Previous Article | Next Article ![]()
Journal of Bacteriology, May 2001, p. 3224-3236, Vol. 183, No. 10
Department of Biology, University of
California at San Diego, La Jolla, California 92093
Received 2 November 2000/Accepted 6 March 2001
The heterofermentative lactic acid bacterium Lactobacillus
brevis transports galactose and the nonmetabolizable galactose analogue thiomethyl- The phosphoenolpyruvate: sugar
phosphotransferase system (PTS) plays a major role in the regulation of
carbon and energy metabolism in many diverse prokaryotes
(26). However, different PTS proteins are involved, and
they function by entirely different mechanisms in the various organisms
(34). In gram-positive bacteria, glucose represses
synthesis of PTS and non-PTS carbohydrate catabolic enzymes (catabolite
repression), inhibits the uptake of PTS and non-PTS sugars (inducer
exclusion), and stimulates dephosphorylation of intracellular sugar
phosphates and/or elicits efflux of free sugars (inducer expulsion)
(35, 40). A principal role of a metabolite-activated
ATP-dependent protein kinase which phosphorylates seryl residue 46 (Ser-46) in HPr in the regulation of enzyme synthesis, inducer
exclusion, and inducer expulsion via an allosteric mechanism that acts
on several different target proteins has been suggested (4, 5,
30, 34, 36, 44).
Homofermentative lactic acid bacteria transport most sugars via the
PTS. In contrast, heterofermentative lactobacilli such as
Lactobacillus brevis transport glucose and galactose as well as their nonmetabolizable analogues 2-deoxyglucose and
thiomethyl- When right-side-out vesicles of L. brevis were loaded with
free [14C]TMG and electroporated with purified HPr of
Bacillus subtilis, rapid efflux of the galactoside was
observed upon addition of glucose (44). Glucose could be
replaced by any one of several glycolytic phosphorylated metabolites,
such as fructose 1,6-bisphosphate, gluconate-6-phosphate, and
2-phosphoglycerate, when the compounds were electroporated into the
vesicles. Allosteric activating effects of these compounds on the
HPr(Ser) kinase in vitro were also observed (30). In the
absence of glucose or phosphorylated metabolites, intravesicular
HPr(S46D), a structural analogue of the seryl-phosphorylated form of
HPr, promoted expulsion of accumulated free [14C]TMG.
The noncharged HPr analogue HPr(S46A) did not promote expulsion of the
accumulated galactoside, clearly implying a critical role for
phosphorylation of HPr at Ser-46 by the HPr(Ser) kinase in inducer
expulsion. In addition, uptake of lactose, glucose, mannose, and ribose
was inhibited by wild-type HPr in the presence of fructose 1,6-bisphosphate or by HPr(S46D) alone, indicating that the
metabolite-activated, ATP-dependent HPr(Ser) kinase regulates sugar
permeases in L. brevis by a feedback-controlled process.
Direct binding of 125I-labeled HPr(S46D) to L. brevis membranes containing high levels of the galactose permease
and inhibition of the binding by nonradioactive HPr(S46D) were
demonstrated (45).
Based on the extensive biochemical evidence summarized above, an
allosteric model was proposed for the observed vectorial sugar
expulsion in L. brevis (Fig.
1). To elucidate the details of the
molecular mechanism of this process in vivo and to eventually determine
the physiological significance of this process to growth and enzyme
induction via the control of inducer levels, we have cloned, sequenced,
and expressed the relevant L. brevis genes in B. subtilis. In this organism, which does not normally exhibit the
phenomenon of PTS-mediated inducer control, we could observe regulation
of the L. brevis GalP activity by mutant derivatives of the
L. brevis HPr. We have therefore reconstituted the
regulatory system in a bacterium that is readily amenable to genetic
manipulation. This system should allow detailed studies of the type
necessary to establish the mechanistic details of inducer control.
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.10.3224-3236.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Genes Involved in Control of Galactose Uptake in
Lactobacillus brevis and Reconstitution of the Regulatory
System in Bacillus subtilis
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-galactoside (TMG) by a permease-catalyzed sugar:H+ symport mechanism. Addition of glucose to L. brevis cells loaded with [14C]TMG promotes efflux
and prevents accumulation of the galactoside, probably by converting
the proton symporter into a uniporter. Such a process manifests itself
physiologically in phenomena termed inducer expulsion and exclusion.
Previous evidence suggested a direct allosteric mechanism whereby the
phosphocarrier protein, HPr, phosphorylated at serine-46
[HPr(Ser-P)], binds to the galactose:H+ symporter to
uncouple sugar transport from proton symport. To elucidate the
molecular mechanism of inducer control in L. brevis, we
have cloned the genes encoding the HPr(Ser) kinase, HPr, enzyme I, and
the galactose:H+ symporter. The sequences of these genes
were determined, and the relevant phylogenetic trees are presented.
Mutant HPr derivatives in which the regulatory serine was changed to
either alanine or aspartate were constructed. The cloned
galP gene was integrated into the chromosome of
Bacillus subtilis, and synthesis of the mutant HPr proteins
in this organism was shown to promote regulation of GalP, as expected
for a direct allosteric mechanism. We have thus reconstituted inducer
control in an organism that does not otherwise exhibit this phenomenon.
These results are consistent with the conclusion that inducer exclusion
and expulsion in L. brevis operates via a multicomponent
signal transduction mechanism wherein the presence of glycolytic
intermediates such as fructose 1,6-bisphosphate (the intracellular
effector), derived from exogenous glucose (the extracellular effector),
activates HPr(Ser) kinase (the sensor) to phosphorylate HPr on Ser-46
(the messenger), which binds to the galactose:H+ symporter
(the target), resulting in uncoupling of sugar transport from proton
symport (the response). This cascade allows bacteria to quickly respond
to changes in external sugar concentrations. Understanding the
molecular mechanism of inducer control advances our knowledge of the
link between metabolic and transport processes in bacteria.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-galactoside (TMG), respectively, by active transport
energized by the proton motive force (33). Previous
biochemical studies have shown that L. brevis possesses a
galactose:H+ symport permease, here designated GalP, which
transports and accumulates cytoplasmic TMG. An ATP-dependent HPr(Ser)
kinase was also identified, and evidence was presented suggesting that it participates in GalP regulation. A complex mechanism was proposed that led to metabolite-activated vectorial sugar exclusion and expulsion (30, 44). When provided with an exogenous energy source such as arginine, galactose-grown cells of L. brevis
were shown to transport [14C]TMG and accumulate the free
sugar analogue in the cytoplasm to a concentration at least 20-fold
higher than that in the medium. However, addition of exogenous glucose,
gluconate, or glucosamine to cells loaded with [14C]TMG
resulted in efflux of the intracellular galactoside, giving rise to a
reduced cytoplasmic concentration of the sugar. Counterflow experiments
suggested that metabolism of glucose by intact L. brevis
cells results in conversion of the active sugar:H+
transporter (symporter) into a facilitated diffusion system (uniporter [33]).

View larger version (22K):
[in a new window]
FIG. 1.
Proposed model for PTS-mediated regulation of vectorial
sugar expulsion in L. brevis. Inducer expulsion in L. brevis is envisioned as a multicomponent signal transduction
process. The galactose:H+ symporter GalP cotransports sugar
and H+. H+ cotransport allows coupling of
galactose uptake to the proton motive force. Upon addition of glucose
(the extracellular effector), accumulation of glycolytic intermediates
such as fructose 1,6-bisphosphate (FBP), gluconate-6-phosphate (Gnt
6-P), and 2-phosphoglycerate (2-PG) (the intracellular effectors)
activate HPr(Ser) kinase (the sensor) to phosphorylate HPr on Ser-46
(the messenger), which binds to GalP (the target), resulting in
uncoupling of sugar transport from H+ symport (the
response). Consequently, the permease is converted from an active
symporter to a facilitative diffusion uniporter that can no longer
accumulate sugar substrates against a concentration gradient (inducer
exclusion-expulsion).
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Bacterial strains and plasmids. The strains used in this study were L. brevis ATCC 367, B. subtilis M168 (wild type), its isogenic ptsK mutant (32), Escherichia coli TOP10F' (Invitrogen), E. coli XL10Gold, and E. coli TG1 (Stratagene). Growth conditions and media used to propagate the strains are described in the relevant sections. The plasmids used in this study were pCR2.1 (Invitrogen), PCRScript (Stratagene), pLA6 (6), pER82 (K. Pogliano, University of California at San Diego [UCSD]), pAG58 (15), and pMK4 (41). pCR2.1 and pCRScript were used for subcloning in E. coli. The pLA6, pAG58, and pMK4 plasmids were used for construction of expression vectors harboring L. brevis galP, wild-type HPr, HPr(S46A), and HPr(S46D). The pER82 plasmid was used to integrate L. brevis galP into the B. subtilis chromosome.
Cloning of the ptsK gene encoding the HPr(Ser) kinase from L. brevis. To clone the HPr(Ser) kinase from L. brevis, we designed degenerate oligonucleotide primers based on the available multiple sequence alignment for PtsK proteins (32). Two of the primers, corresponding to the conserved amino acyl sequences HGVLV(l,m)D(e)V(i)Y(f)G (forward primer, alignment positions 143 to 151 [32]) and EI(v)RGL(v)GIIN (reverse primer, alignment positions 208 to 216) were used in a PCR (capital letters are conserved and lowercase letters are less well conserved residues). The actual sequences of the degenerate oligonucleotides were 5'CAiGGiGTiiTiiTiGAiiTiTAiGG3' (forward, where i is inosine) and 5'TTDATDATiCCiAViCCiCKiAYYTC3' (reverse, where D is T, A, or G; V is A, G, or C; K is G or T; and Y is C or T). A PCR DNA product of 217 bp was amplified from L. brevis ATCC 367 chromosomal DNA by Taq polymerase (Roche Molecular Biochemicals) under the following reaction conditions: denaturation of the template (8 min at 94°C), followed by 40 cycles of 1 min at 94°C (denaturation), 1 min at 32°C (annealing), 2 min at 72°C (extension), and 1 final cycle of 10 min at 72°C. The amplified product was subsequently cloned using the TA cloning kit (vector pCR2.1; Invitrogen). The 217-bp PCR product was sequenced, and high similarity to the corresponding region present in several ptsK genes (32) was detected.
The 217-bp DNA fragment was nonradioactively labeled with digoxigenin (DIG; High Prime DNA labeling system, Roche Molecular Biochemicals) and used as a probe in Southern hybridization against L. brevis chromosomal DNA fragments obtained by restriction with multiple enzyme combinations. A positive hybridization signal corresponded to the PvuII-SspI DNA fragment (approx. 2.9 kb). The mixture of DNA bands corresponding to the positive hybridization signal was cut from the gel, purified (gel extraction kit, Qiagen), and cloned into plasmid pUC18 digested with SmaI and dephosphorylated (shrimp alkaline phosphatase; USB). The ligation mixture was transformed into E. coli TOP10F' (Invitrogen). Transformants were recovered, and individual colonies were inoculated into the wells of microtiter plates with Luria-Bertani (LB) broth (0.2 ml) and ampicillin (50 µg/ml). Following overnight growth, 0.1-ml aliquots of culture from 10 wells were pooled, and DNA was isolated (Spin kit 50; Qiagen). Pools that contained the cloned L. brevis ptsK gene gave positive signals in Southern hybridization and were further refined (individual DNA minipreps) to detect cultures containing the cloned gene. Of approximately 1,000 individual colonies that were screened, 2 contained the L. brevis ptsK gene cloned into pUC18. Sequencing of one of the clones, designated pK3, revealed that the ptsK gene was cloned on a 2,832-bp DNA fragment.Cloning of the galP gene encoding the galactose permease of L. brevis. To clone the gene encoding the galactose permease (GalP) of L. brevis, we designed several degenerate oligonucleotide primers based on the multiple sequence alignment of representative members of the LacS subfamily of the galactoside-pentoside-hexuronide (GPH) family of sugar transporters (25, 39). Two of the primers, 5'AAYGAYCARYTiHiTgg3' (forward, where R is A or G and H is A, T, or C) and 5'TTCMRYTgiCCRTAYTCiAY3' (reverse, where M is C or A), corresponding to the conserved amino acid regions NDQLM(l)W and V(i)EYGQW(l)K, respectively, were used in PCRs with L. brevis ATCC 367 chromosomal DNA (template) and Taq polymerase (Roche Molecular Biochemicals). The PCR product, a DNA fragment of 377 bp, was obtained under the following reaction conditions: one cycle of 8 min at 94°C, followed by 30 cycles of 1 min at 94°C (denaturation), 1 min at 37°C (annealing), 2 min at 72°C (extension), and one final cycle of 10 min at 72°C. The 377-bp DNA fragment was cloned into the pCR2.1 vector (Invitrogen) and sequenced. Sequence determination revealed similarity to internal genomic regions of several sugar permeases of the LacS subfamily. The 377-bp fragment was nonradioactively labeled with DIG and used as a probe in Southern hybridization against L. brevis chromosomal DNA digested with several restriction enzyme combinations. A strong hybridization signal corresponding to a 4.5-kb PvuII DNA fragment was detected. The mixture of DNA bands coinciding in size to this positive signal was isolated, and an attempt was made to clone it into the pUC18 vector. We had used this procedure previously to clone the L. brevis ptsK gene. Several cloning efforts were conducted with no success. Only deleterious or rearranged plasmids were recovered in the E. coli host. As an alternative, a mixture of PvuII DNA fragments corresponding to a positive hybridization signal was recovered from an agarose gel and digested with several restriction enzymes, including HindII, HpaI, DraI, FspI, and StuI. Following restriction, blunt-ended DNA fragments were self-ligated and used as templates in the inverse PCRs. PCR primers were designed based on the DNA sequence of the 377-bp fragment used as a probe in hybridization. The DNA sequences of the two primers were 5'CCAAGACTGGGAACAGAGGAACCG3' (forward) and 5'CGTAAAGGTATCTACGTTGGCGG3' (reverse). Pwo DNA polymerase (Roche Molecular Biochemicals) was used in the PCR with an initial denaturation (10 min at 94°C), 30 cycles of denaturation (1 min at 94°C), annealing (1 min at 50°C), extension (3 min at 72°C), and one cycle of final extension (10 min at 72°C). Initial rounds of inverse PCR amplified an HpaI DNA fragment of about 1.2 kb. This fragment was subcloned in the pCRScript vector (Stratagene). The DNA sequence was determined (1,197 bp), and it was used to design primers for the next round of inverse PCRs (nested PCRs). The DNA sequences of the two primers were 5'CATTCCGCACCCATTCTTCC3' (forward) and 5'CGTCACCTTAGCGGTTCGTCC3' (reverse). The 4.5-kb PvuII fragment mixture was then cut with EaeI; fragments were self-ligated, and inverse PCR was performed as described above. An additional 650 bp of new DNA sequence was determined, assembled with the previously determined 1,197-bp fragment, and used to design a new set of PCR primers to further extend the sequence. The DNA sequences of the new PCR primers were 5'GATAACAACAACCATTGTGATAACG3' (forward) and 5'GCGTTTGATCCGATGATTGGTGGG3' (reverse). For this purpose, L. brevis chromosomal DNA was digested with EcoRV, self-ligated, and used as a template for the inverse PCR. Finally, this approach led to subcloning of a 2,062-bp DNA fragment which encoded the complete galP gene.
Cloning and sequence of the ptsHI operon encoding HPr and EI of the PTS of L. brevis. To clone the genes encoding HPr and enzyme I (EI), we designed several degenerate oligonucleotide primers based on multiple alignments of HPrs and EIs identified in several gram-positive and gram-negative bacteria. Two sets of primers, corresponding to the four conserved amino acid regions, were derived. The first set of primers, 5'GGiATHCAYGCiMGiCCiGCiAC3' (forward) and 5'CCiARiSWCTAiACiCCCTADAT3' (reverse, where S is G or C and W is A or T), corresponded to the amino acid regions GIHARPAT and IMGVMSLG, respectively. The second set of primers, 5'AARGARGTiGAYTTYTT3' (forward) and 5'CATiSWRAAYTCRTC3' (reverse), corresponded to the amino acid regions KEVDFF and DEFSM, respectively. These primers were used in PCRs with L. brevis chromosomal DNA (template) and Taq polymerase (Roche Molecular Biochemicals) to amplify DNA fragments corresponding to internal regions of genes coding for HPr (ptsH) and EI (ptsI), respectively. The PCR product corresponding to an internal region (129 bp) of the L. brevis ptsH gene was amplified under the following reaction conditions: one cycle of 8 min at 94°C, followed by 30 cycles of 1 min at 94°C (denaturation), 1 min at 42°C (annealing), 1 min at 72°C (extension), and one final cycle of 10 min at 72°C. The amplified product was cloned into the pCR2.1 vector (Invitrogen) and sequenced. The 129-bp fragment was nonradioactively labeled and used as a probe in Southern hybridization against L. brevis chromosomal DNA restricted with several enzymes, including StyI and SspI. DNA fragments giving positive hybridization signals were recovered from the agarose gel, self-ligated, and used as templates in inverse PCRs. PCR primers were designed based on the DNA sequence of the 129-bp fragment used as a probe for hybridization. The DNA sequences of the two primers were 5'AGCAGCCTGTACTAATAACG3' (forward) and 5'CAGAAGTTAGCTTGCAATACC3' (reverse). Pwo DNA polymerase (Roche Molecular Biochemicals) was used in the PCR where conditions were initial denaturation (10 min at 94°C), 30 cycles of denaturation (1 min at 94°C), annealing (1 min at 45°C), extension (2 min at 72°C), and one cycle of final extension (10 min at 72°C). An initial round of inverse PCR amplified a StyI DNA fragment of about 2 kb. This fragment was subcloned in the pCRScript vector (Stratagene), and the DNA sequence (1,877 bp) was determined. The entire ptsH gene was encoded on the 1,877-bp DNA fragment and could be directly amplified from L. brevis chromosomal DNA using PCR primers 5'TGTAGAGGTGAATGGTTGC3' (forward) and 5'CTCATTAGTCAGATAAACCC3' (reverse). To determine the complete sequence of ptsI, L. brevis genomic DNA was digested with XhoII and RcaI, self-ligated, and used as template in a set of two inverse PCRs with 5'TGACACTCCCTGTTGTCC3' (forward for XhoII), 5'GTGAACCCACTGCTGCG3' (reverse for XhoII), 5'TACGGCTGATAGAGATAGGC3' (forward for RcaI), and 5'AGTGGATCGCATCGTTCGC3' (reverse for RcaI). This approach led to subcloning of a 3,214-bp DNA fragment encoding the complete ptsH-ptsI operon.
Site-directed mutagenesis of L. brevis ptsH gene encoding HPr. To create two site-directed mutants of L. brevis HPr, HPr(S46A), expected to mimic the unphosphorylated form of HPr, and HPr(S46D), expected to mimic the seryl-phosphorylated form of HPr, the experimental method described before (18) was employed. A two-step PCR approach resulted in replacement of serine residue 46 (S46) in the wild-type L. brevis HPr with either alanine (S46A) or aspartate (S46D). Three oligonucleotide primers were designed: 5'TGAAGTGCTATCATGGGCGTTATGTCATTAGG3' (forward, for the S46A mutant, with G replacing T in the wild-type HPr), 5'TGAAGTGATATCATGGGCGTTATGTCATTAGG3' (forward, for the S46D mutant, with GA replacing TC in the wild-type HPr), and 5'CTCTCATTAGTCAGATAAACCC3' (reverse primer). In the first round of PCRs, two forward primers were combined with a reverse primer in a reaction in which the L. brevis wild-type HPr served as a template. Taq DNA polymerase (Roche Molecular Biochemicals) was used, and reaction conditions were as follows: one cycle of initial denaturation (8 min, 94°C), 30 cycles of denaturation (1 min, 94°C), annealing (1 min, 43°C), and extension (1 min, 72°C), and one cycle of final extension (10 min, 72°C). A unique 130-bp PCR product was amplified in each reaction, purified, and used as a primer in a second round of PCRs with the reverse primer described above. Similar reaction conditions were used as for the first round of PCRs except that annealing was done at 50°C. Amplified PCR products were cloned into the pCRScript vector (Stratagene). Replacement of the serine residue at position 46 in wild-type HPr by either alanine (S46A) or aspartate (S46D) was confirmed by DNA sequencing.
Chromosomal introduction of L. brevis galP gene in B. subtilis. The L. brevis galP gene was amplified by PCR using the Pwo polymerase and L. brevis chromosomal DNA as the template. To express galP in B. subtilis, this gene was fused to a consensus B. subtilis Shine-Dalgarno (SD) sequence in a two-step PCR. Two different forward PCR primers were used, one for each reaction, together with a unique reverse PCR primer. The DNA sequences of the two forward primers were 5'TAGGAGGAGATAAAAATGGTTAAGCAATATTTATCATACGC C3' (SD sequence in bold and 5' end of galP underlined) and 5'AAAACTGCAGTTAGGAGGAGATAAAAATGGTTAAGC3' (PstI restriction site in italics). The sequence of the reverse primer was 5'AAAATCGCGACATCATAGTCGCTTTATGCGACCG3' (NruI restriction site in italics). The PstI-NruI-amplified galP gene was fused to shuttle promoter P6 (6) encoded on plasmid pLA6 restricted with Cfr10I (blunted) and PstI. P6 is a constitutive promoter functional in E. coli, B. subtilis, and numerous lactic acid bacteria (7). The P6/galP recombinant cassette was subcloned into the B. subtilis integration vector pER82 (kindly provided to us by K. Pogliano, UCSD). The P6/galP cassette was cloned into the amylase (amyE) gene on pER82 (restricted with BamHI and EcoRI [blunted]) next to the kanamycin resistance marker. Plasmid pEXP was assembled, propagated, linearized (PvuII), and transformed into B. subtilis M168 (wild type), and the isogenic strain bearing the inactivated gene encoding HPr(Ser) kinase (ptsK, Emr [32]). Following transformation, this cassette was integrated into the chromosome in the two isogenic bacteria via homologous recombination involving the amyE gene present on pEXP and a nonessential amyE gene product on the B. subtilis chromosome. Selection for kanamycin resistance (in wild-type B. subtilis) and for kanamycin and erythromycin resistance (in the B. subtilis ptsK mutant) resulted in the recovery of transformants containing the P6/L. brevis galP cassette integrated into the B. subtilis chromosome in both isogenic strains. The presence of the P6/galP cassette on the B. subtilis chromosome in both strains was confirmed by PCR.
Expression of L. brevis genes encoding HPr, HPr(S46A), and HPr(S46D) in B. subtilis. To express L. brevis HPr (wild type), HPr(S46A), and HPr(S46D) in B. subtilis, L. brevis chromosomal DNA and the two previously constructed plasmids encoding HPr(S46A) and HPr(S46D) were used as templates in the two-step PCR. The three genes were simultaneously amplified by PCR and combined with the B. subtilis consensus SD sequence. Two different forward PCR primers were used, one in each reaction, combined with the unique reverse PCR primer. DNA sequences for the two forward primers were 5'AAGGAGGAGATCAATTATGGAAAAACGC3' (SD sequence in bold and 5' end of galP underlined) and 5'ATATGTCGACAAGGAGGAGATCAATTATGG3' (SalI restriction site in italics). The sequence of the reverse primer was 5'ATATGGATCCCTCATTAGTCAGATAAACCC3' (BamHI restriction site in italics). The SalI/-BamHI-amplified HPr (wild type) and the two mutant derivatives (S46A and S46D) were fused to the B. subtilis promoter Pspac present on plasmid pAG58 (15). The three HPr variants, each combined with Pspac, were further subcloned (as EcoRI-BamHI DNA fragments) into the E. coli-B. subtilis shuttle vector pMK4, which encodes the chloramphenicol resistance marker (41). Recombinant plasmids were originally recovered in E. coli XL10Gold (Stratagene) and propagated in E. coli TG1 (recA+; Stratagene). Plasmid DNA was transformed in B. subtilis M168 (wild type) and the M168 ptsK mutant, both harboring the P6/galP cassette encoding the L. brevis galactose permease integrated into the B. subtilis chromosome. B. subtilis was transformed using its natural competence system. The presence of the recombinant plasmids encoding L. brevis wild-type HPr, HPr(S46A), or HPr(S46D) was confirmed by restriction analysis and by PCR.
[3H]TMG uptake and accumulation in L. brevis. L. brevis cultures were grown for 16 h at 30°C in complex medium (MRS) supplemented with 1% galactose. Cells were harvested in midlogarithmic phase and washed twice before resuspension in 50 mM Tris maleate-5 mM MgCl2 (TM) buffer (pH 7.0) to a cell density of 2 mg/ml (dry weight). The [3H]TMG (final concentration, 0.1 mM; 50 mCi/mmol), the energy source (20 mM arginine), and sugar (20 mM glucose) were added to a 0.5-ml cell suspension at the times indicated in the legend to Fig. 7. Transport assays were conducted at 30°C. Samples (0.1 ml) were removed at appropriate times, filtered (25-mm membrane filters, 45-µm pore size), washed three times with cold TM buffer, dried, and then transferred to vials containing 5 ml of scintillation fluid for determination of radioactivity. Values reported represent the averages of three independent assays.
[3H]TMG and [14C]glucose uptake and
accumulation in B. subtilis.
The B. subtilis wild-type and ptsK mutant cultures harboring
the L. brevis galP gene expressed from the constitutive
promoter P6 were grown for 16 h at 30°C in complex medium (LB)
with 1% glucose or 1% gluconate to midlogarithmic phase. Cells were
washed twice and resuspended in 50 mM Tris maleate-5 mM
MgCl2 buffer (pH 7.0) at a cell density of 1 mg/ml (dry
weight). The energy source (20 mM arginine), the sugar (glucose or
gluconate, each at 10 mM), and [3H]TMG (final
concentration, 20 µM; 50 mCi/mmol) were added to a 0.1-ml cell
suspension at
2,
1, and 0 min, respectively. Transport assays were
conducted at 30°C. Samples (0.02 ml) were removed at appropriate
times, filtered (25-mm membrane filters, 45-µm pore size), washed
three times in cold TM buffer, dried, and then transferred to vials
containing 5 ml of scintillation fluid for determination of
radioactivity. Values reported represent the averages of three
independent assays. Uptake of [14C]glucose was conducted
using the conditions described in the legend to Fig. 9.
Computer methods. To determine the relatedness of L. brevis proteins to their protein homologues from other gram-positive and gram-negative bacteria, multiple sequence alignments and phylogenetic trees were generated with both the TREE program (9) and the ClustalX program (12).
Nucleotide sequence accession numbers. The nucleotide sequence data reported in this paper were submitted to the GenBank nucleotide sequence database under accession numbers AF343443 (ptsK), AF343444 (ptsHI), and AF343445 (galP).
| |
RESULTS |
|---|
|
|
|---|
PtsK of L. brevis.
ptsK genes encoding
HPr(Ser) kinases from B. subtilis (10,
32), Enterococcus faecalis (17),
Streptococcus salivarius (2),
Staphylococcus xylosus (14), and
Lactobacillus casei (8) have been cloned. The
ptsK gene of L. brevis was cloned and sequenced
as described under Materials and Methods. A total of about 2.8 kb of
L. brevis DNA was sequenced with the ptsK gene centrally located in this fragment. The gene encodes a protein of 312 amino acyl residues, with a calculated isoelectric point (pI) of 5.62 and molecular mass of 34.4 kDa. A total of 583 bp of DNA upstream of
ptsK were sequenced, but no upstream open reading frame
(ORF) within this region was detected. Instead, we identified: a
typical putative
35,
10 promoter sequence for gram-positive bacteria and a consensus ribosome-binding site 6 bp upstream of the
structural gene. The 1,314 bp of sequence downstream of ptsK were also determined. A second ORF encoding prolipoprotein
diacylglyceryl transferase (functionally characterized homologue in
Staphylococcus aureus, accession no. spP52282) was
identified. This gene is homologous to the second gene in the
ptsK operon of B. subtilis
(32). The significance of the apposition of the two genes
in these two evolutionarily divergent gram-positive bacterial species
is not known.
|
ptsHI operon of L. brevis. Early biochemical evidence suggested that L. brevis possesses one of the two general PTS proteins, HPr, but that EI was missing in this organism (30). However, anaerobic growth of L. brevis in the presence of fructose resulted in the induction of a complete fructose-specific PTS (37). The ptsHI operon encoding HPr and EI was cloned as described under Materials and Methods. A DNA fragment of 3,214 bp was sequenced. This clone includes the complete ptsH and ptsI genes as well as 946 bp upstream and 263 bp downstream of the operon. The ptsH gene encodes a protein of 89 amino acyl residues (HPr), with a calculated pI of 4.7 and mass of 9.5 kDa. The ptsI gene is located immediately downstream to ptsH and encodes a protein of 576 residues, with a calculated pI of 5.4 and mass of 62.3 kDa. A putative promoter was identified upstream of ptsH. Putative ribosome-binding sites were identified 11 nucleotides in front of the ATG start codon of ptsH and 2 nucleotides in front of ptsI. A putative terminator downstream of ptsI was also identified. A truncated homologue of the Lactobacillus sake and Lactobacillus lactis clpE genes encoding a putative ATP-dependent protease was found upstream of ptsH. The L. brevis clpE gene proved to be transcribed in the opposite direction with respect to ptsHI.
The phylogenetic tree for several HPr proteins is shown in Fig. 3. The L. brevis protein clusters in the order indicated with the homologues from species of Lactobacillus > Enterococcus > Lactococcus > Streptococcus, as expected.
|
|
-strand 3 and
-helix 2 in the open-faced sandwich structure of
HPr. They also comprise the part of the protein that undergoes the
largest conformational change in response to serine-46 phosphorylation
(28). Phosphorylation of this residue causes helix 2 to
extend in length, thereby decreasing the amount of random coil
structure comprising in part the connecting loop.
The other residues conserved in HPrs of gram-positive bacteria but not
in E. coli HPr are scattered, with six residues dispersed in
the region near His15 to the left of the Ser46
conserved loop and three to the far right of this loop. It seems likely
that the primary HPr site of interaction with PtsK (and possibly with GalP) is the region surrounding Ser46. These residues are
reasonable candidates for mutagenesis.
GalP of L. brevis. Although operons including genes for the transport and utilization of galactose via the Leloir pathway have been identified in several lactic acid bacteria (11), only two non-PTS galactose or galactoside permeases were identified, a galactose permease of Lactococcus lactis MG1363 (B. Grossiord, E. Vaughan, E. Luesink, and W. M. de Vos, Proc. 5th Symp. Lactic Acid Bacteria, 1996, abstr. H48) and a putative lactose permease of L. lactis ATCC 7962 (19). In this report we describe cloning of the L. brevis galP gene, encoding a protein of 475 amino acyl residues. The galP gene is followed by a galactokinase (galK) gene on the L. brevis chromosome. The calculated pI and mass of the GalP protein are 9.1 and 51.8 kDa, respectively. GalP is a member of the GPH family (TC 2.A.2 [39]). In contrast to the homologues from Streptococcus thermophilus, Lactobacillus bulgaricus, and Leuconostoc lactis, there is no IIAGlc-like domain C-terminal to the permease domain in L. brevis GalP. This fact immediately suggests (in accordance with the published results) that the L. brevis GalP permease is regulated by a mechanism that is distinct from that which has been reported for the lactose permeases of S. thermophilus and Leuconostoc lactis (22-24, 42).
The multiple alignment of the L. brevis GalP protein with four related galactose and galactoside permeases is shown in Fig. 5. The deduced protein sequence of L. brevis GalP reveals strong similarity of this protein to the galactose permease of Lactococcus lactis and lactose permeases of S. thermophilus and Leuconostoc lactis (45 to 50% identity and 65 to 68% similarity for all four proteins). Fully conserved residues among the five proteins presented in the multiple alignment in Fig. 5 are shaded. Particularly worthy of note are the fully conserved GKFKPW and NDQL motifs in the first half of the protein between transmembrane segments (TMSs) 2 and 3 and in the central loop between TMSs 6 and 7, respectively. The former motif corresponds in position to the well-conserved motifs found between TMSs 2 and 3 in major facilitator superfamily (MFS) permeases (20). The GPH family is believed to be distantly related to the MFS (38). Several fully conserved residues were identified previously among lactic acid bacterial members of the GPH family (42), including E-67 and D-71 (numbers correspond to residues in the S. thermophilus LacS protein) and the conserved motif K-X-X-H-X-X-E, required for lactose and H+ symport. In L. brevis GalP, D-69 in TMS 2 corresponds to the conserved D-71 in TMS2 in the S. thermophilus LacS protein. No conserved residue corresponding to the E-67 in LacS could be identified in GalP. The conserved K-X-X-V-X-X-E motif, characteristic of members of the GPH family, was identified in the region between TMS 10 and TMS 11 in L. brevis GalP (the conserved H in this motif is replaced by V in GalP). The multiple alignment shown in Fig. 5 reveals that the C termini of the L. brevis and Lactococcus lactis GalP proteins are strongly hydrophilic, with 11 of 23 and 11 of 16 charged residues in equivalent regions of the two proteins, respectively. These regions correspond to the hydrophilic Q linkers in the S. thermophilus, L. bulgaricus, and Leuconostoc lactis proteins, which connect the permease domain to the regulatory IIAGlc-like domain.
|
|
Confirmation of inducer expulsion phenomenon in L. brevis.
In the presence of 20 mM arginine, addition of
glucose to cells preloaded with [3H]TMG resulted in a
transient increase in the rate of galactoside uptake, followed by rapid
expulsion (Fig. 7). A similar phenomenon was observed when glucose was used as the energy source (added 1 min
before the addition of [3H]TMG) or when arginine
served as the initial energy source for TMG uptake and glucose was
added 15 min after the addition of [3H]TMG (Fig. 7).
According to the proposed model of inducer expulsion in L. brevis, the initial metabolism of glucose energizes active transport of TMG, but its continued metabolism, which results in the
accumulation of fructose 1,6-bisphosphate, activates the HPr(Ser)
kinase, phosphorylates HPr, and converts the GalP:H+
symporter into a facilitative, fully or partially uncoupled uniporter. Rapid efflux of the free sugar results.
|
Regulation of L. brevis GalP expressed in B. subtilis. B. subtilis encodes HPr and HPr(Ser) kinase but does not exhibit the phenomena of inducer expulsion and inducer exclusion. To study the role of GalP in inducer expulsion, we integrated the L. brevis galP gene into the genome of B. subtilis, an organism that lacks the capacity to take up TMG. The galP gene was fused to a constitutive shuttle promoter (the P6/galP cassette) and expressed in both wild-type B. subtilis and the ptsK mutant strain.
The nucleotide sequences of the P6 promoter and of L. brevis galP were examined for the presence of putative catabolite-reponsive element sites. No such sequence was found, suggesting that the P6/galP cassette cannot be subject to catabolite repression by the PTS-dependent mechanism. Plasmids encoding L. brevis wild-type HPr, HPr(S46A), and HPr(S46D) were introduced in the two B. subtilis strains. In this readily manipulatable organism, it was possible to study GalP regulation by mutant derivatives of L. brevis HPr. Although the B. subtilis genome includes a gene that is homologous to the L. brevis galP, we found that the capacity to take up TMG was lacking under the conditions of our assay. In the absence of the L. brevis galP gene, B. subtilis took up less then 0.05 nmol of [3H]TMG per mg (dry weight) of cells grown in LB supplemented with the appropriate carbohydrate (glucose or gluconate) and provided with an energy source, such as arginine plus glucose or gluconate. In the presence of the expressed L. brevis galP gene integrated into the B. subtilis chromosome, galactoside transport increased over 50-fold in both the B. subtilis wild-type strain and the ptsK mutant when arginine (20 mM) and either glucose or gluconate (10 mM) were added to cells at 2 min and 1 min, respectively, before the addition of [3H]TMG (0 min). However, in contrast to what was observed when the experiment was conducted in L. brevis, sugar efflux from B. subtilis did not follow the initial increase in sugar uptake (Fig. 8A and B). When the same assay was conducted with a B. subtilis wild-type or ptsK mutant strain expressing the P6/galP cassette and bearing the plasmid-encoded L. brevis wild-type HPr, HPr(S46A), or HPr(S46D), strong inhibition of [3H]TMG uptake was observed in the presence of HPr(S46D) relative to that observed when HPr or HPr(S46A) was present (Fig. 8A and B). The same pattern of inhibition of [3H]TMG uptake by L. brevis HPr(S46D) in wild-type B. subtilis and in the ptsK mutant was observed when the two strains were grown in the presence of either glucose or gluconate (data not shown). HPr(S46D) did not inhibit uptake of [14C]glucose under the same conditions (Fig. 9A and B). Inhibition of TMG uptake therefore could not be explained by a decrease in energy availability. Because HPr(S46D) resembles the phosphorylated form of HPr (31), these results confirm our earlier suggestion that GalP is subject to direct allosteric regulation by HPr(Ser). Although we could not demonstrate inducer expulsion in B. subtilis, we demonstrated for the first time in vivo inducer exclusion in this bacterium.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
The work reported in this communication sets the stage for detailed molecular genetic, biochemical, and biophysical experiments aimed at understanding in molecular detail the mechanism of inducer exclusion and expulsion in L. brevis. All of the genes which are known to be directly involved in this novel type of regulation (ptsK, ptsH, and galP) as well as one that may prove to be indirectly involved (ptsI) have now been cloned. Moreover, the essence of the regulatory system has been reconstituted in B. subtilis, an organism that does not normally exhibit the phenomenon of PTS-mediated inducer control. Thus, not only are the requisite genes available for study, but two distinct systems, the native L. brevis system and the reconstituted B. subtilis model system, can be exploited.
Availability of the L. brevis genes opens the door to several experimental approaches. These genes can be knocked out on the L. brevis chromosome to determine the physiological consequences to the cell of the presence of their gene products. The complete regulatory system [including the L. brevis HPr(Ser) kinase] can be reconstituted in B. subtilis to establish that these proteins comprise the entire regulatory cascade. We anticipate that it will also be possible to reconstitute the system in E. coli, an organism that lacks PtsK altogether. All of the plasmids constructed for expression in B. subtilis should be suitable for studies in E. coli, and mutants with pts gene deletions are available.
The cloned L. brevis ptsK gene will allow us to overproduce PtsK for in vitro biochemical analyses. To date, five HPr(Ser) kinases, those from B. subtilis, E. faecalis, S. salivarius, S. xylosus, and L. casei, have been purified and partially characterized. However, extensive evidence suggests that different kinases exhibit very different properties (2, 8, 10, 13, 14, 17, 32). Analyses of the cloned ptsK gene reported in this communication have provided revealing information that explains some earlier observations. For example, the great degree of sequence divergence between the PtsK proteins of B. subtilis and L. brevis (as well as the HPr proteins of these two organisms [Fig. 2 and 3]) explains the exceptionally poor enzymatic cross-reactivity between these proteins, as reported previously (30, 32) and confirmed here. Moreover, the phylogenetic trees shown in Fig. 2 and 3 are fully consistent with the interpretation that both PtsK and PtsH are orthologues in the organisms represented in both trees (L. brevis, B. subtilis, E. faecalis, S. salivarius, Streptococcus bovis, Streptococcus mutans, Mycoplasma genitalium, and Treponema pallidum). As the completely sequenced genomes of B. subtilis, Mycoplasma genitalium, M. pneumoniae, E. faecalis, and Treponema pallidum reveal only a single ptsK gene and a single ptsH gene (excluding the crh gene in B. subtilis, which lacks catalytic activity), we predict that all of these PtsK homologues and all of the PtsH homologues in gram-positive bacteria and perhaps in many gram-negative bacteria as well (i.e., T. pallidum and Neisseria gonorrhoeae) will prove to have been present in the common ancestor. Such a prediction leads in turn to the suggestion that PtsK-mediated regulatory mechanisms may be very old, dating back to a time that predates the divergence of gram-positive bacteria from each other and possibly also before the time when gram-positive and gram-negative bacteria diverged.
It has been reported recently that phosphorylation of HPr by the HPr(Ser) kinase of L. casei controls catabolite repression and inducer exclusion but not inducer expulsion (8). Involvement of HPr kinase in inducer expulsion in L. brevis was extensively documented in vitro (44, 45). To date, we have not been able to inactivate the ptsK gene in L. brevis. Therefore, in vivo confirmation of the role of HPr(Ser) kinase in this organism is not presently possible.
Availability of the galP clone will allow its protein product to be overproduced for reconstitution studies in defined liposome preparations. Only when the regulatory system is reconstituted in such an artificial system with purified components will it be possible to establish unequivocally the protein constituents involved and the details of the signal transduction pathway. The multiple alignment of GalP with its homologues (Fig. 5) provides clear clues as to possible residues involved in HPr(Ser) binding. Mutagenic approaches with GalP should be useful for defining catalytic residues as well as those concerned with allosteric regulation of the activity of this protein. Since the topology of GalP is probably similar to that of the E. coli melibiose permease (1, 27), one can narrow down the possibilities for binding sites. As for the interaction sites established for the E. coli lactose, maltose and melibiose permeases with the regulatory IIAGlc protein of the PTS (see references 3 and 35 for reviews), the allosteric sites of interaction between GalP and HPr(Ser) must be in the N and C termini and/or in the cytoplasmic loops.
Published evidence suggests that the L. brevis galactose permease is regulated by a mechanism that is entirely different from the mechanism that controls lactose permease activities in L. bulgaricus, Leuconostoc lactis, and S. thermophilus (22-24, 34, 36). These three proteins all possess a C-terminal IIAGlc-like domain that influences permease activity. This domain is lacking in L. brevis, clearly pointing to a distinct type of regulation. However, the sequence similarity observed for the GalP proteins from L. brevis and Lactococcus lactis (Fig. 5 and 6) suggests (in the absence of direct experimental evidence) that these permeases may be regulated by a common mechanism.
We have constructed site-specific mutations in L. brevis HPr, altered at the regulatory phosphorylation site. However, mutations at other sites are likely to reveal the sites of interaction with PtsK and GalP. It has been reported recently that replacement of isoleucine at position 47 with threonine in HPr of L. casei results in a less pronounced lag phase during diauxic growth in a mixture of PTS sugars (glucose and lactose) and that carbon catabolite repression was completely abolished when the organism was grown in the presence of non-PTS sugars maltose and ribose (43). Replacement of methionine at position 48 with valine in Streptococcus salivarius has been reported to abolish diauxy by allowing the cells to catabolize non-PTS sugars in the presence of glucose (21). In addition, the growth rate of the S. salivarius M48V mutant on galactose decreased rapidly over time, while growth on another non-PTS sugar (lactose or melibiose) was not affected. Both Ile-47 and Met-48 are conserved in HPr of L. brevis, a heterofermentative bacterium which has been shown to possess fructose PTS-inducible activity under anaerobic conditions (37). It would be most interesting to examine whether replacement of either of the two conserved residues, Ile-47 or Met-48, interferes with catabolite repression in L. brevis, and especially whether the M48V substitution interferes with growth on galactose (which is transported by GalP). Corresponding mutagenic approaches with HPr and GalP should be useful for defining catalytic residues as well as those concerned with allosteric regulation of the activities of these two proteins.
The GalP protein of L. brevis is the first transporter known to be involved in inducer control to have its gene introduced into the B. subtilis chromosome. By introducing the L. brevis GalP and derivatives of L. brevis HPr into B. subtilis, we confirmed directly, for the first time, the role of phosphorylation of HPr at Ser-46 in inducer control. However, under the conditions described in this work, we could not demonstrate the inducer expulsion phenomenon in B. subtilis. The extent to which the L. brevis GalP mechanism of inducer control is pertinent to other permeases in L. brevis and to the numerous proton:sugar symporters in other bacteria is unknown. However, extensive evidence suggests that several permeases, including the glucose permease in L. brevis, are controlled by this HPr(Ser-P)-mediated allosteric mechanism (45, 46). We anticipate that this mechanism will prove to be widespread in low-G+C-content gram-positive bacteria.
| |
ACKNOWLEDGMENTS |
|---|
Work in the authors' laboratory was supported by NIH grant 9RO1 GM55434 from the National Institute of General Medical Sciences.
We thank R. Bruckner, Universität Tübingen, Tübingen, Germany, for helpful suggestions during the initial efforts to clone the HPr kinase gene of L. brevis. We are grateful to Milda Simonaitis, Donna Yun, and Monica Mistry for assistance in the preparation of the manuscript. Don Jack provided useful assistance with the computer analyses.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biology, University of California at San Diego, La Jolla, CA 92093-0116. Phone: (858) 534-4084. Fax: (858) 534-7108. E-mail: msaier{at}ucsd.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Botfield, M. C.,
K. Naguchi,
T. Tsuchiya, and T. H. Wilson.
1992.
Membrane topology of the melibiose carrier of Escherichia coli.
J. Biol. Chem.
267:1818-1822 |
| 2. |
Brochu, D., and C. Vadeboncoeur.
1999.
The HPr(Ser) kinase of Streptococcus salivarius: purification, properties, and cloning of the hprK gene.
J. Bacteriol.
181:709-717 |
| 3. |
Dean, D. A.,
J. Reizer,
H. Nikaido, and M. H. Saier, Jr.
1990.
Regulation of the maltose transport system of Escherichia coli by the glucose-specific enzyme III of the PTS: characterization of inducer exclusion-resistant mutants and reconstitution of inducer exclusion in proteoliposomes.
J. Biol. Chem.
265:21005-21010 |
| 4. |
Deutscher, J., and M. H. Saier, Jr.
1983.
ATP-dependent protein kinase-catalyzed phosphorylation of a seryl residue in HPr, the phosphoryl carrier protein of the phosphotransferase system in Streptococcus pyogenes.
Proc. Natl. Acad. Sci. USA
80:6790-6795 |
| 5. |
Deutscher, J.,
J. Reizer,
C. Fischer,
A. Galinier,
M. H. Saier, Jr., and M. Steinmetz.
1994.
Loss of protein kinase-catalyzed phosphorylation of HPr, a phosphocarrier protein of the phosphotransferase system, by mutation of the ptsH gene confers catabolite repression resistance to several catabolic genes of Bacillus subtilis.
J. Bacteriol.
176:3336-3344 |
| 6. | Djordjevic, G. M., B. Bojovic, N. Miladinov, and L. Topisirovic. 1997. Cloning and molecular analysis of promoter sequences from the chromosomal DNA of Lactobacillus acidophillus ATCC 4356. Can. J. Microbiol. 43:61-69[Medline]. |
| 7. | Djordjevic, G. M., and T. R. Klaenhammer. 1996. Positive selection cloning vectors for Gram-positive bacteria based on a restriction endonuclease cassette. Plasmid 35:37-45[CrossRef][Medline]. |
| 8. |
Dossonnet, V.,
V. Monedero,
M. Zagorec,
A. Galinier,
G. Perez-Martinez, and J. Deutscher.
2000.
Phosphorylation of HPr by the bifunctional HPr kinase/P-Ser-phosphatase from Lactobacillus casei controls catabolite repression and inducer exclusion but not inducer expulsion.
J. Bacteriol.
182:2582-2590 |
| 9. | Feng, D.-F., and R. F. Doolittle. 1990. Progressive alignment and phylogenetic tree construction of protein sequences. Methods Enzymol. 183:375-387[Medline]. |
| 10. |
Galinier, A.,
M. Kravanja,
R. Engelmann,
W. Hengstenberg,
M.-C. Kilhoffer,
J. Deutscher, and J. Haiech.
1998.
New protein kinase and protein phosphatase families mediate signal transduction in bacterial catabolite repression.
Proc. Natl. Acad. Sci. USA
95:1823-1828 |
| 11. | Grossiord, B., E. Vaughan, E. Luesink, and W. M. de Vos. 1998. Genetics of galactose utilization via the Leloir pathway in lactic acid bacteria. Lait 78:77-84[CrossRef]. |
| 12. | Heringa, J. 1999. Two strategies for sequence comparison: profile-preprocessed and secondary structure-induced multiple alignment. Comput. Chem. 23:341-364[CrossRef][Medline]. |
| 13. |
Hoischen, C.,
J. Reizer,
A. Dijkstra,
S. Rottem, and M. H. Saier, Jr.
1993.
Presence of protein constituents of the gram-positive bacterial phosphotransferase regulatory system in Acholeplasma laidlawii.
J. Bacteriol.
175:6599-6604 |
| 14. |
Huynh, P. L.,
I. Jankovic,
N. F. Schnell, and R. Bruckner.
2000.
Characterization of an HPr kinase mutant of Staphylococcus xylosus.
J. Bacteriol.
182:1895-1902 |
| 15. |
Jaacks, K. J.,
J. Healy,
R. Losick, and A. D. Grossman.
1989.
Identification and characterization of genes controlled by the sporulation-regulatory gene spo0H in Bacillus subtilis.
J. Bacteriol.
171:4121-4129 |
| 16. |
Koch, S.,
S. L. Sutrina,
L.-F. Wu,
J. Reizer,
K. Schnetz,
B. Rak, and M. H. Saier, Jr.
1996.
Identification of a site in the phosphocarrier protein, HPr, which influences its interactions with sugar permeases of the bacterial phosphotransferase system: kinetic analyses employing site directed mutants.
J. Bacteriol.
178:1126-1133 |
| 17. | Kravanja, M., R. Engelmann, V. Dossonnet, M. Bluggel, H. E. Meyer, R. Frank, A. Galinier, J. Deutscher, N. Schnell, and W. Hengstenberg. 1999. The hprK gene of Enterococcus faecalis encodes a novel bifunctional enzyme: the HPr kinase/phosphatase. Mol. Microbiol. 31:59-66[CrossRef][Medline]. |
| 18. |
Kuipers, O. P.,
H. J. Boot, and W. M. de Vos.
1991.
Improved site-directed mutagenesis method using PCR.
Nucleic Acids Res.
19:4558 |
| 19. |
Lee, J. M.,
D. K. Chung,
J. H. Park,
W. K. Lee,
H. C. Chang,
J. H. Kim, and H. J. Lee.
1997.
Cloning and nucleotide sequence of -galactosidase gene from Lactococcus lactis ssp. lactis ATCC 7962.
Biotechnol. Lett.
19:179-183[CrossRef].
|
| 20. |
Pao, S. S.,
I. T. Paulsen, and M. H. Saier, Jr.
1998.
The major facilitator superfamily.
Microbiol. Mol. Biol. Rev.
62:1-32 |
| 21. |
Plamondon, P.,
D. Brochu,
S. Thomas,
J. Fradette,
L. Gauthier,
K. Vaillancourt,
N. Buckley,
M. Frenette, and C. Vadeboncoeur.
1999.
Phenotypic consequences resulting from a methionine-to-valine substitution at position 48 in the HPr protein of Streptococcus salivarius.
J. Bacteriol.
181:6914-6921 |
| 22. |
Poolman, B.,
T. J. Royer,
S. E. Mainzer, and B. F. Schmidt.
1989.
Lactose transport system of Streptococcus thermophilus: a hybrid protein with homology to the melibiose carrier and enzyme III of phosphoenolpyruvate-dependent phosphotransferase systems.
J. Bacteriol.
171:244-253 |
| 23. |
Poolman, B.,
R. Modderman, and J. Reizer.
1992.
Lactose transport system of Streptococcus thermophilus.
J. Biol. Chem.
267:9150-9157 |
| 24. |
Poolman, B.,
J. Knol,
B. Mollet,
B. Nieuwenhuis, and G. Sulter.
1995.
Regulation of bacterial sugar-H+ symport by phosphoenolpyruvate-dependent enzyme I/HPr-mediated phosphorylation.
Proc. Natl. Acad. Sci. USA
92:778-782 |
| 25. | Poolman, B., J. Knol, C. van der Does, P. J. F. Henderson, W.-J. Liang, G. Leblanc, T. Pourcher, and I. Mus-Veteau. 1996. Cation and sugar selectivity determinants in a novel family of transport proteins. Mol. Microbiol. 19:911-922[CrossRef][Medline]. |
| 26. | Postma, P. W., J. W. Lengeler, and G. R. Jacobson. 1996. Phosphoenolpyruvate: carbohydrate phosphotransferase systems, p. 1149-1174. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: molecular and cellular biology. ASM Press, Washington, D.C. |
| 27. | Pourcher, T., E. Bibi, H. R. Kaback, and G. Leblanc. 1996. Membrane topology of the melibiose permease of Escherichia coli studied by melB-phoA fusions analysis. Biochemistry 35:4161-4168[CrossRef][Medline]. |
| 28. | Pullen, K., P. Rajagopal, B. R. Branchini, M. E. Huffine, J. Reizer, M. H. Saier, Jr., M. Scholtz, and R. E. Klevit. 1996. Effects of phosphorylation of a serine onthe solution structure and stability of histidine-containing protein, a bacterial phosphotranfer protein. Protein Sci. 4:2478-2486[Medline]. |
| 29. |
Reizer, J.,
M. J. Novotny,
W. Hengstenberg, and M. H. Saier, Jr.
1984.
Properties of ATP-dependent protein kinase from Streptococcus pyogenes that phosphorylates a seryl residue in HPr, a phosphocarrier of the phosphotransferase system.
J. Bacteriol.
160:333-3340 |
| 30. |
Reizer, J.,
A. Peterkofsky, and A. H. Romano.
1988.
Evidence of the presence of HPr and ATP-dependent HPr kinase in heterofermentative lactobacilli lacking a phosphoenolpyruvate:glucose phosphotransferase activity.
Proc. Natl. Acad. Sci. USA
85:2041-2045 |
| 31. | Reizer, J., S. L. Sutrina, M. H. Saier, Jr., G. C. Stewart, A. Peterkofsky, and P. Reddy. 1989. Mechanistic and physiological consequences of HPr(ser) phosphorylation on the activities of the phosphoenolpyruvate:phosphotransferase system in Gram-positive bacteria:studies with site-specific mutants of HPr. EMBO J. 8:2111-2120[Medline]. |
| 32. | Reizer, J., C. Hoischen, F. Titgemeyer, C. Rivolta, R. Rabus, J. Stulke, D. Karamata, M. H. Saier, Jr., and W. Hillen. 1998. A novel protein kinase that controls catabolite repression in bacteria. Mol. Microbiol. 27:1157-1169[CrossRef][Medline]. |
| 33. |
Romano, A. H.,
G. Brino,
A. Peterkofsky, and J. Reizer, J..
1987.
Regulation of -galactoside transport and accumulation in heterofermentative lactic acid bacteria.
J. Bacteriol.
169:5589-5596 |
| 34. | Saier, M. H., Jr., S. Chauvaux, J. Deutscher, J. Reizer, and J. J. Ye. 1995. Protein phosphorylation and regulation of carbon metabolism in Gram-negative versus Gram-positive bacteria. Trends Biol. Sci. 20:267-271. |
| 35. | Saier, M. H., Jr., and M. Crasnier. 1996. Inducer exclusion and the regulation of sugar transport. Res. Microbiol. 147:482-489[Medline]. |
| 36. |
Saier, M. H., Jr.,
S. Chauvaux,
G. M. Cook,
J. Deutscher,
I. T. Paulsen,
J. Reizer, and J. J. Ye.
1996.
Catabolite repression and inducer control in Gram-positive bacteria.
Microbiology
142:217-230 |
| 37. |
Saier, M. H., Jr.,
J. J. Ye,
S. Klinke, and E. Nino.
1996.
Identification of an anaerobically induced phosphoenolpyruvate-dependent fructose-specific phosphotransferase system and evidence for the Embden-Meyerhof glycolytic pathway in the heterofermentative bacterium Lactobacillus brevis.
J. Bacteriol.
178:314-316 |
| 38. | Saier, M. H., Jr., J. T. Beatty, A. Goffeau, K. T. Harley, W. H. M. Heijne, S.-C. Huang, D. L. Jack, P. S. Jahn, K. Lew, J. Liu, S. S. Pao, I. T. Paulsen, T.-T. Tseng, and P. S. Virk. 1999. The major facilitator superfamily. J. Mol. Microbiol. Biotechnol. 1:257-279[Medline]. |
| 39. | Saier, M. H., Jr. 2000. A functional-phylogenetic classification system for transmembrane solute transporters. Microbiol. Mol. Biol. Rev. 64:254-411. |
| 40. | Stülke, J., and W. Hillen. 1999. Carbon catabolite repression in bacteria. Curr. Opin. Microbiol. 2:195-201[CrossRef][Medline]. |
| 41. | Sullivan, M. A., R. E. Yasbin, and F. E. Young. 1984. New shuttle vectors for Bacillus subtilis and Escherichia coli, which allow rapid detection of inserted fragments. Gene 29:21-26[CrossRef][Medline]. |
| 42. | Vaughan, E., S. David, and W. M. de Vos. 1996. The lactose transporter in Leuconostoc lactis is a new member of the LacS subfamily of galactoside-pentose-hexuronide translocators. Appl. Environ. Microbiol. 62:1574-1582[Abstract]. |
| 43. | Viana, R., V. Monedero, V. Dossonnet, C. Vadeboncoeur, G. Perez-Martinez, and J. Deutscher. 2000. Enzyme I and HPr from Lactobacillus casei: their role in sugar transport, carbon catabolite repression and inducer exclusion. Mol. Microbiol. 36:570-584[CrossRef][Medline]. |
| 44. |
Ye, J. J.,
J. Reizer,
X. Cui, and M. H. Saier, Jr.
1994.
ATP-dependent phosphorylation of serine in HPr regulates lactose:H+ symport in Lactobacillus brevis.
Proc. Natl. Acad. Sci. USA
91:3102-3106 |
| 45. |
Ye, J. J., and M. H. Saier, Jr.
1995.
Cooperative binding of lactose and HPr(Ser-P) to the lactose:H+ permease of Lactobacillus brevis.
Proc. Natl. Acad. Sci. USA
92:417-421 |
| 46. |
Ye, J.-J., and M. H. Saier, Jr.
1995.
Allosteric regulation of the glucose:H+ symporter of Lactobacillus brevis: cooperative binding of glucose and HPr(Ser-P).
J. Bacteriol.
177:1900-1902 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»