Previous Article | Next Article ![]()
Journal of Bacteriology, June 2001, p. 3408-3416, Vol. 183, No. 11
Institute of Molecular Plant Sciences, Leiden
University, 2333 AL Leiden, The Netherlands,1
and Departments of Chemistry and Biomolecular Sciences, Michael
Barber Centre for Mass Spectrometry, UMIST, Manchester M60 1QD,
United Kingdom2
Received 11 December 2000/Accepted 5 March 2001
The products of the rhizobial nodulation genes are involved in the
biosynthesis of lipochitin oligosaccharides (LCOs), which are
host-specific signal molecules required for nodule formation. The
presence of an O-acetyl group on C-6 of the nonreducing
N-acetylglucosamine residue of LCOs is due to the enzymatic
activity of NodL. Here we show that transfer of the nodL
gene into four rhizobial species that all normally produce LCOs that
are not modified on C-6 of the nonreducing terminal residue results in
production of LCOs, the majority of which have an acetyl residue
substituted on C-6. Surprisingly, in transconjugant strains of
Mesorhizobium loti, Rhizobium etli, and Rhizobium
tropici carrying nodL, such acetylation of LCOs
prevents the endogenous nodS-dependent transfer of the N-methyl group that is found as a substituent of the
acylated nitrogen atom. To study this interference between
nodL and nodS, we have cloned the
nodS gene of M. loti and used its product in in
vitro experiments in combination with purified NodL protein. It has
previously been shown that a chitooligosaccharide N deacetylated on the
nonreducing terminus (the so-called NodBC metabolite) is the preferred
substrate for NodS as well as for NodL. Here we show that the NodBC
metabolite, acetylated by NodL, is not used by the NodS protein as a
substrate while the NodL protein can acetylate the NodBC metabolite
that has been methylated by NodS.
Rhizobial bacteria have the unique
ability to induce formation of nitrogen-fixing nodules on the roots or
stems of leguminous plants. The development of legume nodules is
largely controlled by reciprocal signal exchange between the symbiotic
partners. Legume roots secrete specific flavonoids or isoflavonoids
that induce the transcription of many bacterial genes (nod,
nol, and noe genes). Most of these genes are involved
in the synthesis and secretion of signal molecules that are essential
to trigger nodule formation and that are known as Nod factors. Nod
factors from many rhizobial species have been characterized, and their structures have been elucidated. Because their basic structure consists
of a chitin oligosaccharide backbone N acylated on the nonreducing
terminal residue, they are referred to as lipochitin oligosaccharides
(LCOs). The nature of the fatty acid and the combination of diverse
chemical substitutions provide host specificity to the LCOs produced by
a given rhizobial strain (for reviews, see references 1, 7, 9,
and 25).
Although there is a wide variability in LCO structures, two major
groups can be distinguished (19, 26, 33). (i) Rhizobia associated with plants of the Trifolieae, Vicieae, and
Galegeae tribes that form indeterminate nodules produce LCOs
carrying specific polyunsaturated fatty acids and have either no
substitution or a carbamoyl or an O-acetyl group on C-6 of
the nonreducing terminal N-acetylglucosamine (Fig.
1). On the reducing terminal residue, they can have substitutions of sulfate or acetate groups. (ii) Rhizobia
associated with plants that form determinate nodules produce LCOs with
common fatty acids and, in most cases, the N atom carrying the fatty
acid is also replaced with a methyl group. On the nonreducing terminal
residue they can also carry carbamoyl groups, while on the reducing
terminal residue they can bear sulfate, arabinose, or fucose.
Frequently, the fucosyl residue is replaced by acetate, sulfate, and/or
methyl groups.
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.11.3408-3416.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Rhizobial NodL O-Acetyl Transferase and
NodS N-Methyl Transferase Functionally Interfere in
Production of Modified Nod Factors


![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

View larger version (21K):
[in a new window]
FIG. 1.
Scheme of LCO structures in rhizobia.
The biochemical functions of most of the nodulation genes involved in the biosynthesis of LCOs have been shown directly or indirectly. The nodABC genes are absolutely required for the synthesis of LCOs; NodC produces chitooligosaccharides, NodB removes the N-acetyl group from the nonreducing terminal residue, and NodA is involved in the transfer of the acyl chain. Modifications of the LCO core are dependent on nod genes that are strain specific. Some nodulation proteins have been purified to homogeneity, and in vitro analysis of their substrate specificities has provided information about their positions in the LCO biosynthesis pathway (for reviews, see references 7 and 14). NodL and NodS are both involved in modifications of the nonreducing terminal residue and are among the best-characterized Nod proteins. The NodL protein has transacetylating activity in vitro with acetyl coenzyme A (CoA) as the acetyl donor, and it is responsible for the presence of one O acetyl group on C-6 of the nonreducing terminal residue of LCOs (3). NodS is an S-adenosyl-L-methionine (SAM)-dependent methyltransferase involved in N methylation of LCOs (12, 13). NodS uses N-deacetylated chitooligosaccharides, the products of the NodBC proteins (the so-called NodBC metabolites), as its methyl acceptors (11, 18). Although the NodL protein appears to be able to acetylate various substrates, such as LCOs, chitin fragments, and N-acetylglucosamine, the NodBC metabolite is the preferred substrate and is probably the in vivo acetyl-accepting substrate (2, 3).
We have introduced the nodL gene of Rhizobium leguminosarum bv. viciae into four different rhizobial species (all producing LCOs of type 2) and have studied the LCO structures produced by the recombinant strains. Mesorhizobium loti carrying nodL produces LCOs which are acetylated but, surprisingly, in contrast to the wild-type LCOs, have no N-methyl group on the nonreducing terminal residue. In order to study in more detail the apparent interference between the nodL and nodS genes, we have cloned nodS of M. loti, and its product has been overproduced in Escherichia coli. In vitro studies have shown that NodS is unable to N methylate the NodBCL metabolite.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Strains, plasmids, and media.
The bacterial strains and
plasmids used in this study are listed in Table
1. Broad-host-range plasmids were
mobilized from E. coli to rhizobia using pRK2013 as a helper
plasmid (8). Rhizobia were grown in B
medium
(27). Antibiotics were added, when required, to the following final concentrations (micrograms per milliliter):
tetracyline, 2 (10 for Rhizobium etli); spectinomycin, 200. For induction of LCOs, naringenin was added to the medium to a final
concentration of 1.5 µM.
|
DNA sequence analysis. DNA sequencing was achieved by the dideoxy chain termination reaction method (24) with a T7 sequencing kit (Pharmacia). The sequencing primers were M13/lac-Z forward and reverse (Perkin-Elmer), and the sequencing vectors were pGEM-T (Promega) and pBluescript SK (Stratagene). The comparison of primary structures was carried out using the Genetics Computer Group (University of Wisconsin, Madison) software package.
Cloning of M. loti nodS. DNA manipulations were carried out using standard procedures (23). Plasmids were isolated with a Qiaprep spin plasmid kit (Qiagen). The nodS gene from M. loti E1R was obtained by PCR using genomic DNA from the bacterium as the template and primers (see Fig. 5A): NB, GATCCAAACAATCAATTTTACCCAAT; U3 (oMP124), CC(A/G)TC(A/G)TGIGTIA(A/G)(T/C)TTIATICC(A/G)C; S1 (oMP119), CGCGACCC(G/A)TGGCG(C/G)(C/A)TCGAC; S2 (oMP120), CTCCGCACCGGC(C/A)(A/G)CATGCCCCCA; C1 (oMP118), GTGTACATTGAGCAATAGCGATTGG (obtained from Isogen, Maarssen, The Netherlands).
PCR was performed using ULTma DNA polymerase (Perkin-Elmer) in a Stratagene Robocycler gradient 40 thermocycler. The amplification conditions were 1 min at 94°C, 4 min at 37°C, and 1 min at 72°C for 30 cycles. The product of the PCR amplification with primers NB and U3 was cloned into the pGEM-T vector (Promega) to yield construct pMP4603. The insert was partially sequenced, and the regions around the start and stop codons were analyzed. Based on the sequences thus determined for the two ends of the open reading frame (ORF), homogeneous primers (oMP179 and -180) were synthesized, with restriction sites introduced at the 5' ends of the primers in order to facilitate cloning into an expression vector: oMP179, GGAATTCATATGGGTGCGAATTTGACC (the NdeI restriction site is underlined); oMP 180, GGACGTCGACTCAGGAAGCGGAAATC (the SalI restriction site is underlined) (both obtained from Isogen). These primers were used in a PCR with M. loti E1R genomic DNA (the PCR conditions were as described above except for the annealing temperature of 54°C). The resulting fragment was purified over an agarose gel, digested with NdeI-SalI, and ligated into pET16b that had been digested with NdeI and XhoI, yielding plasmid pMP4601. Plasmid pMP4600 was obtained by subcloning the NdeI-BamHI fragment of pMP4601 containing the nodS gene into pET3a. For sequencing of nodS, the XbaI-BamHI insert of pMP4601 was subcloned into pBluescript SK. As the source of nodL, plasmids pMP2107 (IncP) and pMP2109 (IncW) were used. Both plasmids carry, in addition to the nodL gene under the control of the nodA promoter, nodD of R. leguminosarum bv. trifolii, which provides in all cases induction of LCOs after the addition of naringenin. In order to compare the production of LCOs under the same conditions but in the absence of nodL, plasmids carrying only nodD of R. leguminosarum bv. viciae(pMP280) or nodD of R. leguminosarum bv. trifolii(pMP2112) were transferred into the different rhizobia. The IncW plasmids pMP2112 and pMP2109 were used in the case of M. loti E1R because IncP plasmids are difficult to maintain in that strain (15).Overproduction of M. loti NodS in E. coli.
E. coli strain BL21(DE3) (30),
which expresses the T7 polymerase under the control of the
lac promoter, was transformed with either pMP4601 or
pMP4600. NodS was produced from BL21(DE3), carrying pMP4601, as a
translational fusion with a histidine tag that can be used for
purification of the fusion protein with a Ni column. Because it was
impossible to isolate an active NodS protein using a Ni column (see
Results), NodS preparations were obtained from BL21(DE3)(pMP4600) as
follows. One-liter cultures were grown on Luria-Bertani medium
containing 25 µg of carbenicillin/ml at 37°C to an optical density
at 620 nm of approximately 0.4, and then IPTG
(isopropyl-
-D-thiogalactopyranoside) was added to a
final concentration of 0.1 mM in order to induce nodS
expression from pMP4600. After 4 h of induction, the cells were
harvested by centrifugation. The cell pellet was suspended in 10 mM
phosphate buffer and lysed by sonication. The suspension was
centrifuged at 6,800 × g for 15 min to obtain the cell
extract. The supernatant containing the soluble NodS protein was used
in the in vitro experiments. As a negative control, cell extracts were
obtained in the same way from strain BL21(DE3) carrying the empty pET3a
vector (without the nodS gene).
Enzyme assays, radiolabeling, and TLC analysis of the products. The activity of NodS was assayed by following incorporation of a radioactive methyl group into the GlcNH2-GlcNAc3 tetrasaccharide (NodBC metabolite), which had been chemically synthesized. Radiolabeled S-[methyl-14C]adenosyl methionine (0.025 µCi; Amersham) was used as the methyl donor. Enzyme activity was assayed in 20 mM Tris-HCl, pH 7.0, for 2 h at room temperature. The resulting modified chitin oligosaccharides were extracted into chloroform and analyzed on silica thin-layer chromatography (TLC) plates (Merck), which were developed in butanol-ethanol-water (5:3:3 [vol/vol/vol]). Radioactive spots were visualized with a Molecular Dynamics PhosphorImager using ImageQuant software after overnight exposure.
NodL protein was purified from E. coli BL21(DE3) harboring pMP3401 as previously described (3). NodL assays were performed as described previously (3).Detection of LCOs by TLC. In vivo labeling of LCOs was carried out in 1-ml cultures using either 0.1 µCi of D-[1-14C]glucosamine (54 mCi/mmol; Amersham) or 0.1 µCi of L-[methyl-14C]methionine (55 mCi/mmol; Amersham). In all cultures, LCO production was induced with naringenin, and after overnight growth, the LCOs were isolated from the cultures by n-butanol extraction. Samples were concentrated by evaporation and chromatographed on reversed-phase C18-coated silica plates (Sigma) using a mobile phase of acetonitrile-water (1:1 [vol/vol]). Radiolabeled components were detected with a PhosphorImager using ImageQuant software.
Purification of LCOs. LCOs were extracted from 1-liter cultures and purified by reversed-phase high-performance liquid chromatography (HPLC) as described by López-Lara et al. (15) for the LCOs of M. loti(pMP2109) and R. etli(pMP2107) and as described by López-Lara et al. (16) for the LCOs of Rhizobium sp. strain GRH2(pMP2107) and R. tropici(pMP2107).
FAB-MS and CID-MS-MS. Positive-ion fast-atom bombardment mass spectra (FAB-MS) were obtained using MS1 of a JEOL JMS-SX/SX102A tandem mass spectrometer operated at 10 kV accelerating voltage. The FAB gun was operated at 6 kV accelerating voltage with an emission current of 10 mA and using xenon as the bombarding gas. The spectra were scanned at a speed of 30 s for the full mass range specified by the accelerating voltage used and were recorded and averaged on a Hewlett Packard 9000 data system running JEOL COMPLEMENT software. Collision-induced dissociation mass spectrum-mass spectrum (CID-MS-MS) data were recorded using the same instrument, with helium as the collision gas in the third field-free region collision cell at a pressure sufficient to reduce the parent ion to one-third of its original intensity. The HPLC fractions were redissolved in 15 to 30 µl of dimethyl sulfoxide, and 1.5-µl aliquots of sample solution were loaded into a matrix of monothioglycerol. De-O-acetylation was carried out by incubating 10 to 35% of each fraction overnight at room temperature in 300 µl of methanol-25% aqueous ammonium hydroxide (1:1 [vol/vol]). The reagent was removed under vacuum, and the product was redissolved in 20 µl of dimethyl sulfoxide for analysis.
Nucleotide sequence accession number. The amino acid sequence of the M. loti nodS gene product was deduced from the nucleotide sequence of the gene (GenBank accession number AF290510).
| |
RESULTS |
|---|
|
|
|---|
Effect of introducing nodL into rhizobia. With the initial intention of examining the effect on the host range of modifying the LCOs produced by a range of different rhizobia, the nodL gene from R. leguminosarum by viciae was introduced into M. loti, R. etli, Rhizobium tropici, and Rhizobium sp. strain GRH2. These species were chosen for having either a broad (Rhizobium sp. strain GRH2 and R. tropici) or narrow (M. loti and R. etli) host range and producing LCOs with a wide variety of substitutions (LCOs from M. loti and R. etli are N methylated, carbamoylated, and acetylfucosylated, while those from R. tropici and Rhizobium sp. strain GRH2 are N methylated and sulfated). Our results showed that M. loti E1R(pMP2109) nodulates Lotus corniculatus as efficiently as the wild type or the strain carrying pMP2112. The strains CIAT899(pMP2107), CE3(pMP2107), and GRH2(pMP2107) form nodules on Phaseolus vulgaris Negro Jamapa at the same rate as their wild-type counterparts. Rhizobium sp. strain GRH2(pMP2107) is able to nodulate A. cacia cyanophylla and Acacia melanoxylon in the same way as does its wild type, which was originally isolated from A. cyanophylla (data not shown). Introduction of nodL, therefore, apparently does not affect the nodulation abilities of these strains.
In order to demonstrate that nodL is expressed in these strain, the LCOs produced by the four strains bearing nodL were screened following D-[14C]-glucosamine labeling, using reversed-phase TLC (Fig. 2). In all four cases, the strain bearing nodL produced LCOs with lower mobility than those produced by the same strain in the absence of nodL (Fig. 2), showing that NodL is able to modify the LCOs in all these different backgrounds and results in LCOs having increased hydrophobicities.
|
Structures of LCOs produced by rhizobia bearing the nodL gene. In order to determine the range of LCO structures produced by the transformed rhizobia, 1-liter cultures were induced with naringenin and the LCOs were extracted into butanol. The butanol extracts from each of the four strains were fractionated on reversed-phase HPLC (15, 16). From each of the four transformed rhizobial strains, fractions corresponding to the major peaks of UV absorbance were collected, and the relevant fractions were pooled. The LCOs in each of the peaks from each of the four rhizobial strains were analyzed using FAB-MS and CID-MS-MS.
The HPLC profile of LCOs isolated from M. loti E1R(pMP2112) (nodD only) shows two peaks; peak I is a broad peak eluting at 40% acetonitrile, while peak II elutes at 60% acetonitrile (15) (Fig. 3). Consistent with the TLC results, the LCOs isolated from M. loti(pMP2109) elute later in the HPLC purification process than those from the strain bearing nodD only, indicating the production of more-hydrophobic structures. Furthermore, instead of one broad peak I, there are two peaks eluting in 40% acetonitrile, Ia and Ib, which were collected mainly in fractions 6 and 9, respectively (Fig. 3).
|
14 = +28). Proof for this hypothesis was sought by subjecting the two
fractions to mildly basic conditions to remove the ester-bound acetyl
groups. The FAB-MS of the products yielded [M + H]+
pseudomolecular ions at m/z 1445 (fraction 9) and 1447 (fraction 16), consistent with the removal of two ester-linked acetyl
groups from the LCOs. On tandem mass spectrometric analysis, fragment ions were observed at m/z 469, 672, 875, and 1078 (fraction
9) (Fig. 4c) and 471, 674, 877, and 1080 (fraction 16) (not shown), consistent with a GlcNAc5 LCO bearing a carbamoyl group and either a
C18:1 or C18:0 fatty acyl group on the reducing
terminal residue, as well as a fucosyl susbstituent on the nonreducing
terminal residue but, importantly, no methyl group such as that found
in the LCOs from wild-type M. loti on the nonreducing
terminal residue.
|
|
[methyl-14C]methionine labeling of LCOs
produced by nodL-bearing strains.
In order to examine
this effect in more detail, labeling experiments were set up for each
of the four strains, using
[methyl-14C]methionine as the in vivo methyl
donor. The resulting LCOs were extracted into butanol and separated on
silica TLC. Radioactive spots were visualized by phosphorimaging (Fig.
5). The results of the labeling
experiment (Fig. 5) are consistent with the results of the structural
analyses
M. loti is unable to incorporate detectable levels
of radioactivity from the 14C-labeled methyl donor into its
LCOs when carrying the nodL gene (Fig. 5, lane 1), although
incorporation is normal in strains without this gene (Fig. 5, lane 2).
R. tropici and R. etli strains carrying the
nodL gene can incorporate only very minor amounts of the
14C-labeled methyl donor into their LCOs (Fig. 5, lanes 6 and 8) in comparison to the strains lacking the nodL gene
(Fig. 5, lanes 5 and 7). In contrast, Rhizobium sp. strain
GRH2 shows no reduction in the level of radioactive incorporation from
the labeled methyl donor into spots corresponding to LCOs in the
presence (Fig. 5, lane 4) or absence (Fig. 5, lane 3) of the
nodL gene.
|
Cloning of M. loti nodS and overexpression of its product. Since the apparent interference of nodL with nodS is most pronounced in M. loti, we chose to use this strain to carry out further studies. We began by identifying and cloning nodS from M. loti. In order to identify the nodS gene in PCR products, two primers, S1 and S2, based on conserved regions of known NodS proteins, were designed. Using these primers in a PCR with M. loti E1R DNA, a PCR product of the expected size was obtained. In order to obtain the complete ORF for the gene, primers flanking the gene were required. In most rhizobia, nodS is found in an operon where it is followed by nodU, and in some cases preceded by nodC, or is found as the first gene in the operon. Consequently, U3, a primer based on a conserved region of the nodU genes, was designed, together with C1, based on the sequence of nodC of M. loti NZP2037 (6), which could be replaced by a nod box-based primer (NB) for those cases when nodS is the first gene in the operon.
Using the primers NB and U3 in a PCR produced a product which, in a nested PCR with primers S1 and S2, yielded a smaller product of the expected size, confirming that the PCR product obtained using the first set of primers harbors the M. loti nodS gene. We thus conclude that in M. loti E1R nodS is followed by nodU but is not preceded by nodC. The amino acid sequence of the M. loti nodS gene was deduced from the nucleotide sequence of the gene and compared with those known for other NodS proteins. The similarities in the sequences of the NodS proteins from M. loti, R. tropici, and R. etli are particularly interesting, considering that these are the species that, when carrying the nodL gene, fail to incorporate radiolabel efficiently from [methyl-14C]methionine, suggesting that their nodS genes (or their products) are all similarly affected by the presence of the nodL gene (or its product). The ORF encoding NodS from M. loti was cloned, as described in Materials and Methods, in pET16b, resulting in plasmid pMP4601. After induction with IPTG of BL21(DE3) carrying pMP4601, the majority of the His tag-NodS fusion protein was found in inclusion bodies. It proved impossible to isolate an active NodS protein using a Ni column (data not shown). Subsequently, the nodS gene was cloned from pMP4601 in pET3a, resulting in pMP4600. The strain BL21(DE3) carrying pMP4600 was used to obtain a cell extract containing soluble NodS protein that was used in further experiments.Functional interference between NodS and NodL activities in
vitro.
In order to determine whether the apparent interference of
nodL with nodS observed in vivo occurs at the
level of the genes or their products, the cell extract from
BL21(DE3)(pMP4600) (the E. coli strain overproducing NodS
from M. loti) was tested in a variety of in vitro enzyme
assays with NodL. The so-called NodBC tetrasaccharide
(GlcNH2-GlcNAc-GlcNAc-GlcNAc) was used as the substrate,
and S-[methyl-14C]adenosyl
methionine was used as the methyl donor. The products were analyzed by
silica TLC, with radioactive compounds detected by phosphorimaging
(Fig. 6).
|
| |
DISCUSSION |
|---|
|
|
|---|
Our results show that the rhizobial nodS-dependent N-methyl transferase and the nodL O-acetyl transferase activities functionally interfere and that this interference occurs at the level of the activities of the primary gene products. The NodBCL metabolite, the product of NodL acetyl transferase activity on the NodBC metabolite, is not used by the NodS protein as a substrate, while the NodBCS metabolite produced by the action of NodS is recognized and used as a substrate by NodL. Clearly, the presence of a substituent on O-6 of the nonreducing terminal residue blocks the action of NodS. Based on our observations, we predict that in the biosynthesis of LCOs that bear both an N-methyl group and a substituent, such as a carbamoyl group, on the non-reducing O-6, as is the case in the LCOs from Azorhizobium caulinodans and Rhizobium sp. strain NGR234, NodS acts on the NodBC product (11, 18), while we predict that the carbamoyl transferase NodU or its analogue acts on a more mature acylated chitin oligosaccharide derivative.
It is known that NodL acts preferentially on the NodBC metabolite
rather than on a more mature acyl-bearing species (2). From our observations, we suggest that NodS-mediated N methylation of
such NodBCL metabolites may well be impossible and that N-methylated, nonreducing-terminally O-acetylated LCOs would therefore be very unlikely to be biosynthesized. We are unaware of any reports of such
LCO structures. In Bradyrhizobium elkani USDA 61, about 20 different LCOs have been identified, among them LCO species carrying acetate on C-6 of the nonreducing terminal residue as well as other LCO
species carrying an N-methyl group. Both the O-acetylated and the
N-methylated species can carry additional carbamoyl groups on the
nonreducing terminal residue, but interestingly, species carrying both
the O-acetyl and the N-methyl groups were not
observed (5, 29). Examples of functional interference of
nod gene products are not abundant, although the description
of LCO structures from the type strain of M. loti, NZP2213,
in which C-3 of the subterminal GlcNAc residue is fucosylated
(21), noted that those fucosylated LCO structures appear
not to be methylated. This could be an example analogous to that
reported here and should therefore allow us to predict that the
(1
3) transferase must act earlier in LCO biosynthesis than the
N-methyl transferase activity.
Our results and those of others (11, 18) show that only a de-N-acetylated chitooligosaccharide can be used as a substrate by NodS. Fully N-acetylated chitooligosaccharides or unmethylated LCOs are not methylated in vitro by NodS (11). In constrast, the NodL protein is able to acetylate, in addition to terminally de-N-acetylated chitooligosaccharides, various other substrates, such as LCOs, chitin oligosaccharides, chitosan oligosaccharides, N-acetylglucosamine, and cellopentaose (2, 3). From all these data it is clear that NodS is highly substrate specific while NodL has a broad substrate specificity. The differences in the degrees of specificity may also account for the effect observed in vivo with the strains carrying nodL. While NodS can act only at a very precise step in LCO biosynthesis (i.e., after NodB deacetylation and before NodA-mediated acylation), NodL acts preferentially at this point but can also act directly on the product of NodC or on a completely mature LCO (i.e., at any point in LCO biosynthesis). Mergaert et al. (18) have shown that an E. coli strain expressing nodCS produces unmethylated chitin oligosaccharides. Based on our in vitro data, we predict that an E. coli strain expressing nodCL should be able to produce acetylated chitin oligosaccharides.
In spite of the functional interference of the nodS and nodL gene products in vivo, we have developed an in vitro system for synthesizing NodBCSL metabolites that in most cases would not be possible to synthesize using an in vivo system. It remains to be seen whether this system can be used to generate mature LCOs that are both N methylated and O acetylated in order to carry out bioactivity experiments.
Having determined the sequence of the nodS gene from M. loti, we have deduced its amino acid sequence and demonstrated its similarity to the analogous proteins from R. etli and R. tropici. This similarity is consistent with our observation that the NodS proteins from all three strains are interfered with by the NodL protein from R. leguminosarum bv. viciae. Having demonstrated in vivo that the nodS gene from Rhizobium sp. strain GRH2 is apparently not interfered with by the presence of the nodL gene, it will be interesting to see how different the GRH2 NodS protein appears to be from the other three proteins when its sequence becomes known.
The transconjugant strains carrying the nodL gene are all able to nodulate the same natural host plants as their wild-type counterparts. Since a nodS mutant of R. tropici CIAT899 is unable to nodulate Phaseolus (32), we propose that in the nodL transconjugant strain the lack of the N-methyl group is compensated for by the presence of the O-acetyl substitution. Apart from a role in host specificity, it is proposed that the substituents on LCOs make them more resistant to degradation by enzymes produced by the plant or present in the rhizosphere. It is possible that the function of O-acetyl or N-methyl substituents on the nonreducing terminus is thus to render LCOs more resistant to degradation. This proposal is supported by the recent finding that LCOs produced by Rhizobium fredii (a strain that produces non-N-methylated LCOs) are de-N-acylated by fatty acyl amidase II secreted by Dictyostelium discoideum but, interestingly, N-methylated LCOs from a transgenic R. fredii strain carrying nodS are protected against degradation by this enzyme (31).
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by grants from the European Union (ERBFMRXCT 980243) and the Human Frontier Science Organization.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Institute of Molecular Plant Sciences, Leiden University, Wassenaarseweg 64, 2333 AL Leiden, the Netherlands. Phone: 31-71-5275055. Fax: 31-71-5275088. E-mail: spaink{at}rulbim.leidenuniv.nl.
Present address: Centro de Investigacion sobre Fijacion de
Nitrogeno-UNAM, CP 62251 Cuernavaca, (Mor.), Mexico.
Present address: Institute of Biology, Heraclion, Crete, Greece.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Bladergroen, M. R., and H. P. Spaink. 1998. Genes and signal molecules involved in the rhizobia-Leguminosae symbiosis. Curr. Opin. Plant Biol. 1:353-359[CrossRef][Medline]. |
| 2. | Bloemberg, G. V., R. M. Lagas, S. V. Leeuwen, G. A. V. D. Marel, J. H. V. Boom, B. J. J. Lugtenberg, and H. P. Spaink. 1995. Substrate specificity and kinetic studies of nodulation protein NodL of Rhizobium leguminosarum. Biochemistry 34:12712-12720[CrossRef][Medline]. |
| 3. | Bloemberg, G. V., J. E. Thomas-Oates, B. J. J. Lugtenberg, and H. P. Spaink. 1994. Nodulation protein NodL of Rhizobium leguminosarum O-acetylates lipo-oligosaccharides, chitin fragments and N-acetylglucosamine in vitro. Mol. Microbiol. 11:793-804[CrossRef][Medline]. |
| 4. | Cárdenas, L., J. Domínguez, C. Quinto, I. M. López-Lara, B. J. J. Lugtenberg, H. P. Spaink, G. J. Rademaker, J. Haverkamp, and J. E. Thomas-Oates. 1995. Isolation, chemical structure and biological activity of the lipo-chitin oligosaccharide nodulation signals from Rhizobium etli. Plant Mol. Biol. 29:453-464[CrossRef][Medline]. |
| 5. |
Carlson, R. W.,
J. Sanjuan,
U. R. Bhat,
J. Glushka,
H. P. Spaink,
A. H. M. Wijfjes,
A. A. N. V. Brussel,
T. J. W. Stockermans,
K. Peters, and G. Stacey.
1993.
The structures and biological activities of the lipo-oligosaccharide nodulation signals produced by type I and type II strains of Bradyrhizobium japonicum.
J. Biol. Chem.
268:18372-18381 |
| 6. |
Collins-Emerson, J. M.,
E. A. Terzaghi, and D. B. Scott.
1990.
Nucleotide sequence of Rhizobium loti nodC.
Nucleic Acids Res.
18:6690 |
| 7. | Dénarié, J., F. Debellé, and J.-C. Promé. 1996. Rhizobium lipo-chitooligosaccharide nodulation factors: signaling molecules mediating recognition and morphogenesis. Annu. Rev. Biochem. 65:503-535[CrossRef][Medline]. |
| 8. |
Ditta, G.,
S. Stanfield,
D. Corbin, and D. R. Helinski.
1980.
Broad host range DNA cloning system for Gram-negative bacteria: construction of a gene bank of Rhizobium meliloti.
Proc. Natl. Acad. Sci. USA
77:7347-7351 |
| 9. | Downie, J. A. 1998. Functions of rhizobial nodulation genes, p. 387-402. In H. P. Spaink, A. Kondorosi, and P. J. J. Hooykaas (ed.), The Rhizobiaceae Kluwer, Dordrecht, The Netherlands. |
| 10. | Folch-Mallol, J. L., S. Marroquí, C. Sousa, H. Manyani, I. M. López-Lara, K. M. G. M. V. D. Drift, J. Haverkamp, C. Quinto, A. Gil-Serrano, J. E. Thomas-Oates, H. P. Spaink, and M. Megías. 1996. Characterization of Rhizobium tropici CIAT899 nodulation factors: the role of nodH and nodPQ genes in their sulfation. Mol. Plant-Microbe Interact. 9:151-163[Medline]. |
| 11. | Geelen, D., B. Leyman, P. Mergaert, K. Klarskov, M. V. Montagu, R. Geremia, and M. Holsters. 1995. NodS is an S-adenosyl-L-methionine-dependent methyltransferase that methylates chitooligosaccharides deacetylated at the non-reducing end. Mol. Microbiol. 17:387-397[CrossRef][Medline]. |
| 12. | Geelen, D., P. Megaert, R. A. Geremia, S. Goormachtig, M. V. Montagu, and M. Holsters. 1993. Identification of nodSUIJ genes in Nod locus 1 of Azorhizobium caulinodans: evidence that nodS encodes a methyltransferase involved in Nod factor modification. Mol. Microbiol. 9:145-154[CrossRef][Medline]. |
| 13. |
Jabbouri, S.,
R. Fellay,
F. Talmont,
P. Kamalaprija,
U. Burger,
B. Relic,
J.-C. Prome, and W. J. Broughton.
1995.
Involvement of nodS in N-methylation and nodU in 6-O-carbamoylationof Rhizobium sp. NGR234 Nod factors.
J. Biol. Chem.
270:22968-22973 |
| 14. | Kamst, E., H. P. Spaink, and D. Kafetzopoulos. 1998. Biosynthesis and secretion of rhizobial lipochitin-oligosaccharide signal molecules, p. 29-71. In B. B. Biswas, and H. K. Das (ed.), Plant-Microbe Interactions. Plenum Press, New York, N.Y. |
| 15. | López-Lara, I. M., J. D. J. V. D. Berg, J. E. Thomas-Oates, J. Glushka, B. J. J. Lugtenberg, and H. P. Spaink. 1995. Structural identification of the lipo-chitin oligosaccharide nodulation signals of Rhizobium loti. Mol. Microbiol. 15:627-638[Medline]. |
| 16. | López-Lara, I. M., K. M. G. M. V. D. Drift, A. A. N. V. Brussel, J. Haverkamp, B. J. J. Lugtenberg, J. E. Thomas-Oates, and H. P. Spaink. 1995. Induction of nodule primordia on Phaseolus and Acacia by lipo-chitin oligosaccharide nodulation signals from broad-host-range Rhizobium strain GRH2. Plant Mol. Biol. 29:465-477[CrossRef][Medline]. |
| 17. | Martínez, E., M. A. Pardo, R. Palacios, and M. A. Cevallos. 1985. Reiteration of nitrogen fixation gene sequences and specificity of Rhizobium in nodulation and nitrogen fixation in Phaseolus vulgaris. J. Gen. Microbiol. 131:1779-1786. |
| 18. |
Mergaert, P.,
W. D'Haeze,
D. Geelen,
D. Promé,
M. V. Montagu,
R. Geremia,
J.-C. Promé, and M. Holsters.
1995.
Biosynthesis of Azorhizobium caulinodans Nod factors.
J. Biol. Chem.
270:29217-29223 |
| 19. | Mergaert, P., M. V. Montagu, and M. Holsters. 1997. Molecular mechanisms of Nod factor diversity. Mol. Microbiol. 25:811-817[CrossRef][Medline]. |
| 20. |
Noel, K. D.,
A. Sánchez,
L. Fernández,
J. Leemans, and M. A. Cevallos.
1984.
Rhizobium phaseoli symbiotic mutants with Tn5 insertions.
J. Bacteriol.
158:148-155 |
| 21. |
Olsthoorn, M. M. A.,
I. M. López-Lara,
B. O. Petersen,
K. Bock,
J. Haverkamp,
H. P. Spaink, and J. E. Thomas-Oates.
1998.
Novel branched Nod factor structure results from -(1-3) fucosyl transferase activity: the major lipo-chitin oligosaccharides from Mesorhizobium loti strain NZP2213 bear an -(1-3) fucosyl substituent on a nonterminal backbone residue.
Biochemistry
37:9024-9032[CrossRef][Medline].
|
| 22. |
Ritsema, T.,
O. Geiger,
P. V. Dillewijn,
B. J. J. Lugtenberg, and H. P. Spaink.
1994.
Serine residue 45 of nodulation protein NodF from Rhizobium leguminosarum bv. viciae is essential for its biological function.
J. Bacteriol.
176:7740-7743 |
| 23. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 24. |
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467 |
| 25. | Schultze, M., E. Kondorosi, P. Ratet, M. Buire, and A. Kondorosi. 1994. Cell and molecular biology of Rhizobium-plant interactions. Int. Rev. Cytol. 156:1-75. |
| 26. | Spaink, H. P. 1996. Regulation of plant morphogenesis by lipo-chitin oligosaccharides. Crit. Rev. Plant Sci. 15:559-582. |
| 27. | Spaink, H. P., C. A. Wijffelman, R. J. H. Okker, and B. J. J. Lugtenberg. 1989. Localization of functional regions of the Rhizobium nodD product using hybrid nodD genes. Plant Mol. Biol. 12:59-73. |
| 28. | Spaink, H. P., C. A. Wijffelman, E. Pees, R. J. H. Okker, and B. J. J. Lugtenberg. 1987. Rhizobium nodulation gene nodD as a determinant of host specificity. Nature (London) 328:337-340[CrossRef]. |
| 29. | Stokkermans, T. J. W., R. Orlando, V. S. K. Kolli, R. W. Carlson, and N. K. Peters. 1996. Biological activities and structures of Bradyrhizobium elkanii low abundance lipochitin-oligosaccharides. Mol. Plant-Microbe Interact. 9:298-304. |
| 30. | Studier, F. W., A. H. Rosenberg, J. J. Dunn, and J. W. Dubendorff. 1990. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185:60-89[Medline]. |
| 31. |
Sutherland, P. J.,
A. E. Tobin,
C. L. Rutherford, and N. P. J. Price.
1998.
Dictyostelium discoideum fatty-acyl amidase II has deacilase activity on Rhizobium nodulation factors.
J. Biol. Chem.
273:4459-4464 |
| 32. | Waelkens, F., T. Voets, K. Vlassak, J. Vanderleyden, and P. V. Rhijn. 1995. The nodS gene of Rhizobium tropici strain CIAT899 is necessary for nodulation on Phaseolus vulgaris and on Leucaena leucocephala. Mol. Plant-Microbe Interact. 8:147-154[Medline]. |
| 33. |
Yang, G.-P.,
F. Debellé,
A. Savagnac,
M. Ferro,
O. Schiltz,
F. Maillet,
D. Promé,
M. Treilhou,
C. Vialas,
K. Lindstrom,
J. Dénarié, and J.-C. Promé.
1999.
Structure of the Mesorhizobium huakii and Rhizobium galegae Nod factors: a cluster of phylogenetically related legumes are nodulated by rhizobia producing Nod factors with , -unsaturated N-acyl substitutions.
Mol. Microbiol.
34:227-237[CrossRef][Medline].
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»