This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Amaya, E.
Right arrow Articles by Piggot, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Amaya, E.
Right arrow Articles by Piggot, P. J.

 Previous Article  |  Next Article 

Journal of Bacteriology, June 2001, p. 3623-3630, Vol. 183, No. 12
0021-9193/01/$04.00+0   DOI: 10.1128/JB.183.12.3623-3630.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

Analysis of Promoter Recognition In Vivo Directed by sigma F of Bacillus subtilis by Using Random-Sequence Oligonucleotides

Edward Amaya,dagger Anastasia Khvorova,Dagger and Patrick J. Piggot*

Department of Microbiology and Immunology, Temple University School of Medicine, Philadelphia, Pennsylvania 19140

Received 27 December 2000/Accepted 26 March 2001


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Formation of spores from vegetative bacteria by Bacillus subtilis is a primitive system of cell differentiation. Critical to spore formation is the action of a series of sporulation-specific RNA polymerase sigma  factors. Of these, sigma F is the first to become active. Few genes have been identified that are transcribed by RNA polymerase containing sigma F (E-sigma F), and only two genes of known function are exclusively under the control of E-sigma F, spoIIR and spoIIQ. In order to investigate the features of promoters that are recognized by E-sigma F, we studied the effects of randomizing sequences for the -10 and -35 regions of the promoter for spoIIQ. The randomized promoter regions were cloned in front of a promoterless copy of lacZ in a vector designed for insertion by double crossover of single copies of the promoter-lacZ fusions into the amyE region of the B. subtilis chromosome. This system made it possible to test for transcription of lacZ by E-sigma F in vivo. The results indicate a weak sigma F-specific -10 consensus, GG/tNNANNNT, of which the ANNNT portion is common to all sporulation-associated sigma  factors, as well as to sigma A. There was a rather stronger -35 consensus, GTATA/T, of which GNATA is also recognized by other sporulation-associated sigma  factors. The looseness of the sigma F promoter requirement contrasts with the strict requirement for sigma A-directed promoters of B. subtilis. It suggests that additional, unknown, parameters may help determine the specificity of promoter recognition by E-sigma F in vivo.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Formation of spores from vegetative bacteria by Bacillus subtilis is a primitive system of cell differentiation. A hallmark of B. subtilis sporulation is an asymmetric division that produces two cells of unequal size, the smaller prespore and the larger mother cell. The prespore develops into the mature, heat-resistant spore, whereas the mother cell ultimately lyses. These radically different developmental fates are in part determined by the action of a series of sporulation-specific RNA polymerase sigma  factors: sigma F and sigma G in the prespore and sigma E and sigma K in the mother cell. Of these, sigma F is the first to become active (reviewed in references 17 and 36).

Sigma factors determine the promoter recognition specificity of RNA polymerase. Comparative analysis of different promoters and analysis of promoter mutations have revealed that two regions centered at approximately 35 and 10 nucleotides upstream of the transcription start point are of prime importance for promoter recognition directed by the majority of sigma  factors. They are generally referred to as the -35 and -10 regions. By far the most extensively studied promoters are those for the major vegetative sigma  factors sigma 70 of Escherichia coli and sigma A of B. subtilis. For both of these sigma  factors, the consensus -35 sequence is TTGACA and the -10 consensus is TATAAT. The distance between these two sequences is also important and varies mostly between 16 and 18 nucleotides. Although the sequences at these two regions are not strictly conserved, B. subtilis promoters conform much more closely to the consensus than do those of E. coli (11). The different promoters for the sporulation-associated sigma  factors of B. subtilis are less firmly defined (9).

The complex regulation of sigma F activation is increasingly becoming understood (16, 17). However, much less is known about promoters recognized by RNA polymerase containing sigma F (E-sigma F). Few genes have been identified that are transcribed by E-sigma F (9). The two genes of known function that are exclusively under the control of E-sigma F are spoIIR (13, 20) and spoIIQ (19); PspoIIQ is much the stronger of the two promoters. Several E-sigma F-transcribed genes are also transcribed by E-sigma G (9), whose promoter specificity overlaps that of E-sigma F (9), whereas the specificity of one overlaps that of E-sigma B (28).

In order to investigate the features of promoters that are recognized by E-sigma F, we have employed a method based on that developed by Oliphant and Struhl (23, 24) to study sigma A promoters of E. coli. The method utilizes chemically synthesized DNA sequences that are degenerate in a predefined region. In the present study, the randomized sequences were for the -10 and -35 regions of the promoter for spoIIQ. Randomized promoter regions were cloned in front of a promoterless copy of lacZ in a vector designed for insertion by double crossover of single copies of the promoter-lacZ fusions into the amyE region of the B. subtilis chromosome. This system made it possible to test for transcription of lacZ by E-sigma F in vivo. The results indicate a weak sigma F-specific -10 consensus and a rather stronger -35 consensus. The looseness of the sigma F promoter requirement contrasts with the strict requirement for sigma A promoters (11) and suggests that additional factors may determine the specificity of promoter recognition by E-sigma F in vivo.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Strains. The E. coli strain used for all cloning and clone bank amplification was DH5alpha [F- endA1 hsdR17(rK- mK+) supE44 thi-1 lambda - recA1 gyrA96 relA1 Delta (lacZYA-argF)U169 phi 80dlacZDelta M15]. The parental B. subtilis strain was BR151. The B. subtilis strains used are listed in Table 1.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   B. subtilis strains used in this study

Plasmids. All plasmids were maintained in E. coli DH5alpha . Plasmid pEIA84 is a derivative of integrative plasmid pDH32 (35), in which the spoIIQ promoter region extending from -200 to +9 was amplified by PCR and inserted into the EcoRI site (made blunt with the Klenow fragment of DNA polymerase) of pDH32, which is located immediately upstream of the lacZ ribosome binding site. Plasmid pEIA96 is a derivative of pDH32 (35) in which the cat cassette was removed by digestion with EcoRI and StuI and replaced with a neo cassette from a derivative of pBEST501 (12). pEIA98 was constructed by cloning the region upstream of SpoIIQ, extending from -200 to -38 (obtained by PCR), into the EcoRI site (made blunt with Klenow) of pEIA96.

Media. E. coli was maintained on Luria-Bertani (LB) broth or LB agar supplemented with ampicillin (100 µg/ml) when required. B. subtilis was maintained by using Schaeffer's sporulation agar (SSA) or modified Schaeffer's sporulation medium (MSSM) (30). When appropriate, B. subtilis was grown in the presence of antibiotics at the following concentrations: neomycin, 5 µg/ml; spectinomycin, 50 µg/ml. When required, 5-bromo-4-chloro-3-indolyl-beta -D-galactopyranoside (X-Gal) was added to SSA to a concentration of 100 µg/ml.

Nucleic acid manipulation. DNA was prepared as described previously (39). DNA sequencing was done by the dideoxy-chain termination method of Sanger et al. (33), using the Circum Vent Thermal Cycle Dideoxy DNA Sequencing Kit (New England Biolabs, Beverly, Mass.). The primers used for sequencing of cloned promoter inserts were LacZ2 (reverse) (GGGTTTTCCCGGTCG) and IIQ12 (forward) (CTATGTTCAGCAAGACGC). Cellular RNA was extracted essentially as described by Penn et al. (27). Primer extension analyses were performed as described previously (39).

The PCR was based on the protocol of Sambrook et al. (32). One hundred picomoles of each oligonucleotide and 2.0 µg of chromosomal template DNA, 0.2 µg of a PCR fragment, or 1.0 µg of plasmid template DNA were added to the PCR mixture. The PCR was carried out with Taq polymerase (Fisher, Pittsburgh, Pa.) or Pfu polymerase (Statagene, La Jolla, Calif.) in the appropriate amplification buffer with deoxynucleoside triphosphates (dNTPs; 0.25 mM each dNTP) in a final volume of 100 µl.

Transformation. B. subtilis transformation was performed as described previously (31). When large numbers of colonies were being screened as donors in transformations, donor DNA was not purified. Instead, a modification of the method of Ephrati-Elizur (6) was used essentially as described previously (29). Donor strains were grown in LB broth to stationary phase, at which stage they secreted DNA onto the cell surface or into the medium (6). A volume of 0.05 ml of these cultures was used as a donor and added to 0.5 ml of the culture of a competent recipient. This method required counterselection against the donor.

Induction of the Pspac promoter by IPTG. Overnight cultures were diluted 100-fold into prewarmed MSSM and incubated at 37°C with aeration. Induction of Pspac by addition of 1 mM isopropyl-beta -D-thiogalactopyranoside (IPTG) was performed as described previously (34)

beta -Galactosidase activity. B. subtilis strains grown in MSSM at 37°C were assayed with o-nitrophenyl-beta -D-galactopyranoside as substrate essentially as described by Nicholson and Setlow (22). beta -Galactosidase specific activity is expressed as nanomoles of o-nitrophenyl-beta -D-galactopyranoside hydrolyzed per minute per milligram (dry weight) of bacteria.

Construction of randomized spoIIQ promoter clone banks. Clone banks were constructed as described by Oliphant and Struhl (23), with some modifications. Approximately 50 pmol of oligonucleotides R10IIQup and R35IIQup was phosphorylated with 5 U of T4 polynucleotide kinase and ATP for 1 h at 37°C in separate 1.5-ml microcentrifuge tubes. These oligonucleotides consisted of the spoIIQ promoter region extending from -37 to +9, with positions -14 to -7 (R10IIQup) or -35 to -31 (R35IIQup) randomized. The phosphorylated oligonucleotides were cleaned by precipitation and resuspended in 10 µl of sterile distilled water. Next, 50 pmol of oligonucleotide IIQext was added, separately, to the phosphorylated R10IIQup and R35IIQup oligonucleotides. Primer IIQext has 15 bases, corresponding to spoIIQ positions +9 to -6, that hybridize to R10IIQup and R35IIQup and also a 12-nucleotide extension downstream of +9 that will form a BamHI restriction site. The mixtures were heated to 90°C for 5 min and then cooled to room temperature slowly. After the annealing, Klenow buffer (1× final concentration), dNTPs (0.25 mM final concentration of each dNTP), and 5 U of Klenow fragment were added in a final volume of 30 µl. The mixtures were incubated in 37°C for 1 h and then fractionated by electrophoresis in a 4% NuSieve GTG agarose gel. The appropriate double-stranded DNA (dsDNA) band was excised from the gel and purified by using the QIAEX II (Qiagen, Chatsworth, Calif.) gel extraction kit. Approximately 2 µg of dsDNA from each preparation was digested with BamHI and purified. The resulting oligonucleotides, with a blunt end at -37 and a BamHI site at +9, were ligated to pEIA98 previously digested with StuI and BamHI. As the yield of dsDNA was somewhat variable, the amount of insert to be added to a given amount of vector was determined empirically in order to optimize the ligation reactions. In this way, random -10 (R10) and random -35 (R35) clone banks were obtained by using the framework of PspoIIQ.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Test system for analysis of E-sigma F-transcribed promoters. The two well-characterized loci that are known to be transcribed only by E-sigma F are spoIIR (13, 20) and spoIIQ (19). Primer extension analysis was used to identify the 5' end of the spoIIQ transcript and hence to infer the transcription start point and promoter. RNA was isolated from B. subtilis strain SL5618 4 h after the start of sporulation. Primer extension analysis was performed, and the same 5' end was identified with two different primers (Fig. 1). It is inferred that this represents the transcription start point. The sequence of the spoIIQ promoter is indicated in Fig. 2. The deduced spoIIQ promoter -10 and -35 regions are indicated in bold. A similar analysis was performed for spoIIR (data not shown). The deduced spoIIR promoter agreed with that predicted previously (Fig. 2) (13). Also shown are the promoter regions for genes known to be transcribed in vivo by E-sigma F and whose transcription start point has been inferred from primer extension analysis.


View larger version (66K):
[in this window]
[in a new window]
 
FIG. 1.   Determination of the 5' end of spoIIQ mRNA by primer extension analysis. RNA was extracted from strain SL5618 (spoIIIGDelta 1) 4 h after the end of exponential growth. Primer extension analysis was done with primer IIQ2 (TCAGCCAACGGATCCTTTACC, positions +161 to +181 from the inferred transcription start point) (A) and primer IIQ10 (CTGATTGATACCAAAGGAC, positions +128 to +147 from the inferred transcription start point) (B). Sequencing ladders using the same primers are also shown. The likely transcription start site is indicated by an asterisk.


View larger version (26K):
[in this window]
[in a new window]
 
FIG. 2.   Sequence alignment of promoter regions for E-sigma F-transcribed genes for which the transcription start site has been inferred by primer extension analysis. Of these, only spoIIQ, spoIIR, and katX are not also recognized by E-sigma F (1-3, 5, 7, 8, 13, 34, 37-39). Asterisks indicate spaces introduced to adjust the spacing between the -10 and -35 consensuses. The underlined bases indicate the inferred transcription start points.

The spoIIQ promoter was chosen for the analysis of E-sigma F-transcribed promoters because it is the strongest promoter known to be transcribed by E-sigma F and it is transcribed only by E-sigma F. Initial experiments indicated that the spoIIQ promoter region extending from -200 to +9 (relative to the inferred transcription start point) displayed maximal spoIIQ promoter activity as assayed with lacZ. In order to analyze the effects of alterations to the -10 and -35 regions, a vector, pEIA98, was constructed that contained the spoIIQ promoter region from -200 to -38 and had a StuI site at -38 and an adjacent BamHI site immediately upstream of the lacZ ribosome binding site. The vector was designed for insertion by double crossover of promoter-lacZ fusions into the amyE region of the B. subtilis chromosome (35) with selection for Neor. pEIA98 was digested with StuI and BamHI, and oligonucleotides extending from -37 to +9 were ligated into the plasmid to yield the spoIIQ promoter region from -200 to +9, with alterations as required.

Construction and analysis of a clone bank containing a randomized -10 sigma F promoter region. The procedure used to construct a library with the randomized -10 region is described in Materials and Methods. Positions -14 to -7 were randomized, with the rest of PspoIIQ kept constant from -200 to +9. In particular, the G at -15 was kept constant. Sun et al. (37) had shown that a G in this position in other promoters appeared to be necessary for sigma F recognition (although one weak sigma F /sigma G promoter, for ywhE, has recently been described that has a T at this position [26]). The ligation mixtures were used to transform E. coli, and in all, approximately 250,000 transformant colonies were obtained. Plasmids were isolated from eight of these clones, and the promoter regions were sequenced. Three or four different nucleotides were found at each of the randomized positions in the eight clones, indicating that the randomization was successful; none of the eight clones displayed sigma F promoter activity in B. subtilis (data not shown). The rest of the transformant colonies were recovered from the agar plates, and pooled plasmid DNA was prepared from them. This preparation was designated the R10 clone bank.

The R10 clone bank was initially screened with B. subtilis strain EIA87. Strain EIA87 has the spoIIIGDelta 1 mutation and so lacks sigma G, whose promoter specificity overlaps that of sigma F (9). It also contains amyE::erm to help confirm that the promoter-lacZ fusions integrate at the amyE locus by double crossover. Strain EIA87 was transformed with a portion of the R10 clone bank. Approximately 55,000 transformants were obtained on SSA containing neomycin and X-Gal. Known sigma F promoters are generally weak, and so any colony that had a detectable shade of blue was considered a potential positive clone. About 800 blue colonies were detected, and 500 of these were used for further study.

The subsequent screens of these putative sigma F responsive clones utilized them as donors in transformation with different tester strains. To readily accommodate large numbers of donors, the Ephrati-Elizur (6) method was used; in this method, DNA secreted by B. subtilis is used as the donor in transformations. The tests were for lack of expression in a strain that had the structural gene for sigma F deleted (EIA54) and for expression in a strain (SL7541) that had the structural gene for sigma E deleted, but not the structural gene for sigma F; sigma E is the next factor activated after sigma F during sporulation. Three hundred twenty-eight clones passed the screens. Of these, five were also tested for their response to artificial induction of sigma F by addition of IPTG to a strain that had the structural gene for sigma F, spoIIAC, placed under the control of the Pspac promoter; the test strain, SL7542, also contained the spoIIIGDelta 1 mutation so as to avoid possible complications from sigma G induction. beta -Galactosidase was measured to indicate promoter activity. The results are shown in Fig. 3A. Addition of IPTG resulted in induction of beta -galactosidase in all five clones but not in the strain with the lacZ fusion derived from pEIA98 (with the spoIIQ promoter region extending only from -200 to -38), confirming that the screen had identified sigma F-controlled promoters. There was no significant difference in strength among the four strongest promoters.


View larger version (24K):
[in this window]
[in a new window]
 
FIG. 3.   Effect of induction of sigma F on expression of lacZ associated with different spoIIQ promoter regions. Synthesis of sigma F was induced by addition of IPTG to strains containing the structural gene for sigma F, spoIIAC, under the control of the Pspac promoter (41). Shown are strains with alterations to the -10 region (A) and the -35 region (B) of the promoter directing lacZ. Cultures were grown in MSSM to an optical density at 600 nm of 0.3. They were then divided in two, and 1 mM IPTG was added to one of each pair. None of the cultures displayed significant beta -galactosidase activity in the absence of IPTG. (A) SL7472/EIA100 (PspoIIQ [-200 to -38]) symbols: black-lozenge , no IPTG; diamond , 1 mM IPTG. SL7472/R10-103 symbols: black-triangle, no IPTG; triangle , 1mM IPTG. SL7472/R10-333 symbols: , no IPTG; open circle , 1 mM IPTG. SL7472/R10-435 symbols: , no IPTG; , 1 mM IPTG. SL7472/R10-901 symbols: ×, no IPTG; *, 1 mM IPTG. SL7472/R10-1024 symbols: +, no IPTG; -, 1 mM IPTG. Samples grown in the absence of IPTG produced little or no beta -galactosidase, and symbols for the different cultures largely mask each other. (B) SL7472/R35-10 symbols: black-lozenge , no IPTG; diamond , 1 mM IPTG. SL7472/R35-20 symbols: black-triangle, no IPTG; triangle , 1 mM IPTG. SL7472/R35-43 symbols: , no IPTG; , 1 mM IPTG. SL7472/R35-53 symbols: , no IPTG; open circle , 1 mM IPTG. wt, weight.

Out of the 328 positive R10 clones, 35 were picked at random (by using a table of random numbers) for sequencing of the promoter region (Table 2). Four of the sequences were shifted by one base to better fit the consensus suggested by the other promoters. The variety of promoter sequences was surprising. Out of 35 R10 clones sequenced, only two were identical to each other (R10-332 and R10-333) and another one was identical to the spoIIQ -10 sequence (R10-746). If the sigma F -10 consensus sequence were highly conserved, then more sequences in the set would have been expected to be identical to each other. Measurement of beta -galactosidase activities of liquid cultures confirmed that the 35 clones contained promoters that were induced during sporulation. However, statistical analysis using the Kruskal-Wallis test indicated that fine distinctions could not be made between the strengths of the promoters (M. L. Higgins, personal communication).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Promoter sequences from the R10 clone bank that responded to E-sigma F

Construction and analysis of a clone bank containing a randomized -35 sigma F promoter region. The -35 clone bank was constructed in a way similar to that used for the R10 clone bank, as described in Materials and Methods. Five bases, from -35 to -31 in the spoIIQ promoter, were randomized. Ligation mixes were used to transform E. coli, and about 7,700 transformants were obtained. The transformant colonies were recovered, and pooled plasmid DNA was prepared from them; this preparation is referred to as the R35 clone bank. The same general procedure was used to screen the R35 and R10 banks. Transformation of EIA87 with a portion of the R35 bank yielded 3,300 colonies on SSA containing neomycin and X-Gal; of these, 64 appeared blue after 2 days at 37°C. These were presumed to represent distinct clones. All 64 clones were screened for sigma F-responsive promoter activity, as described for the R10 bank; 44 passed the screens and were presumed to contain sigma F-controlled promoters. Four of the 44 presumptive sigma F-controlled promoter clones were also tested for their response to artificial induction of sigma F by addition of IPTG to a strain (SL7542) that had the structural gene for sigma F, spoIIAC, placed under the control of the Pspac promoter. beta -Galactosidase was measured to indicate promoter activity. The results are shown in Fig. 3B. Addition of IPTG resulted in induction of beta -galactosidase in all four clones.

Out of the 44 positive R35 clones, 18 were picked at random (by using a table of random numbers) for sequencing. The results of the sequencing are in Table 3. These data suggested a tight consensus for the -35 region. Plasmids were also prepared from 11 R35 clones that were negative for sigma F activity and from eight of the original E. coli transformants used to make the R35 plasmid bank; sequence analysis indicated 19 unique sequences that showed no conformity to the consensus deduced for the positive clones. This result indicated that the randomization was successful.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 3.   Promoter sequences from the R35 bank that responded to E-sigma F

Distinguishing promoters recognized only by E-sigma F from those recognized by both E-sigma F and E-sigma G. As mentioned previously, sigma F and sigma G have overlapping promoter specificities (9, 37). The positive, sequenced clones from the R10 and R35 banks were tested for beta -galactosidase expression in a B. subtilis strain, SL5037, that lacked sigma F but had sigma G activity. This strain has the spoIIADelta 4 mutation that deletes most of the spoIIA operon, including spoIIAC, which encodes sigma F, and spoIIAB, which encodes a negative regulator of sigma G (15, 31); apparently as a consequence of the deletion of spoIIAB, sigma G becomes active even though sigma F is absent (V. K. Chary and P. J. Piggot, unpublished observations). Promoter-lacZ fusions were introduced into SL5037 by transformation. As controls, dacF-lacZ (responding to sigma F and sigma G) and spoIIQ-lacZ (responding only to sigma F) were also introduced into SL5037. Transformants were selected on SSA containing neomycin with X-Gal. Transformants were scored after a 2-day incubation at 37°C. Colonies of the positive control (dacF-lacZ) were blue; colonies of the negative control (spoIIQ-lacZ) were white. By this test, 10 of the 35 R10 promoter-lacZ fusions responded to sigma G. None of the R35 promoter-lacZ fusions was responsive. The failure of the R35 clones to respond to sigma G is thought to result from their having the -10 sequence of the spoIIQ promoter, which is presumed to prevent recognition by E-sigma G. The responses of the different R10 clones to sigma G are indicated in Table 2. Seven of the natural promoters responded to sigma G, while three did not (Fig. 1). The frequencies of bases at different positions are shown in Table 4 for promoters that responded to sigma G and for those that did not; data for natural promoters and for the R10 bank are combined.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 4.   Frequencies of occurrence of different nucleotides in the -10 region of promoters recognized by E-sigma Fa

Search for sigma F-controlled genes by computer-assisted analysis. The putative sigma F consensus sequence, as defined above, was used to search the B. subtilis database for any potential promoter within 100 nucleotides upstream of an open reading frame by utilizing the search tools provided by the Subilist database (http://genolist.pasteur.fr/SubtiList). For the search, four different -35 sequences (GTTTD, GTATD, GCTTD, and GCATD, where D is A, G, or T) were used, with a spacer of 14 to 16 bp and GKNNANNNT (K is G or T; N is G, A, T, or C) as the -10 sequence. The search gave 193 hits, including all known sigma F-controlled genes that conformed to the search sequence. Of the potential promoter regions, the following seven were chosen for further analysis: yhcR, ycdF, yveA, ykqC, yxlJ, lonB, and yfhF. The potential promoter regions were amplified by PCR and cloned into pEIA96 as a prelude to testing in strain SL7542 (Pspac-spoIIAC). The expression of only one, lonB, was induced by sigma F, indicating that lonB is transcribed by E-sigma F in vivo. LonB is involved in the proteolysis of sigma H at low pH (18). However, a knockout mutation of lonB was generated and it had no discernible effect on growth or sporulation (data not shown). Serrano et al. have also identified lonB as an E-sigma F-transcribed gene (M. Serrano, S. Hövel, C. P. Moran, Jr., A. O. Henriques, and U. Völker, personal communication).


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The RNA polymerase factor sigma F has a pivotal role in the sporulation of B. subtilis. Its activation is highly regulated. It is the first sigma  factor to display compartmentalized expression, during sporulation (10). It is made in large quantities (21), and inappropriate expression is toxic (4, 42). However, fewer promoters have been identified as specifically requiring only sigma F for their expression than requiring any of the other sporulation-associated sigma  factors (1-3, 5, 7, 8, 13, 34, 37-39). Sun et al. originally identified four promoters that responded to E-sigma F. The most striking feature that they noted was G at -15 (37) (to avoid confusion, all numbering is relative to the spoIIQ promoter [Fig. 2]). Subsequently, Londoño-Vallejo et al. (19) identified spoIIQ, which was found to have the strongest promoter known to be recognized only by E-sigma F. We determined the 5' end of sigma F spoIIQ mRNA and inferred the transcription start point and hence the promoter. The promoter deviated somewhat from the previously suggested consensus but retained the G at -15. Here we report the analysis of sigma F -10 and -35 region recognition determinants by using a method similar to that developed by Oliphant and Struhl (23), with the spoIIQ promoter as the base.

We tested the effects of randomizing positions -14 to -7 of the spoIIQ promoter while keeping the rest of the region from -200 to +9 fixed. Surprisingly, almost 1% of 56,000 clones with this randomized region displayed E-sigma F promoter activity. Of 35 active promoters that were sequenced, only 2 were the same and only 1 was identical to the spoIIQ promoter (Table 2). This variability suggests that a large number of possible -14 to -7 sequences could be recognized by E-sigma F within the context of the spoIIQ promoter region. Data for the 10 natural promoters are combined with data for the R10 sequences in Table 4. A consensus, GG/tNNANNNT, from -15 to -7 was discernible. However, the ANNNT portion, from -11 to -7, is common to all sporulation-associated sigma  factors, as well as to sigma A (Table 5). The 10 natural sigma F promoters had T or A at -16 (Fig. 2), and this position might also contribute to promoter recognition. The G at -15 had previously been considered to be essential for sigma F activity (37), although one exception, the ywhE promoter, has recently been described (26). Nucleotides G are T are favored at -14. Site-directed mutatgenesis of the spoIIQ promoter confirmed the importance of the A at -11 and the T at -7 and also confirmed that a C is tolerated at -14 (E. Amaya and P. J. Piggot, unpublished observations).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 5.   Alignment of -10 consensus sequences for B. subtilis sigma  factorsa

The limited nature of the -10 consensus identified as specific for sigma F promoters was surprising. Comparison of sigma A-controlled promoters has indicated that they conform much more closely to the consensus in B. subtilis than do the comparable sigma 70-controlled promoters in E. coli (11). The analysis by Oliphant and Struhl (23) of sigma 70-controlled promoters indicated that the results obtained with their method agreed very well with those obtained by analyzing natural promoters. Our preliminary analysis of B. subtilis sigma A promoters by the randomized-oligonucleotide method is entirely consistent with a tighter consensus than for sigma 70 promoters of E. coli (A. Khvorova and P. J. Piggot, unpublished observations). It may be that the context of the spoIIQ promoter permitted the flexibility in the -10 region of the E-sigma F promoters analyzed. However, the natural E-sigma F promoters (Fig. 2) did not suggest a more restricted -10 region, with the possible exception of additional conformity at -9.

Analysis of the effects of randomizing five nucleotides in the -35 region suggested greater sigma F specificity than at -10. Of 3,300 clones tested with a randomized -35 to -31 pentamer, 44 displayed sigma F promoter activity. From these, 18 were sequenced, and 17 had the motif GTAT (-35 to -32), with 15 being GTATA/T (Table 3); analysis of nonexpressing clones in the R35 bank had indicated that the -35 to -31 region was indeed randomized in the bank. The 10 natural sigma F promoters display greater variability, with T, C, or G being found at position -34 and T or A at -33 (Fig. 2). This greater flexibility in the natural promoters may indicate that the spoIIQ promoter framework somehow restricts the flexibility in recognition of the -35 region. As with the -10 consensus, much of the -35 consensus, GNATA, is recognized by other sporulation-specific sigma  factors (Table 6). The natural promoters also suggested that positions flanking the region tested might contribute to promoter specificity; these positions were not investigated in the present study. The natural promoter sequences are combined with the randomization data to illustrate the conformity to the -35 consensus (Table 7).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 6.   Alignment of -35 consensus sequences for B. subtilis sigma  factorsa


                              
View this table:
[in this window]
[in a new window]
 
TABLE 7.   Frequency of occurrence of different nucleotides in the -35 region of promoters recognized by E-sigma Fa

E-sigma F has promoter specificity that overlaps that of E-sigma G (9). PspoIIQ is one of the few E-sigma F promoters that are not recognized by E-sigma G. Ten of the promoters from the R10 library constructed in the PspoIIQ background responded to sigma G, and 25 did not (Table 2). None of the promoters with a T at -14 responded to sigma G (Tables 2, and 5), suggesting that the T at this position discriminated against sigma G. However, a G, C, or A at this position was not sufficient among sigma F promoters to determine sigma G recognition. No clear discriminator was found at any other position. Scanning of known natural sigma F promoters outside the regions tested here (Fig. 2) shed no further light on the situation. An example of the complexity is at position -12, where all four nucleotides were found in both classes of promoters (Tables 4 and 5), and yet R10-333, which responded to sigma G, differed only at that position from R10-301, which did not respond. None of the clones from the R35 library was responsive to sigma G; this is presumably a consequence of the T at position -14 in the spoIIQ promoter discriminating against sigma G.

The B. subtilis database was scanned for plausible sigma F promoters located within 100 nucleotides of the start of open reading frames, as defined in the database. By using the sigma F consensus defined from the R10 and R35 analysis, 193 possible promoters were identified. A set of seven was chosen from this group that also fulfilled the additional criterion of having an upstream AT-rich region. This set was tested to see if the genes were transcribed in vivo by E-sigma F. Only one of the seven, lonB, was transcribed by E-sigma F. The inadequacy of our database predictions indicates that something additional to the -10 and -35 regions is important for E-sigma F recognition. This same conclusion can be deduced from the lack of a strong sigma F-specific promoter consensus sequence. It may be that the surrounding spoIIQ promoter context provides sigma F recognition determinants additional to those tested in the -10 and -35 regions. However, no strong determinants were apparent when other natural sigma F promoters (Fig. 2) were compared to the set of eight potential promoters. For example, A/T at position -16 (Fig. 2) was present in three of the seven nonfunctional test promoters and not present in the likely lonB promoter. However, comparison of known sigma F promoters did not reveal any obvious shared sequence motif outside the -10 and -35 regions (Fig. 2).

Accessory transcription factors have been identified that strongly modulate (activate or repress) the activity of RNA polymerase containing each of the other sporulation-associated sigma  factors: SpoIIID, SpoVT, and GerE are associated with sigma E, sigma G, and sigma K, respectively (17). No factor has been identified that shows comparable strong regulation of E-sigma F-directed promoters, although it seems plausible that such factors exist. The transcription of spoIIIG is delayed by some 40 min compared to the transcription of other sigma F-directed genes (14) and requires that sigma E also be active (25), suggesting that for spoIIIG, at least, there is an absolute requirement for an accessory transcription factor. Wu and Errington (40) have reported that RsfA increases the expression of spoIIR and modulates, to some extent, the activity of E-sigma F on other promoters, although not transcription of spoIIQ, the base of the present study. A requirement for unidentified transcription factors may explain, in part, the looseness of the sigma F promoter consensus and the inability of our search to identify novel sigma F-directed genes. However, it is also possible that the promoter recognition requirements of E-sigma F are complex, with weak contributions from various positions outside the tested regions, as well as from the tested regions.

Selection of functional nucleotide sequences from randomized libraries has become a powerful technique for studying the structure and function of the nucleic acids (7). This technique (often called SELEX) has been used successfully to select in vitro the functional sequences in both RNA and DNA that are capable of binding to specific ligands or of performing a chemical reaction. The use of the randomized libraries for selection of the functional nucleic acid sequences is mostly restricted to in vitro applications, mainly because of physical limitations on the length of the library (about 15 nucleotides) imposed by the cloning and expression procedures. Although the randomized libraries are limited by length, selection from them in vivo can potentially be a very powerful tool with which to study functions of nucleic acids that involve the interactions of short nucleotide (DNA or RNA) motifs. This approach was successfully used to analyze the consensus sequence of E. coli E-sigma 70 promoters (23). The present study illustrates the usefulness and the limitations of SELEX logic applied to an analysis of promoter recognition determinants of E-sigma F in B. subtilis.


    ACKNOWLEDGMENTS

This work was supported by Public Health Service grant GM43577 from the National Institutes of Health.

We are very grateful to V. K. Chary, J. D. Helmann, and M. L. Higgins for helpful discussions.


    FOOTNOTES

* Corresponding author. Mailing address: Department of Microbiology and Immunology, Temple University School of Medicine, 3400 N. Broad St., Philadelphia, PA 19140. Phone: (215) 707-7927. Fax: (215) 707-7788. E-mail: piggotp{at}astro.temple.edu.

dagger Present address: Department of Microbiology, University of Colorado Health Science Center, Denver, Colo.

Dagger Present address: Department of Molecular, Cellular and Developmental Biology, University of Colorado, Boulder, Colo.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Bagyan, I., L. Casillas-Martinez, and P. Setlow. 1998. The katX gene, which codes for the catalase in spores of Bacillus subtilis, is a forespore-specific gene controlled by sigma F, and KatX is essential for hydrogen peroxide resistance of the germinating spore. J. Bacteriol. 180:2057-2062[Abstract/Free Full Text].
2. Bagyan, I., M. Noback, S. Bron, M. Paidhungat, and P. Setlow. 1998. Characterization of yhcN, a new forespore-specific gene of Bacillus subtilis. Gene 212:179-188[CrossRef][Medline].
3. Cabrera-Hernandez, A., J.-L. Sanchez-Salas, M. Paidhungat, and P. Setlow. 1999. Regulation of four genes encoding small, acid-soluble spore proteins in Bacillus subtilis. Gene 232:1-10[CrossRef][Medline].
4. Coppolecchia, R., H. DeGrazia, and C. P. Moran, Jr. 1991. Deletion of spoIIAB blocks endospore formation in Bacillus subtilis at an early stage. J. Bacteriol. 173:6678-6685[Abstract/Free Full Text].
5. Decatur, A., and R. Losick. 1996. Identification of additional genes under the control of the transcription factor sigma F of Bacillus subtilis. J. Bacteriol. 178:5039-5041[Abstract/Free Full Text].
6. Ephrati-Elizur, E. 1968. Spontaneous transformants in Bacillus subtilis. Genet. Res. 11:83-96[Medline].
7. Gold, L., D. Brown, Y.-Y. He, T. Shtatland, B. S. Singer, and Y. Wu. 1997. From oligonucleotide shapes to genomic SELEX: novel biological regulatory loops. Proc. Natl. Acad. Sci. USA 94:59-64[Abstract/Free Full Text].
8. Gomez, M., and S. M. Cutting. 1996. Expression of the Bacillus subtilis spoIVB gene is under dual sigma F/sigma G control. Microbiology 142:3453-3457[Abstract/Free Full Text].
9. Haldenwang, W. G. 1995. The sigma factors of Bacillus subtilis. Microbiol. Rev. 59:1-30[Abstract/Free Full Text].
10. Harry, E., K. Pogliano, and R. Losick. 1995. Cell-specific gene expression in B. subtilis. J. Bacteriol. 177:3386-3393[Abstract/Free Full Text].
11. Helmann, J. D. 1995. Compilation and analysis of Bacillus subtilis sigma A-dependent promoter sequences: evidence for extended contact between RNA polymerase and upstream promoter DNA. Nucleic Acids Res. 13:2351-2360.
12. Itaya, M., K. Kondo, and T. Tanaka. 1989. A neomycin resistance gene cassette selectable in a single copy state in the Bacillus subtilis chromosome. Nucleic Acids Res. 17:4410[Free Full Text].
13. Karow, M. L., P. Glaser, and P. J. Piggot. 1995. Identification of a gene, spoIIR, that links the activation of sigma E to the transcriptional activity of sigma F during sporulation in Bacillus subtilis. Proc. Natl. Acad. Sci. USA 92:2012-2016[Abstract/Free Full Text].
14. Karow, M. L., and P. J. Piggot. 1995. Construction of gusA transcriptional fusion vectors for Bacillus subtilis and their utilization for studies of spore formation. Gene 163:69-74[CrossRef][Medline].
15. Kellner, E. M., A. Decatur, and C. P. Moran, Jr. 1996. Two-stage regulation of an anti-sigma factor determines developmental fate during bacterial endospore formation. Mol. Microbiol. 21:913-924[CrossRef][Medline].
16. King, N., O. Dreesen, P. Stragier, K. Pogliano, and R. Losick. 1999. Septation, dephosphorylation, and the activation of sigma F during sporulation in Bacillus subtilis. Genes Dev. 13:1156-1167[Abstract/Free Full Text].
17. Kroos, L., B. Zhang, H. Ichikawa, and Y.-T. N. Yu. 1999. Control of sigma  factor activity during Bacillus subtilis sporulation. Mol. Microbiol. 31:1285-1294[CrossRef][Medline].
18. Liu, J., W. M. Cosby, and P. Zuber. 1999. Role of Lon and ClpX in the posttranslational regulation of a sigma subunit of RNA polymerase required for cellular differentiation in Bacillus subtilis. Mol. Microbiol. 33:415-428[CrossRef][Medline].
19. Londoño-Vallejo, J. A., C. Frehel, and P. Stragier. 1997. spoIIQ, a forespore-expressed gene required for engulfment in Bacillus subtilis. Mol. Microbiol. 24:29-39[CrossRef][Medline].
20. Londoño-Vallejo, J.-A., and P. Stragier. 1995. Cell-cell signaling pathway activating a developmental transcription factor in Bacillus subtilis. Genes Dev. 9:503-508[Abstract/Free Full Text].
21. Lord, M., D. Barilla, and M. D. Yudkin. 1999. Replacement of vegetative sigma A by sporulation-specific sigma F as a component of the RNA polymerase holoenzyme in sporulating Bacillus subtilis. J. Bacteriol. 181:2346-2350[Abstract/Free Full Text].
22. Nicholson, W. L., and P. Setlow. 1990. Sporulation, germination and outgrowth., p. 391-429. In C. R. Harwood, and S. M. Cutting (ed.), Molecular biological methods for Bacillus. John Wiley & Sons, Inc., New York, N.Y.
23. Oliphant, A. R., and K. Struhl. 1987. The use of random-sequence oligonucleotides for determining consensus sequences. Methods Enzymol. 155:568-582[Medline].
24. Oliphant, A. R., and K. Struhl. 1988. Defining the consensus sequences of E. coli promoter elements by random selection. Nucleic Acids Res. 16:7673-7683[Abstract/Free Full Text].
25. Partridge, S. R., and J. Errington. 1993. The importance of morphological events and intercellular interactions in the regulation of prespore-specific gene expression during sporulation in Bacillus subtilis. Mol. Microbiol. 8:945-955[Medline].
26. Pedersen, L. B., K. Ragkousi, T. J. Cammett, E. Melly, A. Sekowska, E. Schopick, T. Murray, and P. Setlow. 2000. Characterization of ywhE, which encodes a putative high-molecular-weight class A penicillin-binding protein in Bacillus subtilis. Gene 246:187-196[CrossRef][Medline].
27. Penn, M. D., G. Thireos, and H. Greer. 1984. Temporal analysis of general control of amino acid biosynthesis in Saccharomyces cerevisae: role of positive regulatory genes in initiation and maintenance of mRNA derepression. Mol. Cell. Biol. 4:339-348.
28. Petersohn, A., S. Engelmann, P. Setlow, and M. Hecker. 2000. The katX gene of Bacillus subtilis is under dual control of sigma B and sigma F. Mol. Gen. Genet. 262:173-179.
29. Piggot, P. J. 1973. Mapping of asporogenous mutations of Bacillus subtilis: a minimum estimate of the number of sporulation operons. J. Bacteriol. 114:1241-1253[Abstract/Free Full Text].
30. Piggot, P. J., and C. A. M. Curtis. 1987. Analysis of the regulation of gene expression during Bacillus subtilis sporulation by manipulation of the copy number of spo-lacZ fusions. J. Bacteriol. 169:1260-1266[Abstract/Free Full Text].
31. Piggot, P. J., C. A. M. Curtis, and H. de Lencastre. 1984. Use of integrational plasmid vectors to demonstrate the polycistronic nature of a transcriptional unit (spoIIA) required for sporulation of Bacillus subtilis. J. Gen. Microbiol. 130:2123-2136[Abstract/Free Full Text].
32. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
33. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467[Abstract/Free Full Text].
34. Schuch, R., and P. J. Piggot. 1994. The dacF-spoIIA operon of Bacillus subtilis, encoding sigma F, is autoregulated. J. Bacteriol. 176:4104-4110[Abstract/Free Full Text].
35. Shimotsu, H., and D. J. Henner. 1986. Construction of a single-copy integration vector and its use in analysis of regulation of the trp operon of Bacillus subtilis. Gene 43:85-94[CrossRef][Medline].
36. Stragier, P., and R. Losick. 1996. Molecular genetics of sporulation in Bacillus subtilis. Annu. Rev. Genet. 30:297-341[CrossRef][Medline].
37. Sun, D., P. Fajardo-Cavazos, M. D. Sussman, F. Tovar-Rojo, R. M. Cabrera-Martinez, and P. Setlow. 1991. Effect of chromosome location of Bacillus subtilis forespore genes on their spo gene dependence and transcription by Esigma F: identification of features of good Esigma F-dependent promoters. J. Bacteriol. 173:7867-7874[Abstract/Free Full Text].
38. Sussman, M. D., and P. Setlow. 1991. Cloning, nucleotide sequence, and regulation of the Bacillus subtilis gpr gene, which codes for the protease that initiates degradation of small, acid-soluble proteins during spore germination. J. Bacteriol. 173:291-300[Abstract/Free Full Text].
39. Wu, J. J., and P. J. Piggot. 1990. Regulation of transcription of Bacillus subtilis spoIIA locus. J. Bacteriol. 171:692-698.
40. Wu, L. J., and J. Errington. 2000. Identification and characterization of a new prespore-specific regulatory gene, rsfA, of Bacillus subtilis. J. Bacteriol. 182:418-424[Abstract/Free Full Text].
41. Yansura, D. G., and D. J. Henner. 1984. Use of the Escherichia coli lac repressor and operator to control gene expression in Bacillus subtilis. Proc. Natl. Acad. Sci. USA 81:439-443[Abstract/Free Full Text].
42. Yudkin, M. D. 1986. The sigma-like product of sporulation gene spoIIAC of Bacillus subtilis is toxic to Escherichia coli. Mol. Gen. Genet. 202:55-57[CrossRef][Medline].


Journal of Bacteriology, June 2001, p. 3623-3630, Vol. 183, No. 12
0021-9193/01/$04.00+0   DOI: 10.1128/JB.183.12.3623-3630.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Koo, B.-M., Rhodius, V. A., Nonaka, G., deHaseth, P. L., Gross, C. A. (2009). Reduced capacity of alternative {sigma}s to melt promoters ensures stringent promoter recognition. Genes Dev. 23: 2426-2436 [Abstract] [Full Text]  
  • Jerg, B., Gerischer, U. (2008). Relevance of nucleotides of the PcaU binding site from Acinetobacter baylyi. Microbiology 154: 756-766 [Abstract] [Full Text]  
  • Cote, C. K., Bozue, J., Moody, K. L., DiMezzo, T. L., Chapman, C. E., Welkos, S. L. (2008). Analysis of a novel spore antigen in Bacillus anthracis that contributes to spore opsonization. Microbiology 154: 619-632 [Abstract] [Full Text]  
  • Budde, I., Steil, L., Scharf, C., Volker, U., Bremer, E. (2006). Adaptation of Bacillus subtilis to growth at low temperature: a combined transcriptomic and proteomic appraisal.. Microbiology 152: 831-853 [Abstract] [Full Text]  
  • Freiberg, C., Fischer, H. P., Brunner, N. A. (2005). Discovering the Mechanism of Action of Novel Antibacterial Agents through Transcriptional Profiling of Conditional Mutants. Antimicrob. Agents Chemother. 49: 749-759 [Abstract] [Full Text]  
  • Steil, L., Serrano, M., Henriques, A. O., Volker, U. (2005). Genome-wide analysis of temporally regulated and compartment-specific gene expression in sporulating cells of Bacillus subtilis. Microbiology 151: 399-420 [Abstract] [Full Text]  
  • Hilbert, D. W., Piggot, P. J. (2004). Compartmentalization of Gene Expression during Bacillus subtilis Spore Formation. Microbiol. Mol. Biol. Rev. 68: 234-262 [Abstract] [Full Text]  
  • Chary, V. K., Piggot, P. J. (2003). Postdivisional Synthesis of the Sporosarcina ureae DNA Translocase SpoIIIE either in the Mother Cell or in the Prespore Enables Bacillus subtilis To Translocate DNA from the Mother Cell to the Prespore. J. Bacteriol. 185: 879-886 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Amaya, E.
Right arrow Articles by Piggot, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Amaya, E.
Right arrow Articles by Piggot, P. J.