INSERM E0004-Laboratoire de Recherche
Moléculaire sur les Antibiotiques, UFR Broussais-Hôtel
Dieu and Pitié Salpétrière, Université
Paris VI, Paris,1 and Laboratoire de
Bactériologie, Centre Hospitalier Intercommunal,
Villeneuve-Saint Georges,2 France
 |
TEXT |
Bacterial insertion sequences (IS),
integral parts of the chromosome of many bacterial species, are mobile
DNA elements which typically code only for the transposase which
promotes their mobility. These elements are capable of generating
mutations and genome rearrangements as a result of translocation, of
promoting gene acquisition, and of mobilizing DNA fragments via the
formation of compound transposons (13, 14). By various
mechanisms, the presence or mobility of these elements may affect
degradative pathways (9, 10), bacterial pathogenicity or
virulence (8, 35), and resistance to antibiotics
(15, 17) and may condition gene expression. Genes may be
silenced by insertional gene disruption and reactivated by precise
excision (8, 11, 35). Gene activation also may result from
the provision of efficient promoters, carried either entirely by the
element (10, 17) or generated as hybrid structures between
IS, upon insertion, and target sequences (5, 9, 12, 15).
Like most bacterial genera in which insertion sequences have been
searched for, Bacteroides harbors several such elements. They are IS4351, IS942, IS1186, and
IS1224 (or their isoforms), and they belong to the
IS30, IS4, IS5, and IS21
families, respectively (13, 27). Only IS4351
has also been observed as part of a compound transposon
(20). The four elements have been found preferentially in
Bacteroides fragilis, the anaerobe species most frequently
isolated from human infections (24).
No involvement other than that in the expression of antibiotic
resistance genes has, as yet, been observed for the
Bacteroides IS elements. While it was speculated that
IS1224 may activate the endogenous B. fragilis
cephalosporinase gene, cepA, either via inactivation of a
repressor function or generation of a hybrid promoter (22,
27), it has been shown that the carbapenemase gene
cfiA (ccrA) is activated by an
IS1186-borne promoter (17). It seemed likely
that there was a similar contribution to transcription of
cfiA by IS942 (19) and
IS4351 (I. Podglajen, unpublished data), of the macrolide
resistance gene ermF by IS4351 (20), and of the metronidazole resistance genes nimA and
nimB by IS1168 (7), nimD
by IS1169 and nimC by IS1170
(32).
The carbapenemase CfiA confers resistance to practically all
-lactams, the most widely used class of antibiotics. Surprisingly, this conceivably advantageous resistance trait seems to have remained confined to a small, genotypically identified subgroup (or subspecies) of B. fragilis (6, 16, 23) despite the presence
of a variety of genetic elements with the potential for gene
mobilization and transfer within the genus Bacteroides
(25-27). In the present study we describe two novel
insertion sequences and their capacity to efficiently promote the
expression of cfiA.
Identification and characterization of two novel IS elements in
B. fragilis.
During the systematic analysis of
carbapenem resistance in clinical isolates of B. fragilis we
observed five imipenem-resistant strains, by using dot blot
hybridization (data not shown), which carried cfiA but
none of the promoter-bearing insertion sequences IS1186
(17), IS942 (19), or
IS4351 (20 and I. Podglajen, unpublished) or
closely related IS isoforms. Since cfiA has generally been
found to be silent unless at least one of these IS is present, we
explored the mode of its activation in the five clinical strains which
are part of our collection of 65 cfiA-positive strains.
Species identification was carried out using API 20A and API 32A strips
(bioMérieux, Marcy-l'Etoile, France). Identification of all
strains given in Fig. 1 was confirmed by
nucleotide sequence analysis of 16S ribosomal DNA segments amplified
with the primers BF16SF (TAACTCCGTGCCAGCAGC) and BF16SR
(GTGGACTACCAGGGTATC) and Extra-pol II DNA polymerase
(Eurobio, Les Ulis, France) under standard conditions (1).
The regions upstream of cfiA were amplified with primers E
(CTTCGAATTCGGCGAGGGATACATAA) and G
(CGCCAAGCTTTGCCTGCCATTAT), specific for sequences upstream
of the known IS insertion sites and cfiA, respectively
(17). The nucleotide sequences of the PCR-generated
fragments were determined by a commercial provider (Génome
Express, Montreuil, France) or by using the Thermo Sequenase [33P] Terminator Cycle Sequencing kit from Amersham. New
primers were synthesized as sequence determination proceeded. All
sequences were determined in duplicate on both strands.
View larger version (32K):
[in this window]
[in a new window]
|
FIG. 1.
Relative efficiency of cfiA transcription
mediated by various IS elements as related to susceptibility to
imipenem. a, autoradiograph of RNA-DNA slot blot hybridization with
total RNA and a 32P-labeled cfiA probe; b,
relative intensity determined after densitometry of the autoradiograph;
c, MIC IMI, minimal inhibitory concentration of imipenem; d, absence
( ) or presence (+) of cfiA (in BFr81 there is no IS
upstream of cfiA).
|
|
Two novel IS elements were identified, IS1187 in four of the
imipenem-resistant strains and IS1188 in one strain (Fig.
1). IS1187 was 1,026 bp in length, had 21-bp inverted
repeats (with one mismatch), and contained one major open reading
frame, spanning most of the element, with a protein-coding capacity of
326 amino acids (aa), a deduced molecular size of 37.5 kDa, and a
theoretical pI of 9.3. The stop codon of this reading frame was
located within the right inverted repeat. The inverted repeats were
flanked by direct repeats of 9 bp in BFr1757 and BFr1761 and 8 bp (with
one mismatch) in BFr1758 and BFr1760 (Fig.
2). The second element, IS1188, was 1,691 bp in length, had 17-bp inverted repeats
(with three mismatches), and contained two major open reading frames, one with a protein-coding capacity of 448 aa, a deduced molecular size
of 52.5 kDa, and a theoretical pI of 9.5; the other, on the opposite
strand, with a protein-coding capacity of 140 aa, a molecular size of
16.3 kDa, and a theoretical pI of 9.7. The inverted repeats of this
element were flanked by direct repeats of 4 bp (Fig. 2).
View larger version (19K):
[in this window]
[in a new window]
|
FIG. 2.
Insertion sites and direct repeats of insertion
sequences activating cfiA transcription. Direct repeats are
underlined and mismatches are shown below the line. a, sequence
upstream from cfiA in strain BFr81 with the ribosomal
binding site (RBS) and translation initiation codon shown in bold; b,
sequence in BFR81R (17); c, e, and f, sequences in BFr908, BFr271R, and
BFr930, respectively (I. Podglajen, unpublished); d, sequence
in strains TAL2480 (31) and TAL3636 (18, 19);
g, h, i, and k, sequences in strains BFr902, BFr1757, BFr1758 and
BFr1760, and BFr1761, respectively. Nucleotide variations with
respect to BFr81 are shown in lower case; , no nucleotide at
that position.
|
|
Insertion of both elements occurred within ca. 90 bp upstream from the
initiation codon of cfiA and in all but one case occurred very close to the sites at which insertion of all IS elements known or
suspected to carry cfiA-activating promoters has been observed previously (Fig. 2).
The copy numbers of IS1187 and IS1188 were
estimated in cfiA-positive and cfiA-negative
strains (see below) using IS-specific probes after digestion of
chromosomal DNA with AvaI and Southern hybridization
(17). Probes specific for the respective
transposase-coding regions were generated with primers BF1187F
(CGTATTGCAGAATGGTAAGTGC) and BF1187R
(GTTCCACGTCGTGGTCCTGTTC) amplifying a 725-bp fragment of IS1187 and primers BF1188F (GGCCTGTGCTCACAACCGAC)
and BF1188R (CGGTATGCGGTCACATATGC) amplifying a 778-bp
fragment of IS1188. The probes were randomly labeled with
the Megaprime kit and [
-32P]dCTP from Amersham. The
copy numbers of the two elements varied between one in the two
cfiA-negative strains, as for IS1187 in BFr1763
and IS1188 in BFr1765, and three to at least five in the cfiA-positive strains (Fig.
3). Since neither IS contained an AvaI site, each band should represent at least one element.
The differences in hybridization intensity might reflect the existence of incomplete copies or, perhaps more likely, of copies with some sequence divergence (IS isoforms). Such an element, with 74% homology to IS1187, has been observed in a clinical B. fragilis isolate in the United Kingdom while this work was under
way (3).
View larger version (81K):
[in this window]
[in a new window]
|
FIG. 3.
Copies of IS1187 and IS1188 in the
B. fragilis strains studied. AvaI-digested total
DNA was hybridized, after Southern blotting, with probes specific for
IS1187 (five leftmost lanes) or IS1188 (two
rightmost lanes). Strains are given in Fig. 1, except for BFr1763;
BFr1763 and BFr1765 were imipenem susceptible and cfiA
negative.
|
|
When criteria for grouping IS (13, 14) were applied,
IS1187 and IS1188 appeared to be members of the
IS5 family. There was agreement with the overall size of the
elements and the size of the inverted and direct repeats. Furthermore,
identities in the vicinity of the amino acids of the DDE triad, a
conserved motif of the active site of IS transposases (13,
14), indicated a relationship of the putative transposase of
IS1187 with that of IS5 and of the transposase of
IS1188 with that of IS1031, representative of a
subgroup of the IS5 family (Fig.
4) (13).
View larger version (15K):
[in this window]
[in a new window]
|
FIG. 4.
DDE motifs in the putative transposases of
IS1187 and IS1188. Data for IS5 and
IS1031 were taken from Mahillon and Chandler
(13), who also assigned IS1186
(17) to the IS5 family.
|
|
When the amino acid sequences of the putative transposases were
compared with sequences in the databases, that of IS1187 was most closely related to a plasmid-coded transposase of ISRa1 from Riemerella anatipestifer (33), with 45%
identities and 66% equivalencies over a stretch of 300 aa, to a
transposase from Clostridium cellulovorans (30) (34% identities, 50% equivalencies, over a stretch
of 251 aa) and to the transposase of IS982 from lactococci
(34) (29% identities, 45% equivalencies, over a stretch
of 189 aa). The putative transposase of IS1188 was most
closely related to similar proteins coded by an IS element from a
Sphingomonas sp. (4) (32% identities, 51%
equivalencies, over a stretch of 418 aa), by IS1380 from
Acetobacter pasteurianus (29) (31% identities, 47% equivalencies, over a stretch of 447 aa), and by the chromosome of
Bacillus halodurans (28).
The G+C contents of IS1187 (42.9 mol%) and
IS1188 (46.1 mol%) were quite close to the values of 40.1, 42, and 46.6 mol% for IS942 (19),
IS4351 (20), and IS1186
(17), respectively, and 42 mol% for the B. fragilis chromosome overall (27). These values
neither support nor preclude the possibility of a foreign origin of the
IS elements.
Incidence of IS1187 and IS1188 among
B. fragilis isolates.
The IS elements reported
previously in Bacteroides appear to exist primarily in the
small cfiA-positive subgroup of B. fragilis, where they are chromosome borne (16). To test the
possibility that this was true also for IS1187 and
IS1188, we carried out dot blot hybridization experiments
using the IS-specific probes. Seventy-five randomly collected
cfiA-negative B. fragilis strains, mostly from
our laboratory collection or kindly provided by I. Casin and L. Dubreuil, were assayed for the presence of the two elements.
Hybridization was positive with each element in one strain but did not
occur with any of the several plasmids in the size range of ca. 3 to 8 kb that were present in both strains (data not shown). This suggested a
chromosomal location of the elements in these strains. Except for
IS1224 (27), no IS has been reported as being
chromosome borne outside of the cfiA-positive group. In the
cases where IS942 or IS1186 or isoforms thereof have been described outside of this group (7, 32), they
were carried on small plasmids. There was no coresidence in the
IS1187- or IS1188-bearing strains with one of the
three known IS elements IS942, IS1186, or
IS4351, combinations of which, by contrast, were observed in
about one-third of the 50 cfiA-positive strains analyzed
previously (16). Whether the absence of such a coresidence reflects a recent introduction of IS1187 or
IS1188 or both into B. fragilis remains a matter
of speculation.
Expression of cfiA in IS1187- or
IS1188-bearing strains.
Expression of cfiA
was studied by Northern hybridization using a slot blot procedure with
cesium chloride gradient-purified RNA (10 µg per slot) and a
32P-labeled cfiA probe. The relative efficiency
of cfiA transcription was estimated after densitometry of
the autoradiograph (Fig. 1). There was an apparent correlation between
the degree of cfiA transcription and the level of resistance
to imipenem, with a somewhat lower relative level of transcription in
strain BFr902. Considering that IS1187 and IS1188
had inserted within a ca. 90-bp stretch upstream of a cfiA
copy located at the same chromosomal site in all strains (as deduced
from the immediate upstream nucleotide sequences) and close to the
insertion sites previously reported for other IS (Fig. 2), it seemed
likely that these two IS also provided promoters for cfiA
transcription. Close inspection of the IS1187 and
IS1188 sequences revealed the existence, as in IS1186 (17) and IS942
(19), of hexamers (see Fig. 6) potentially corresponding
to 35 and 10 consensus sequences of promoters recognized by the
primary sigma factor in Escherichia coli (21). To accurately map the sites of transcription initiation of
cfiA in IS1187 and IS1188 and to
contribute to the still-limited knowledge of promoter structures in
Bacteroides, we applied the 5' RACE System (Rapid
Amplification of cDNA Ends, version 2; GibcoBRL-Life Technologies)
according to the manufacturer's instructions, except that RNA was
prepared as for the Northern blots. RNA from strains BFr1757
(IS1187) and BFr902 (IS1188), and comparatively
from strains BFr81R (IS1186) and TAL2480 (IS942),
was used. The primers for reverse transcription and for nested PCRs 1 and 2, respectively, were GSP1cfiA
(GATAACAATCATCCCGTTGGAAGGTACCATACCCC), GSP2cfiA (CCTTCGATTTCGGCGAGGGATACATAAGTGTACAC), and primer H
(17). The fragments generated during the final PCR are
shown in Fig. 5. Sequence determination
of these fragments indicated that all transcripts started with an
adenine, flanked in three out of the four cases by a consensus C(1)
and T(+2) (21), and located a few nucleotides downstream
from an octameric motif, strongly or perfectly resembling the octameric
sequence TAnnTTTG (Fig. 6). This "7
motif," together with a "33 motif," TTTG, has recently been
identified 1 to 12 bp upstream from the transcription initiation sites
of over 20 B. fragilis genes and shown to be essential,
by in vitro mutagenesis, for promoter activity in cepA
(2). There were two consecutive 7 motifs in
IS1187. In IS1186 and IS1188, the
octameric motifs overlapped with a putative consensus
E
70 promoter at the 10 hexamer, and the TTG triplet of
the 33 motif overlapped with the 35 hexamer. There was no such
overlap in IS942 and IS1187, but putative
E70 promoter sequences were observed at some distance
downstream or upstream, respectively (Fig. 6). Whether the 10 and
35 hexamers may be functional in 70
homologue-producing species more closely related to the
Enterobacteriaceae remains to be tested experimentally. This
possibility leads to the further speculation that the multiplicity of
consensus sequences might endow Bacteroides IS elements with
the potential to provide mobile promoters to distantly related
bacterial species.
View larger version (55K):
[in this window]
[in a new window]
|
FIG. 5.
Mapping of cfiA transcripts by 5' RACE. Lane
1, strain BFr1757 (IS1187); lane 2, BFr902
(IS1188); lane 3, TAL2480 (IS942); lane 4, BFr81R
(IS1186); lane M, molecular size standards (123-bp DNA
ladder; Gibco BRL-Life Sciences).
|
|
View larger version (8K):
[in this window]
[in a new window]
|
FIG. 6.
Start sites of cfiA transcription downstream
from putative promoter sequences in B. fragilis IS elements.
Start sites determined by 5' RACE are indicated by an arrow, and
the distance to the translation initiation codon is indicated in base
pairs. Consensus sequences of the B. fragilis promoter
sequences (TTTG ["33"], TAnnTTTG ["7"])
(2) are shown in bold. Putative 35 and 10 hexamers of
the E. coli E70 promoter (21)
are underlined.
|
|
With respect to cfiA, the number of known mobile promoters,
currently five, that this rare and normally promoterless gene is able
to recruit in order to ensure its transcription is quite remarkable. It
is conceivable that the use of carbapenems has somehow favored the
accumulation of IS elements in the cfiA-positive B. fragilis population, or alternatively, that this population might
possess particular factors enhancing their acquisition or transposition.
Nucleotide sequence accession numbers.
The nucleotide
sequences of IS1187 and IS1188 have been
deposited in the GenBank and EMBL databases under the accession numbers Y18979 and AJ277413, respectively.
This work was supported by grants from the Institut National de la
Santé et de la Recherche Médicale (CRI 95-06) and the MENRT-sponsored Programme de Recherche Fondamentale en Microbiologie et
Maladies Infectieuses et Parasitaires.
We gratefully acknowledge I. Casin and L. Dubreuil for the gift of
strains and P. Bertin for critically reading the manuscript.
| 1.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl.
1992.
Short protocols in molecular biology, 2nd ed.
Greene Publishing Associates and John Wiley & Sons, Inc., New York, N.Y.
|
| 2.
|
Bayley, D. P.,
E. R. Rocha, and C. J. Smith.
2000.
Analysis of cepA and other Bacteroides fragilis genes reveals a unique promoter structure.
FEMS Microbiol. Lett.
193:149-154[CrossRef][Medline].
|
| 3.
|
Edwards, R., and P. N. Read.
2000.
Expression of the carbapenemase gene (cfiA) in Bacteroides fragilis.
J. Antimicrob. Chemother.
46:1009-1012[Abstract/Free Full Text].
|
| 4.
|
Feng, X.,
L. T. Ou, and A. Ogram.
1997.
Cloning and sequence analysis of a novel insertion element from plasmids harbored by the carbofuran-degrading bacterium, Sphingomonas sp. CFO6.
Plasmid
37:169-179[CrossRef][Medline].
|
| 5.
|
Goussard, S.,
W. Sougakoff,
C. Mabilat,
A. Bauernfeind, and P. Courvalin.
1991.
An IS1-like element is responsible for high-level synthesis of extended-spectrum beta-lactamase TEM-6 in Enterobacteriaceae.
J. Gen. Microbiol.
137:2681-2687[Medline].
|
| 6.
|
Gutacker, M.,
C. Valsangiacomo, and J. C. Piffaretti.
2000.
Identification of two genetic groups in Bacteroides fragilis by multilocus enzyme electrophoresis: distribution of antibiotic resistance (cfiA, cepA) and enterotoxin (bft) encoding genes.
Microbiology
146:1241-1254[Abstract/Free Full Text].
|
| 7.
|
Haggoud, A.,
G. Reysset,
H. Azeddoug, and M. Sebald.
1994.
Nucleotide sequence analysis of two 5-nitroimidazole resistance determinants from Bacteroides strains and of a new insertion sequence upstream of the two genes.
Antimicrob. Agents Chemother.
38:1047-1051[Abstract/Free Full Text].
|
| 8.
|
Hammerschmidt, S.,
R. Hilse,
J. P. van Putten,
R. Gerardy-Schahn,
A. Unkmeir, and M. Frosch.
1996.
Modulation of cell surface sialic acid expression in Neisseria meningitidis via a transposable genetic element.
EMBO J.
15:192-198[Medline].
|
| 9.
|
Hubner, A., and W. Hendrickson.
1997.
A fusion promoter created by a new insertion sequence, IS1490, activates transcription of 2,4,5-trichlorophenoxyacetic acid catabolic genes in Burkholderia cepacia AC1100.
J. Bacteriol.
179:2717-2723[Abstract/Free Full Text].
|
| 10.
|
Kallastu, A.,
R. Horak, and M. Kivisaar.
1998.
Identification and characterization of IS1411, a new insertion sequence which causes transcriptional activation of the phenol degradation genes in Pseudomonas putida.
J. Bacteriol.
180:5306-5312[Abstract/Free Full Text].
|
| 11.
|
Kusumoto, M.,
Y. Nishiya, and Y. Kawamura.
2000.
Reactivation of insertionally inactivated Shiga toxin 2 genes of Escherichia coli O157:H7 caused by nonreplicative transposition of the insertion sequence.
Appl. Environ. Microbiol.
66:1133-1138[Abstract/Free Full Text].
|
| 12.
|
Lopez de Felipe, F.,
C. Magni,
D. de Mendoza, and P. Lopez.
1996.
Transcriptional activation of the citrate permease P gene of Lactococcus lactis biovar diacetylactis by an insertion sequence-like element present in plasmid pCIT264.
Mol. Gen. Genet.
250:428-436[Medline].
|
| 13.
|
Mahillon, J., and M. Chandler.
1998.
Insertion sequences.
Microbiol. Mol. Biol. Rev.
62:725-774[Abstract/Free Full Text].
|
| 14.
|
Mahillon, J.,
C. Leonard, and M. Chandler.
1999.
IS elements as constituents of bacterial genomes.
Res. Microbiol.
150:675-687[Medline].
|
| 15.
|
Maki, H., and K. Murakami.
1997.
Formation of potent hybrid promoters of the mutant 11m gene by IS256 transposition in methicillin-resistant Staphylococcus aureus.
J. Bacteriol.
179:6944-6948[Abstract/Free Full Text].
|
| 16.
|
Podglajen, I.,
J. Breuil,
I. Casin, and E. Collatz.
1995.
Genotypic identification of two groups within the species Bacteroides fragilis by ribotyping and by analysis of PCR-generated fragment patterns and insertion sequence content.
J. Bacteriol.
177:5270-5275[Abstract/Free Full Text].
|
| 17.
|
Podglajen, I.,
J. Breuil, and E. Collatz.
1994.
Insertion of a novel DNA sequence, IS1186, upstream of the silent carbapenemase gene cfiA, promotes expression of carbapenem resistance in clinical isolates of Bacteroides fragilis.
Mol. Microbiol.
12:105-114[Medline].
|
| 18.
|
Rasmussen, B. A.,
Y. Gluzman, and F. P. Tally.
1990.
Cloning and sequencing of the class B beta-lactamase gene (ccrA) from Bacteroides fragilis TAL3636.
Antimicrob. Agents Chemother.
34:1590-1592[Abstract/Free Full Text].
|
| 19.
|
Rasmussen, B. A., and E. Kovacs.
1991.
Identification and DNA sequence of a new Bacteroides fragilis insertion sequence-like element.
Plasmid
25:141-144[CrossRef][Medline].
|
| 20.
|
Rasmussen, J. L.,
D. A. Odelson, and F. L. Macrina.
1987.
Complete nucleotide sequence of insertion element IS4351 from Bacteroides fragilis.
J. Bacteriol.
169:3573-3580[Abstract/Free Full Text].
|
| 21.
|
Record, J.,
M. T. Reznikoff,
W. S. Craig,
M. L. McQuade, and P. J. Schlax.
1996.
Escherichia coli RNA polymerase (E70), promoters, and the kinetics of the steps of transcription initiation, p. 792-820.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 1. ASM Press, Washington, D.C.
|
| 22.
|
Rogers, M. B.,
T. K. Bennett,
C. M. Payne, and C. J. Smith.
1994.
Insertional activation of cepA leads to high-level beta-lactamase expression in Bacteroides fragilis clinical isolates.
J. Bacteriol.
176:4376-4384[Abstract/Free Full Text].
|
| 23.
|
Ruimy, R.,
I. Podglajen,
J. Breuil,
R. Christen, and E. Collatz.
1996.
A recent fixation of cfiA genes in a monophyletic cluster of Bacteroides fragilis is correlated with the presence of multiple insertion elements.
J. Bacteriol.
178:1914-1918[Abstract/Free Full Text].
|
| 24.
|
Salyers, A. A.
1984.
Bacteroides of the human lower intestinal tract.
Annu. Rev. Microbiol.
38:293-313[CrossRef][Medline].
|
| 25.
|
Salyers, A. A., and N. B. Shoemaker.
1996.
Resistance gene transfer in anaerobes: new insights, new problems.
Clin. Infect. Dis.
23(Suppl. 1):S36-S43.
|
| 26.
|
Salyers, A. A.,
N. B. Shoemaker, and L. Y. Li.
1995.
In the driver's seat: the Bacteroides conjugative transposons and the elements they mobilize.
J. Bacteriol.
177:5727-5731[Free Full Text].
|
| 27.
|
Smith, C. J.,
G. D. Tribble, and D. P. Bayley.
1998.
Genetic elements of Bacteroides species: a moving story.
Plasmid
40:12-29[CrossRef][Medline].
|
| 28.
|
Takami, H.,
K. Nakasone,
Y. Takaki,
G. Maeno,
R. Sasaki,
N. Masui,
F. Fuji,
C. Hirama,
Y. Nakamura,
N. Ogasawara,
S. Kuhara, and K. Horikoshi.
2000.
Complete genome sequence of the alkaliphilic bacterium Bacillus halodurans and genomic sequence comparison with Bacillus subtilis.
Nucleic Acids Res.
28:4317-4331[Abstract/Free Full Text].
|
| 29.
|
Takemura, H.,
S. Horinouchi, and T. Beppu.
1991.
Novel insertion sequence IS1380 from Acetobacter pasteurianus is involved in loss of ethanol-oxidizing ability.
J. Bacteriol.
173:7070-7076[Abstract/Free Full Text].
|
| 30.
|
Tamaru, Y.,
S. Karita,
A. Ibrahim,
H. Chan, and R. H. Doi.
2000.
A large gene cluster for the Clostridium cellulovorans cellulosome.
J. Bacteriol.
182:5906-5910[Abstract/Free Full Text].
|
| 31.
|
Thompson, J. S., and M. H. Malamy.
1990.
Sequencing the gene for an imipenem-cefoxitin-hydrolyzing enzyme (CfiA) from Bacteroides fragilis TAL2480 reveals strong similarity between CfiA and Bacillus cereus beta-lactamase II.
J. Bacteriol.
172:2584-2593[Abstract/Free Full Text].
|
| 32.
|
Trinh, S.,
A. Haggoud,
G. Reysset, and M. Sebald.
1995.
Plasmids pIP419 and pIP421 from Bacteroides: 5-nitroimidazole resistance genes and their upstream insertion sequence elements.
Microbiology
141:927-935[Abstract].
|
| 33.
|
Weng, S.,
W. Lin,
Y. Chang, and C. Chang.
1999.
Identification of a virulence-associated protein homolog gene and ISRa1 in a plasmid of Riemerella anatipestifer.
FEMS Microbiol. Lett.
179:11-19[CrossRef][Medline].
|
| 34.
|
Yu, W.,
I. Mierau,
A. Mars,
E. Johnson,
G. Dunny, and L. L. McKay.
1995.
Novel insertion sequence-like element IS982 in lactococci.
Plasmid
33:218-225[CrossRef][Medline].
|
| 35.
|
Ziebuhr, W.,
V. Krimmer,
S. Rachid,
I. Lossner,
F. Gotz, and J. Hacker.
1999.
A novel mechanism of phase variation of virulence in Staphylococcus epidermidis: evidence for control of the polysaccharide intercellular adhesin synthesis by alternating insertion and excision of the insertion sequence element IS256.
Mol. Microbiol.
32:345-356[CrossRef][Medline].
|
![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Top
Abstract
Text
