pGCx1; the fragment was amplified with the primers com1 (5'AACAAGCTTTTAGAAAATGACCCGTTTTA3') and com1-2 (5'AACTCGAGTACAGACAATATCAAGACCACT3'), digested with HindIII and XhoI (sites underlined in primer sequences), and ligated to pGCx1 digested with the same restriction enzymes.
RT-PCR. Reverse transcription-PCR (RT-PCR) was performed with Ready-To-Go beads (AP Biotech), using as the template 500 ng of total RNA prepared from GC strains with Tri Reagent (Molecular Research Center) and treated with RNase-free DNase I. Two sets of primers were used: (i) comP1 (5'AATCGGGGGTTTACACTGGT3') and comP2 (5'TCACTACACGAACTGGCGGACTT3') and (ii) tbpA1 (5'ATTTGCCTTCCGGTTGGTCATAGC3') and tbpA2 (5'GGCGGTCGGGCGGTAAAATAAA3'). DNA contamination controls were performed by inactivating reverse transcriptase with 10 min of incubation at 95°C. Amplification was carried out for 27 cycles, and products were analyzed by agarose gel electrophoresis.
Transformation assay. Gonococcal strains grown on GC agar for 12 to 15 h were suspended in Proteose Peptone medium with 10 mM MgCl2 to ca. 108 CFU/ml. A 0.5-ml portion of the suspensions was mixed with 500 ng of plasmid pSY6, which contains a neisserial chromosomal fragment with a mutated form of the gene gyrB that confers resistance to nalidixic acid (40). The suspensions were kept at 37°C for 30 min, after which 100 µg of DNase I was added, and the mixtures were further incubated for 5 to 10 min at room temperature. The bacteria were diluted with 2 ml of Proteose Peptone broth and incubated for 5 h at 37°C with 5% CO2, after which they were serially diluted and plated in triplicates on GC agar, with or without 2 µg of nalidixic acid/ml. Transformation frequencies were calculated relative to the total number of CFU recovered on GC agar.
Uptake assay.
A 350-bp DNA fragment containing the DUS in
its central portion was amplified by PCR, using pGCx1 as the template
and primers T3 (5'ATTAACCCTCACTAAAGGGA3') and Blue
(5'ATTTCCATTCGCCATTCAGG3'). Radiolabeled
[-32P]dATP and [-32P]dCTP were added
to the reaction mixture and incorporated into the product, which was
purified using G-50 spin columns (ProbeQuant; AP Biotech); specific
activities obtained were about 5 × 106 cpm/µg.
Primer extension.
Total RNA (30 µg) from GC strain MS11
was annealed with 0.2 pmol of the oligonucleotide comE-XT
(5'ATGTTTACCGCCGCAAGGGAGAAG3') end labeled with
[
-32P]ATP and T4 polynucleotide kinase. Primer
extension reactions were performed with Superscript II enzyme (Gibco
BRL), and the product was analyzed in an 8% polyacrylamide gel,
together with products of sequencing reactions using comE-XT as the
primer and pGC-comE1 as the template.
Expression and purification of rComE.
The primers comE-M
(5'GAAGGATCCGCGGTAAACATCAATGCGGC3') and com1-2
(5'AACTCGAGTACAGACAATATCAAGACCACT3') were used
to amplify the sequence corresponding to the putative mature ComE; the
fragment was digested with BamHI and XhoI (sites
underlined in primer sequences) and cloned into pQE30 (Qiagen) digested
with BamHI and SalI, yielding plasmid pQM1.
Expression of mature six-His-tagged ComE (rComE) in E. coli
strain M15/pRP4 was induced by adding 0.5 mM IPTG
(isopropyl-
-D-thiogalactopyranoside) to cultures in
mid-log phase, and the recombinant protein was purified by affinity
chromatography with nickel-nitrilotriacetic acid resin under native
conditions, as recommended by the manufacturer. The purified protein
was used to raise rabbit antiserum.
DNA-binding assays.
Southwestern blots were performed as
follows: protein samples were fractionated by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred
to nitrocellulose filters. The filters were equilibrated in binding
buffer (25 mM HEPES [pH 7.9], 3 mM MgCl2, 4 mM KCl) with
5% skim milk and 0.05% NaN3 for 4 h, probed
overnight with radiolabeled DNA, and washed with binding buffer before
exposure. Different DNA molecules were radiolabeled by primer extension
and used as probes: plasmid pBluescript II SK(), plasmid pGCx7
[pBluescript II SK() containing seven copies of the DUS], and a
0.7-kb PvuII fragment derived from the latter.
-32P]ATP and T4 polynucleotide kinase. Approximately
4 × 103 pmol (0.25 ng) of the probe was mixed with
different amounts of rComE in 15 µl of gel shift buffer (25 mM HEPES
[pH 7.9], 3 mM MgCl2, 4 mM KCl, 150 mM NaCl, and 5%
glycerol), with or without competing DNA [poly(dI-dC) or calf thymus
DNA]. The mixture was incubated for 15 min at room temperature and
separated by electrophoresis in an 8% polyacrylamide gel in
Tris-borate-EDTA buffer.
For agarose gel retardation assays, 500 ng of pBluescript II SK() or
pGCx1 was incubated with different amounts of rComE in 10 µl of 25 mM
HEPES (pH 7.9)-2.5 mM MgCl2-50 mM NaCl-500 ng bovine
serum albumin for 15 min at room temperature. Reaction products were
analyzed by electrophoresis in 0.8% agarose gel in Tris-acetate-EDTA buffer.
Immunoblots. Proteins were fractionated by SDS-PAGE on a 12.5% polyacrylamide gel in Tris-Tricine buffer and transferred to nitrocellulose membrane (Hybond-C; AP Biotech). The membrane was blocked with 3% skim milk-0.05% Triton X-100 in phosphate-buffered saline and probed with rabbit anti-ComE antiserum diluted in the same solution, followed by incubation with protein A conjugated to horseradish peroxidase and detection by chemiluminescence (ECL kit; AP Biotech).
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Identification of an ORF with homology to B. subtilis
comEA in the Neisseria genome.
ComEA is the DNA
receptor in competent B. subtilis (33), being
required for both binding and transport of DNA during transformation (20). Using the TBLASTN algorithm (1), the
gonococcal genome was queried against ComEA. We initially found one
open reading frame (ORF) whose derived amino acid sequence showed
homology (46% identity and 69% similarity over a 63-amino-acid
stretch) (Fig. 1A) to the C-terminal
portion of the B. subtilis protein, which is the domain with
DNA-binding activity. The neisserial ORF was named comE.
|
Genetic organization of the comE loci in
Neisseria.
The comE copies are distributed
throughout the bacterial chromosome, located downstream of each of the
four rRNA operons (rrn) of GC FA1090 (Fig.
2), and were arbitrarily numbered 1 to 4. The sequence between the rrn operons and the comE
copies is absolutely conserved in all four locations and contains a
copy of the Correia element, a neisserial 152-bp repetitive sequence
with 26-bp inverted repeats at its extremities (7). In
both MC strains, Z2491 and MC58, the comE copies are also
found next to the rRNA operons but the Correia element is absent at all
four locations.
|
10 region
(5'TACCGG3') has only two out of six bases identical to the
sigma 70 promoter consensus sequence (5'TATAAT3'), while a
potential 35 region (5'TTGAGC3') can be recognized 18 bp
further upstream, with four of six bases of the consensus sequence
(5'TTGACA3'). This putative promoter is localized inside the
Correia element, with the 10 region and the transcription start point
contained in the proximal 26-bp inverted repeat (Fig. 3).
|
Deletion of comE copies affects transformation
ability.
In order to determine whether comE is
necessary for Neisseria competence, mutants containing
deletions of comE were constructed in a GC MS11 background
and tested for transformability. This was accomplished by replacing the
structural region of each comE copy with an antibiotic
resistance cassette, with the use of four different cassettes allowing
for the construction of mutants with multiple comE
deletions. The deletions were confirmed by PCR (not shown) and Southern
blot analysis (Fig. 4A).
|
comE1::Spc genotype, which exhibited a ca.
10-fold reduction in transformation frequency compared to the parental
strain. Since the sequence upstream of each of the comE
copies and the structural regions themselves are identical in MS11,
this phenotype could be due to a polar effect of this particular
construct. In fact, comP, the gene located immediately
downstream of comE1, is essential for competence, and it was
reported that transposon insertions in the 3'-terminal region of
comE1 partially reduced the transformation ability of GC
(45).
In order to confirm the polar effect of
comE1::Spc, a second strain (the
comE1::Erm mutant) was constructed by replacing comE1 with the Ermr cassette without its
transcriptional terminator, inserted in the same orientation as
comP and close to its initial ATG (see the NsiI
site in Fig. 3). In this way, comP would be expressed as a
transcriptional fusion from the Ermr cassette promotor.
RT-PCR analysis was performed to assess comP mRNA levels in
the strains: as shown in Fig. 4C, a small decrease in the amount of
comP transcript could be detected in the
comE1::Spc strain compared to the wild-type
strain; in contrast, the comE1::Erm strain had
elevated levels of comP mRNA. Transformation frequencies obtained with the comE1::Erm strain were
consistently higher (ca. threefold) than wild-type frequencies (Fig.
4B), suggesting that ComP may be limiting during the transformation
process. This is consistent with the fact that ComP was not detectable
by immunoblotting in GC (45), which indicates that this
protein is normally present in very small amounts.
Sequential deletion of the comE copies yielded the following
results: deletion of copies 3 and 4 did not have a marked effect on
transformation frequency (an approximately 50% decrease compared to
the parental strain), whereas deletion of copies 4, 3, and 2 diminished
transformability to ca. 10 to 15% of the wild-type level. Finally,
deletion of all four copies severely impaired transformation capacity,
even with comP being overexpressed (Fig. 4C): frequencies
were reduced to ca. 0.0025% of wild-type values (Fig. 4B), which
corresponds to a 4 × 104-fold decrease. The
comE-all mutant did not show detectable growth deficiency
in vitro and exhibited normal piliation, as evaluated by colony
morphology; the twitching motility phenotype was also preserved. Thus,
we conclude that comE is not necessary for pilus formation,
but it is essential for genetic competence in GC.
Effects of comE deletions on transformation correlates
with DNA uptake ability.
In order to understand in which step of
the transformation process comE participates, we compared
the abilities of GC MS11 and the deletion mutants to take up DNA to a
DNase-protected state (Fig. 4D). The comE2,
comE3, and comE4 mutants were able to internalize DNA at levels similar to that of the wild-type strain. The
comE1::Spc mutant showed impaired ability to
take up DNA, whereas the comE1::Erm strain was
up to 10 times more efficient than the parental strain in this assay;
these data confirm the role of ComP in DNA uptake (45).
Multiple deletions of comE led to progressive reduction in
the ability to internalize DNA; the comE-all mutant
protected DNA at the same level as nonpiliated bacteria, which are
unable to take up DNA (3). The pattern shown by the
comE deletion strains in this assay resembles their phenotypes regarding transformation capacity (Fig. 4B), indicating that
the influence of comE mutations on transformability reflects their effect on DNA uptake. Thus, we conclude that comE is
necessary for efficient DNA uptake in GC.
The comE gene is expressed as a protein.
Rabbit
antiserum was raised against purified rComE and used for immunoblotting
analysis of whole-cell extracts from MS11 and comE mutants.
As shown in Fig. 4E, a number of bands were recognized by this
antiserum, including a strongly immunoreactive band corresponding to a
protein of ca. 8 kDa. This band could be observed in lysates from the
wild-type and single-copy deletion strains, with similar intensity; a
decrease in the signal could be observed in the comE43 strain, whereas it was very weak in the comE432 strain.
Finally, this band was absent in the mutant comE-all
strain, indicating that it corresponds to the product of
comE. The migration rate of this band agrees with the
predicted molecular mass of the protein after processing of the
putative signal peptide (8 kDa), while the unprocessed protein would be
10.3 kDa. rComE has a calculated molecular mass of 9.5 kDa.
Recombinant ComE binds DNA. B. subtilis ComEA protein has DNA-binding activity (33). In order to characterize the properties of the neisserial ortholog, we expressed and purified rComE and tested its ability to bind DNA in a number of in vitro assays.
A DNA-binding activity could be observed in a Southwestern assay in whole-cell lysate from E. coli M15/pRP4/pQM1 (which encodes the His-tagged ComE) after IPTG induction (Fig. 5A). The purified recombinant protein showed the same property, indicating that the DNA-binding activity belongs to the His-tagged protein. However, different probes were found to bind to the protein (data not shown), irrespective of the presence or absence of DUS.
|
Recombinant ComE inhibits neisserial transformation.
When
purified ComE was exogenously added to a transformation mixture, it was
able to inhibit transformation of GC MS11 in a dose-dependent manner
(Fig. 6). This effect can be attributed to sequestration of the plasmid DNA by rComE, and it could be alleviated by the presence of poly(dI-dC) (Fig. 6), which by itself did
not have any effect on transformation (data not shown). These results
support the notion that the binding of DNA to ComE is not sequence
specific.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
We identified comE, a gene involved in DNA uptake during transformation of N. gonorrhoeae. So far, this is the only gonococcal competence factor known to interact with DNA. Its identification was possible due to the similarity to its ortholog in B. subtilis and to the availability of neisserial genomic sequence information. Given the presence of four copies of this gene in the chromosome and the need to inactivate at least three of them in order to have a clearly noticeable phenotype (Fig. 4B), its identification by classical genetic methods such as mutagenesis would have been unlikely.
Why are there four copies of comE in the Neisseria genome? As shown here, a single copy of this gene in GC is sufficient to achieve efficient transformation, and the complete absence of comE did not affect viability in vitro or piliation, suggesting that there would not be a strong selective pressure to keep multiple copies of comE. In GC, there are Correia elements flanking the comE genes; copies of this repetitive sequence have been found upstream of several members of the opa gene family (2), indicating that it might play a role in gene duplication and rearrangement. Its presence upstream of the comE copies in GC could suggest that a similar process led to the duplication of this gene. However, these elements are not found upstream of comE genes in N. meningitidis.
The localization of comE next to the rRNA operons might provide a hint on how its duplication occurred and how the multiple copies are kept homogeneous. rRNA operons, present in multiple copies in most bacterial species, are subject to concerted evolution by gene conversion (18), and homogenization of flanking regions resulting from coconversion has been described (24). Thus, it is conceivable that comE was initially present downstream of one rrn operon, from where it was propagated to the other locations by gene conversion. This process would also account for the sequence homogeneity among the copies within one strain, whereas the sequence could drift between strains. Interestingly, as seen from MC genomes, the differences among the comE copies within a strain occur mostly in the 3' end of the gene, where the homogenizing effect of the rrn operon proximity might be less pronounced. The insertion of the Correia element between the rrn operons and the comE copies in GC would have occurred after comE duplication, initially as a single insertion which then spread to the other loci through the same mechanism. A strikingly similar situation is found in Dichelobacter nodosus, where identical copies of the 5' region of ORF E, whose product is homologous to ComE (Fig. 1B), are located downstream of all three rrn operons (22). Another suggestive analogy can be drawn from Streptococcus pneumoniae, where two identical copies of comX, which encodes a competence-specific transcriptional modulator, are located upstream of two rrn operon copies (23).
In MC, the ORFs containing the comE copies can be extended beyond the ATG start codon for GC shown in Fig. 3. In fact, Zhu et al. (46) described a comEA-like ORF (which corresponds to comE4) in MC and assumed that the corresponding gene in GC would be a pseudogene, interrupted by the Correia element. Furthermore, the annotation of both MC genomes features ComEA-like proteins of 148 amino acids. However, our data show that ComE in GC is functional, and immunoblotting analysis detected a protein in MC with the same migration rate as in GC.
Neisserial ComE shares sequence similarity with the C-terminal portion of the B. subtilis ComEA, which is the domain with DNA-binding activity. The alignment of the two protein sequences shows that the homology starts immediately after the putative signal peptide cleavage site in neisserial ComE and after a flexible region containing a stretch of glycine residues in B. subtilis ComEA, which could function as a hinge that allows the protein to bend and direct the bound DNA to a channel spanning the cytoplasmic membrane (11). B. subtilis ComEA is an integral membrane protein which spans this organism's thick cell wall, in order to make contact with DNA on the cell surface. In contrast, neisserial ComE is much smaller and does not contain any identifiable transmembrane domain, but it does possess a predicted signal peptide. Thus, the protein would presumably be translocated across the cytoplasmic membrane by the Sec machinery; since the signal peptide is apparently cleaved, as suggested by the migration rate of the ComE band (Fig. 4E), the mature protein should be released into the periplasm.
ComE and its B. subtilis ortholog (ComEA) contain predicted HhH motifs, which interact with DNA in a non-sequence-specific manner (8). Indeed, DNA binding and uptake in B. subtilis do not have any sequence requirement, and our data indicate that the DNA-binding activity of ComE lacks sequence specificity. However, DNA uptake in Neisseria is dependent on the presence of the DUS, a motif which is overrepresented in the neisserial genome, frequently appearing as an inverted pair 3' of ORFs and serving as a transcriptional terminator (17, 29). So, one may question what role ComE plays in the process of DNA uptake in Neisseria.
The first possible scenario is that ComE binds DNA nonspecifically to the cell surface. DNA binding to gonococci has been reported to be nonspecific (9), and different positively charged surface structures may contribute to this interaction, such as the Opa proteins (19). In the same manner, ComE could prolong sequestration of DNA to the cell surface, which would translate into more efficient uptake over time. However, anti-ComE serum did not inhibit transformation (data not shown) and transformability was not restored in comE mutants by supplying exogenous recombinant protein, in contrast to what was observed with PilC (34): these data suggest that ComE is not surface exposed. Besides, this model would also imply a rather accessory role in transformation, as with Opa (19), whereas ComE is essential for efficient Neisseria transformation. A second possibility is that ComE is part of a structure that binds DNA and recognizes the DUS but is not capable of specific binding by itself. But in that case, transformation would be prone to inhibition by nonspecific DNA, which does not happen in Neisseria.
The third possibility is that ComE is involved in binding of DNA molecules which have already been selected for the presence of the DUS; in that case, sequence specificity would not be a requirement anymore. The DUS would be recognized at the cell surface by its specific receptor, whose identity remains unknown, and committed to uptake, maybe through binding to ComE.
The gene comP, whose product is essential for competence, is located directly downstream of comE1, in both GC and MC. So far, ComP and now ComE are the only factors known to be necessary for DNA uptake which are not involved in pilus structure, biogenesis, or function in Neisseria. In B. subtilis, DNA binding during transformation requires the presence of four pilin-like proteins, ComGC, -GD, -GE, and -GG (4, 5). It has been suggested that these ComG proteins form a channel structure which would allow ComEA to traverse the cell wall and gain access to DNA on the surface (33). Since ComP is a pilin-like protein, it is tempting to speculate whether it would play an equivalent role in Neisseria, perhaps forming a composite structure together with PilE (45), with which ComE would interact.
| |
ACKNOWLEDGMENTS |
|---|
We acknowledge the following genome projects: the Gonococcal Genome Sequencing Project, N. meningitidis Z2491 at the Sanger Centre, and N. meningitidis MC58 at The Institute for Genomic Research. We thank David Dubnau and Roberta Provvedi for sharing unpublished data on B. subtilis ComEA and helpful suggestions; Vijay Pancholi, Daniel Nelson, and Chris Elkins for technical advice; and Ben Mulder for insightful discussion.
This work was supported by Public Health Service grant AI 10615 to E.C.G.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Public Health Research Institute, 455 First Ave., New York, NY 10016. Phone: (212) 578-0843. Fax: (212) 578-0804. E-mail: ichen{at}phri.nyu.edu.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. |
Altschul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402 |
| 2. | Belland, R. J., S. G. Morrison, J. H. Carlson, and D. M. Hogan. 1997. Promoter strength influences phase variation of neisserial opa genes. Mol. Microbiol. 23:123-135[CrossRef][Medline]. |
| 3. |
Biswas, G. D.,
T. Sox,
E. Blackman, and P. F. Sparling.
1977.
Factors affecting genetic transformation of Neisseria gonorrhoeae.
J. Bacteriol.
129:983-992 |
| 4. | Chung, Y. S., F. Breidt, and D. Dubnau. 1998. Cell surface localization and processing of the ComG proteins, required for DNA binding during transformation of Bacillus subtilis. Mol. Microbiol. 29:905-913[CrossRef][Medline]. |
| 5. |
Chung, Y. S., and D. Dubnau.
1998.
All seven comG open reading frames are required for DNA binding during transformation of competent Bacillus subtilis.
J. Bacteriol.
180:41-45 |
| 6. |
Cornelissen, C. N.,
G. D. Biswas,
J. Tsai,
D. K. Paruchuri,
S. A. Thompson, and P. F. Sparling.
1992.
Gonococcal transferrin-binding protein 1 is required for transferrin utilization and is homologous to TonB-dependent outer membrane receptors.
J. Bacteriol.
174:5788-5797 |
| 7. |
Correia, F. F.,
S. Inouye, and M. Inouye.
1988.
A family of small repeated elements with some transposon-like properties in the genome of Neisseria gonorrhoeae.
J. Biol. Chem.
263:12194-12198 |
| 8. |
Doherty, A. J.,
L. C. Serpell, and C. P. Ponting.
1996.
The helix-hairpin-helix DNA-binding motif: a structural basis for non-sequence-specific recognition of DNA.
Nucleic Acids Res.
24:2488-2497 |
| 9. | Dougherty, T. J., A. Asmus, and A. Tomasz. 1979. Specificity of DNA uptake in genetic transformation of gonococci. Biochem. Biophys. Res. Commun. 86:97-104[CrossRef][Medline]. |
| 10. | Drake, S. L., and M. Koomey. 1995. The product of the pilQ gene is essential for the biogenesis of type IV pili in Neisseria gonorrhoeae. Mol. Microbiol. 18:975-986[CrossRef][Medline]. |
| 11. | Dubnau, D. 1999. DNA uptake in bacteria. Annu. Rev. Microbiol. 53:217-244[CrossRef][Medline]. |
| 12. |
Elkins, C.,
C. E. Thomas,
H. S. Seifert, and P. F. Sparling.
1991.
Species-specific uptake of DNA by gonococci is mediated by a 10-base-pair sequence.
J. Bacteriol.
173:3911-3913 |
| 13. | Facius, D., and T. F. Meyer. 1993. A novel determinant (comA) essential for natural transformation competence in Neisseria gonorrhoeae and the effect of a comA defect on pilin variation. Mol. Microbiol. 10:699-712[CrossRef][Medline]. |
| 14. | Freitag, N. E., H. S. Seifert, and M. Koomey. 1995. Characterization of the pilF-pilD pilus-assembly locus of Neisseria gonorrhoeae. Mol. Microbiol. 16:575-586[Medline]. |
| 15. | Fussenegger, M., D. Facius, J. Meier, and T. F. Meyer. 1996. A novel peptidoglycan-linked lipoprotein (ComL) that functions in natural transformation competence of Neisseria gonorrhoeae. Mol. Microbiol. 19:1095-1105[CrossRef][Medline]. |
| 16. | Fussenegger, M., A. F. Kahrs, D. Facius, and T. F. Meyer. 1996. Tetrapac (tpc), a novel genotype of Neisseria gonorrhoeae affecting epithelial cell invasion, natural transformation competence and cell separation. Mol. Microbiol. 19:1357-1372[CrossRef][Medline]. |
| 17. |
Goodman, S. D., and J. J. Scocca.
1988.
Identification and arrangement of the DNA sequence recognized in specific transformation of Neisseria gonorrhoeae.
Proc. Natl. Acad. Sci. USA
85:6982-6986 |
| 18. | Gurtler, V. 1999. The role of recombination and mutation in 16S-23S rDNA spacer rearrangements. Gene 238:241-252[CrossRef][Medline]. |
| 19. |
Hill, S. A.
2000.
Opa expression correlates with elevated transformation rates in Neisseria gonorrhoeae.
J. Bacteriol.
182:171-178 |
| 20. |
Inamine, G. S., and D. Dubnau.
1995.
ComEA, a Bacillus subtilis integral membrane protein required for genetic transformation, is needed for both DNA binding and transport.
J. Bacteriol.
177:3045-3051 |
| 21. |
Koomey, J. M., and S. Falkow.
1987.
Cloning of the recA gene of Neisseria gonorrhoeae and construction of gonococcal recA mutants.
J. Bacteriol.
169:790-795 |
| 22. |
La Fontaine, S., and J. I. Rood.
1996.
Organization of ribosomal RNA genes from the footrot pathogen Dichelobacter nodosus.
Microbiology
142:889-899 |
| 23. |
Lee, M. S., and D. A. Morrison.
1999.
Identification of a new regulator in Streptococcus pneumoniae linking quorum sensing to competence for genetic transformation.
J. Bacteriol.
181:5004-5016 |
| 24. | Liao, D. 2000. Gene conversion drives within genic sequences: concerted evolution of ribosomal RNA genes in bacteria and archaea. J. Mol. Evol. 51:305-317[Medline]. |
| 25. | Maiden, M. C. 1993. Population genetics of a transformable bacterium: the influence of horizontal genetic exchange on the biology of Neisseria meningitidis. FEMS Microbiol. Lett. 112:243-250[CrossRef][Medline]. |
| 26. |
Mathis, L. S., and J. J. Scocca.
1984.
On the role of pili in transformation of Neisseria gonorrhoeae.
J. Gen. Microbiol.
130:3165-3173 |
| 27. | Meyer, T. F., J. Pohlner, and J. van Putten. 1994. Biology of the pathogenic Neisseriae. Curr. Top. Microbiol. Immunol. 192:283-317[Medline]. |
| 28. |
Nielsen, H.,
J. Engelbrecht,
S. Brunak, and G. von Heijne.
1997.
Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites.
Prot. Eng.
10:1-6 |
| 29. | Parkhill, J., M. Achtman, K. D. James, S. D. Bentley, C. Churcher, S. R. Klee, G. Morelli, D. Basham, D. Brown, T. Chillingworth, R. M. Davies, P. Davis, K. Devlin, T. Feltwell, N. Hamlin, S. Holroyd, K. Jagels, S. Leather, S. Moule, K. Mungall, M. A. Quail, M. A. Rajandream, K. M. Rutherford, M. Simmonds, J. Skelton, S. Whitehead, B. G. Spratt, and B. G. Barrell. 2000. Complete DNA sequence of a serogroup A strain of Neisseria meningitidis Z2491. Nature 404:502-506[CrossRef][Medline]. |
| 30. |
Pestova, E. V., and D. A. Morrison.
1998.
Isolation and characterization of three Streptococcus pneumoniae transformation-specific loci by use of a lacZ reporter insertion vector.
J. Bacteriol.
180:2701-2710 |
| 31. | Prentki, P., and H. M. Krisch. 1984. In vitro insertional mutagenesis with a selectable DNA fragment. Gene 29:303-313[CrossRef][Medline]. |
| 32. |
Projan, S. J.,
M. Monod,
C. S. Narayanan, and D. Dubnau.
1987.
Replication properties of pIM13, a naturally occurring plasmid found in Bacillus subtilis, and of its close relative pE5, a plasmid native to Staphylococcus aureus.
J. Bacteriol.
169:5131-5139 |
| 33. | Provvedi, R., and D. Dubnau. 1999. ComEA is a DNA receptor for transformation of competent Bacillus subtilis. Mol. Microbiol. 31:271-280[CrossRef][Medline]. |
| 34. |
Rudel, T.,
D. Facius,
R. Barten,
I. Scheuerpflug,
E. Nonnenmacher, and T. F. Meyer.
1995.
Role of pili and the phase-variable PilC protein in natural competence for transformation of Neisseria gonorrhoeae.
Proc. Natl. Acad. Sci. USA
92:7986-7990 |
| 35. | Rudel, T., I. Scheurerpflug, and T. F. Meyer. 1995. Neisseria PilC protein identified as type-4 pilus tip-located adhesin. Nature 373:357-359[CrossRef][Medline]. |
| 36. |
Schultz, J.,
R. R. Copley,
T. Doerks,
C. P. Ponting, and P. Bork.
2000.
SMART: a web-based tool for the study of genetically mobile domains.
Nucleic Acids Res.
28:231-234 |
| 37. |
Smith, J. M.,
N. H. Smith,
M. O'Rourke, and B. G. Spratt.
1993.
How clonal are bacteria?
Proc. Natl. Acad. Sci. USA
90:4384-4388 |
| 38. |
Sonnhammer, E. L.,
S. R. Eddy,
E. Birney,
A. Bateman, and R. Durbin.
1998.
Pfam: multiple sequence alignments and HMM-profiles of protein domains.
Nucleic Acids Res.
26:320-322 |
| 39. |
Sparling, P. F.
1966.
Genetic transformation of Neisseria gonorrhoeae to streptomycin resistance.
J. Bacteriol.
92:1364-1371 |
| 40. |
Stein, D. C.,
R. J. Danaher, and T. M. Cook.
1991.
Characterization of a gyrB mutation responsible for low-level nalidixic acid resistance in Neisseria gonorrhoeae.
Antimicrob. Agents Chemother.
35:622-626 |
| 41. |
Tettelin, H.,
N. J. Saunders,
J. Heidelberg,
A. C. Jeffries,
K. E. Nelson,
J. A. Eisen,
K. A. Ketchum,
D. W. Hood,
J. F. Peden,
R. J. Dodson,
W. C. Nelson,
M. L. Gwinn,
R. DeBoy,
J. D. Peterson,
E. K. Hickey,
D. H. Haft,
S. L. Salzberg,
O. White,
R. D. Fleischmann,
B. A. Dougherty,
T. Mason,
A. Ciecko,
D. S. Parksey,
E. Blair,
H. Cittone,
E. B. Clark,
M. D. Cotton,
T. R. Utterback,
H. Khouri,
H. Qin,
J. Vamathevan,
J. Gill,
V. Scarlato,
V. Masignani,
M. Pizza,
G. Grandi,
L. Sun,
H. O. Smith,
C. M. Fraser,
E. R. Moxon,
R. Rappuoli, and J. C. Venter.
2000.
Complete genome sequence of Neisseria meningitidis serogroup B strain MC58.
Science.
287:1809-1815 |
| 42. | Tonjum, T., N. E. Freitag, E. Namork, and M. Koomey. 1995. Identification and characterization of pilG, a highly conserved pilus-assembly gene in pathogenic Neisseria. Mol. Microbiol. 16:451-464[Medline]. |
| 43. | West, S. E., and V. L. Clark. 1989. Genetic loci and linkage associations in Neisseria gonorrhoeae and Neisseria meningitidis. Clin. Microbiol. Rev. 2(Suppl.):S92-S103. |
| 44. | Wolfgang, M., P. Lauer, H. S. Park, L. Brossay, J. Hebert, and M. Koomey. 1998. PilT mutations lead to simultaneous defects in competence for natural transformation and twitching motility in piliated Neisseria gonorrhoeae. Mol. Microbiol. 29:321-330[CrossRef][Medline]. |
| 45. | Wolfgang, M., J. van Putten, S. F. Hayes, and M. Koomey. 1999. The comP locus of Neisseria gonorrhoeae encodes a type IV prepilin that is dispensable for pilus biogenesis but essential for natural transformation. Mol. Microbiol. 31:1345-1357[CrossRef][Medline]. |
| 46. |
Zhu, P.,
G. Morelli, and M. Achtman.
1999.
The opcA and  opcB regions in Neisseria: genes, pseudogenes, deletions, insertion elements and DNA islands.
Mol. Microbiol.
33:635-650[CrossRef][Medline].
|
Journal of Bacteriology, May 2001, p. 3160-3168, Vol. 183, No. 10
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.10.3160-3168.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lang, E., Haugen, K., Fleckenstein, B., Homberset, H., Frye, S. A., Ambur, O. H., Tonjum, T.
(2009). Identification of neisserial DNA binding components. Microbiology
155: 852-862
[Abstract] [Full Text] -
Blokesch, M., Schoolnik, G. K.
(2008). The Extracellular Nuclease Dns and Its Role in Natural Transformation of Vibrio cholerae. J. Bacteriol.
190: 7232-7240
[Abstract] [Full Text] -
Jeon, B., Zhang, Q.
(2007). Cj0011c, a Periplasmic Single- and Double-Stranded DNA-Binding Protein, Contributes to Natural Transformation in Campylobacter jejuni. J. Bacteriol.
189: 7399-7407
[Abstract] [Full Text] -
Assalkhou, R., Balasingham, S., Collins, R. F., Frye, S. A., Davidsen, T., Benam, A. V., Bjoras, M., Derrick, J. P., Tonjum, T.
(2007). The outer membrane secretin PilQ from Neisseria meningitidis binds DNA. Microbiology
153: 1593-1603
[Abstract] [Full Text] -
Ducey, T. F., Carson, M. B., Orvis, J., Stintzi, A. P., Dyer, D. W.
(2005). Identification of the Iron-Responsive Genes of Neisseria gonorrhoeae by Microarray Analysis in Defined Medium. J. Bacteriol.
187: 4865-4874
[Abstract] [Full Text] -
Wiesner, R. S., Hendrixson, D. R., DiRita, V. J.
(2003). Natural Transformation of Campylobacter jejuni Requires Components of a Type II Secretion System. J. Bacteriol.
185: 5408-5418
[Abstract] [Full Text] -
Yeh, Y.-C., Lin, T.-L., Chang, K.-C., Wang, J.-T.
(2003). Characterization of a ComE3 Homologue Essential for DNA Transformation in Helicobacter pylori. Infect. Immun.
71: 5427-5431
[Abstract] [Full Text] -
Albiger, B., Johansson, L., Jonsson, A.-B.
(2003). Lipooligosaccharide-Deficient Neisseria meningitidis Shows Altered Pilus-Associated Characteristics. Infect. Immun.
71: 155-162
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»