Previous Article | Next Article 
Journal of Bacteriology, July 2001, p. 3866-3874, Vol. 183, No. 13
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.13.3866-3874.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
In Vitro Processing of the 16S rRNA of the
Thermophilic Archaeon Sulfolobus solfataricus
Andrea
Ciammaruconi1 and
Paola
Londei1,2,*
Dipartimento Biotecnologie Cellulari ed
Ematologia, Università di Roma "La Sapienza,"
Rome,1 and Dipartimento Biochimica
Medica e Biologia Medica, Università di Bari,
Bari,2 Italy
Received 4 August 2000/Accepted 3 April 2001
 |
ABSTRACT |
In this paper we have analyzed the processing in vitro of the 16S
rRNA of the thermophilic archaeon Sulfolobus solfataricus, using pre-rRNA substrates transcribed in vitro and different protein preparations as the source of processing enzymes. We show that the 5'
external transcribed spacer of the S. solfataricus pre-rRNA transcript contains a target site for a specific endonuclease, which
recognizes a conserved sequence also existing in the early A0 and 0 processing sites of Saccharomyces cerevisiae and
vertebrates. This site is present in other members of the kingdom
Crenarchaeota but apparently not in the
Euryarchaeota. Furthermore, S. solfataricus pre-16S RNA is processed within the double-helical stem formed by the
inverted repeats flanking the 16S RNA sequence, in correspondence with
a bulge-helix-bulge motif. The endonuclease responsible for this
cleavage is present in both the Crenarchaeota and the
Euryarchaeota. The processing pattern remained the same
when the substrate was a 30S ribonucleoprotein particle instead of the
naked RNA. Maturation of either the 5' or the 3' end of the 16S RNA
molecule was not observed, suggesting either that maturation requires
conditions not easily reproducible in vitro or that the responsible
endonucleases are scarcely represented in cell extracts.
 |
INTRODUCTION |
In both bacteria and eukaryotes,
rRNAs are synthesized as large precursors which are processed to mature
rRNA species. However, the maturation pathways, and the enzymatic
machinery involved, differ in the two cell domains (for reviews, see
references 7 and 9). The principal maturation enzyme in
bacteria is RNase III, which cleaves within the long double-stranded
stems formed by the inverted repeats flanking both large rRNA genes,
releasing precursor 16S and 23S rRNAs, which are subsequently trimmed
at both ends to yield the mature molecules. However, RNase III is not
strictly essential, and mutants lacking this enzymatic activity are
viable (although slow growing) because there exist alternative processing pathways for producing mature rRNAs, especially the 16S rRNA
(9). In eukaryotes, the rRNA genes are not flanked by
inverted repeats and there are no processing stems: rRNA maturation is
performed by ribonucleoprotein enzymes that cut at specific sites
within the transcribed spacers. The compositions and mechanisms of
action of these enzymes are still largely unknown, although it is well
established that they require the presence of several small nucleolar
RNAs such as U3, U8, U14, and others (7, 25). However,
eukaryotes also possess an RNase III homolog that in Saccharomyces cerevisiae has been shown to be involved in
rRNA processing both in vitro and in vivo (1).
In contrast with the wealth of data available for the other two primary
domains, our knowledge of rRNA processing in archaea is still very
fragmentary. As in bacteria, the archaeal large rRNA genes are flanked
by imperfect inverted repeats that pair, forming long double-helical
stems. These stems are truncated by an enzyme which probably recognizes
a specific structure, a bulge-helix-bulge (BHB) motif (4, 8, 13,
15). A peculiar situation seems to exist in the crenarchaeon
Sulfolobus acidocaldarius, where 16S rRNA maturation was
reported to be independent of the formation of the processing stem
(6), thus resembling the early steps of eukaryotic 18S RNA maturation.
In this paper we discuss the in vitro processing of 16S rRNA in the
extremely thermophilic archaeon Sulfolobus solfataricus, using pre-rRNA substrates transcribed in vitro and various protein preparations. We show that the 5' external transcribed spacer (5'ETS)
of the S. solfataricus pre-rRNA transcript contains a target
site for a specific endonuclease, which recognizes a conserved sequence
also present in the early A0 and 0 processing sites of yeast and
vertebrates. This site is probably specific to the
Crenarchaeota, as it is recognized and cleaved by
heterologous cell extracts from this archaeal branch only. Furthermore,
S. solfataricus pre-16S RNA is processed within the
double-helical stem formed by the inverted repeats flanking the 16S
sequence, in correspondence with the BHB motif. The endonuclease
responsible for this cleavage is present in cell extracts from both
Crenarchaeota and Euryarchaeota. The processing
sites were the same regardless of whether the substrate was the naked
RNA or a ribonucleoprotein particle. Under no experimental conditions
was maturation of either the 5' or the 3' end of the 16S RNA observed,
suggesting either that maturation requires conditions not easily
reproducible in vitro or that the responsible endonucleases are
scarcely represented in cell extracts.
 |
MATERIALS AND METHODS |
In vitro transcription.
The RNAs for in vitro processing
were obtained by in vitro transcription with T7 RNA polymerase of the
ribosomal DNA operon of S. solfataricus, cloned in such a
way that the artificial transcription start site was very close to the
natural one, except for the presence of some 15 nucleotides (nt) of a
plasmid polylinker ahead of the archaeal sequence (21). To
obtain the short transcript, which includes the 5'ETS and about 100 nt
of the 16S sequence (see Fig. 1), the construct was linearized with
AflIII. To obtain the entire 16S rRNA, which includes the
5'ETS and the internal transcribed spacer (ITS) (see Fig. 2), the
construct was linearized with HpaI, whose first site from
the 5' end of the rDNA operon lies in the ITS 8 nt upstream from the 5'
extremity of the 23S RNA sequence.
Preparation of the S-100 and RW fractions.
S.
solfataricus (strain MT4) cells were grown at 85°C as described
by De Rosa et al. (5). Desulfurococcus mobilis
and Thermococcus celer frozen cells were the kind gift of W. Zillig (Martinsried, Germany). To prepare the supernatant fraction, the
cells were disrupted by alumina (Alcoa) grinding and crude cell lysates
were obtained, as described by Londei et al. (17). The
crude lysates were fractionated by centrifugation at 100,000 × g for 2 h; the resulting supernatants (S-100 fractions)
were concentrated by precipitation with 70% ammonium sulfate. The
precipitates were resuspended in 10 mM Tris-HCl (pH 7.2)-10% glycerol
(one-fifth of the initial volume of the S-100 fraction), dialyzed
extensively against the same buffer and stored at
80°C in small
aliquots. To prepare the high-salt ribosome wash (RW) the crude
ribosomes in the 100,000 × g pellets were resuspended
in a buffer containing 500 mM NH4Cl, 20 mM Tris-HCl (pH
7.4), 10 mM Mg acetate, and 5 mM
-mercaptoethanol and again
centrifuged at 100,000 × g for 12 h through a
cushion of 0.5 M sucrose in the same buffer. The resulting pellets
(purified ribosomes) were resuspended in a buffer containing 2 M
NH4Cl, 20 mM Tris-HCl (pH 7.4), 10 mM Mg acetate, and 5 mM
-mercaptoethanol (high-salt buffer) and incubated on ice for 4 to
5 h with stirring. The samples were then centrifuged at
100,000 × g for 4 to 5 h; the resulting
supernatant (high-salt RW fraction) was concentrated by precipitation
with 70% ammonium sulfate and finally resuspended in 10 mM Tris-HCl
(pH 7.2)-10% glycerol.
In vitro processing.
One to 2 µg of RNA, or of 30S
ribonucleoprotein particles, was incubated for 10 min (or various
amounts of time from 0 to 20 min when processing kinetics were
determined) at 75°C with about 1 µg of chaperonin or 5 µg of
either the S-100 fraction or of the high-salt RW fraction. When the
experiments were performed with the radiolabeled RNA, the incubation
mixtures contained 100 ng of each transcript (200,000 to 300,000 cpm).
The reaction buffer contained 10 mM KCl (or 100 mM when the
reconstituted 30S rRNAs were employed), 50 mM Tris (pH 8), and 10 mM
MgCl2 (final volume, 30 µl). The reaction was stopped
with 30 µl of 50 mM EDTA (pH 8) and 0.5% sodium dodecyl sulfate. The
products were resolved by electrophoresis on 6% acrylamide gels
containing 8 M urea in Tris-borate-EDTA or subjected to primer
extension analysis.
Primer extension.
Primer extension determination of the
processing cuts on the RNA transcripts was performed according to
techniques described previously (24). To detect processing
within the 5'ETS, a 17-mer oligonucleotide (5'ACTCCCATGGCTTAACC3')
complementary to the region containing nt 42 to 58 of the 16S RNA
coding sequence was used as the primer. For the ITS, the primer
was a 24-mer oligonucleotide (5'TAAGCGGCCTTTCGGCCCTAAGCC3')
complementary to the ITS tract from nt
20 to
43
relative to the 5' end of the 23S rRNA.
Site-directed mutagenesis.
Site-directed mutagenesis was
performed according to the method of Deng and Nickoloff
(3), using a Transformer site-directed mutagenesis kit
(Clontech Laboratories) and appropriate oligonucleotides containing the
mutations to be inserted.
Chemical probing of RNA structure.
To obtain experimental
information about the structure of the S. solfataricus
5'ETS, the short in vitro transcript was treated with
1-cyclohexyl-3-(2-morpholinoethyl)carbodiimide
metho-p-toluene sulfonate (CMCT), which preferentially
modifies unpaired uracil residues, essentially according to the
protocol described by Stem et al. (24) except that
chemical modification was performed at 70°C, close to the
physiological temperature for Sulfolobus growth. The
modified RNA was subjected to primer extension analysis with the same
primer employed to analyze processing. The stop signals corresponding
to the modified nucleotides were visualized by autoradiography.
In vitro assembly of 30S subunits.
About 2 µg (4 pmol) of
the long transcript 16S RNA was incubated with an optimal amount of
TP30 as determined experimentally. Incubation was carried out at 80°C
for 15 min in the presence of a solution containing 100 mM KCl, 20 mM
Tris-HCl (pH 7), and 20 mM Mg acetate, in a final volume of 15 µl. At
the end of the incubation, 10 µl of the mixture was analyzed by
centrifugation on sucrose density gradients to determine whether 30S
particles had formed, while the rest was used for processing experiments.
 |
RESULTS |
In vitro processing of the S. solfataricus 5'ETS.
Previous work on the earlier steps of pre-rRNA processing in the
thermophilic archaeon S. acidocaldarius (6)
revealed the presence in vivo of three processing sites in the 5'ETS,
one corresponding to the mature 5' end of the 16S RNA and the other two
located at nt
98 and
31 relative to it. These cleavage sites were
also observed in vitro using unfractionated cell extracts and a short synthetic RNA substrate including the whole 5'ETS and only about 100 nt
of the 16S rRNA sequence. This finding showed that processing within
the 5'ETS did not require the presence of most of the 16S coding
sequence or of the processing stem.
Recently, we found that a similar short pre-rRNA substrate from
S. solfataricus (including the entire 5'ETS and about 100 nt
of the 16S rRNA sequence) was cleaved in vitro at a single site (termed
site 0) by a specific endonuclease tightly associated with the 60-kDa
chaperonin (21) (Fig. 1).
The processing site was located 94 nt upstream of the mature 5' end of
the 16S rRNA, corresponding to the most distal of the sites mapped in
S. acidocaldarius. Importantly, site 0 is likely to be the
earliest processing site in the S. solfataricus pre-rRNA, as
precursor molecules ending at this site were observed in vivo
(20).

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 1.
In vitro processing of the short pre-rRNA by different
protein preparations and processing of a minimal transcript. (A) Primer
extension analysis of the processing cuts introduced in the short
transcript by the following protein preparations: chaperonin (Ch), the
postribosomal S-100 fraction (S100), and the RW fraction. The short
transcript, which included the entire 5'ETS and about 100 nt of the 16S
rRNA sequence, is illustrated on the right. The sequence and secondary
structure of the 5'ETS are shown in full, while the remainder of the
molecule is schematized as a box (16S, 100 nt). The primary processing
site (site 0) and the location of the mature 5' end of the 16S RNA are
indicated. (B) In vitro processing patterns of uniformly labeled RNA
molecules. Lanes 1 and 2, short transcript incubated with and without
chaperonin, respectively; lanes 3 and 4, minimal transcript incubated
in the same way. The structure of the minimal transcript (about 100 nt)
is illustrated on the right.
|
|
Since no other cleavage sites were observed, the inference was that the
chaperonin-associated endonuclease was responsible for the cut at site
0 only and that the rest of 16S rRNA 5'-end processing was carried out
by other enzymatic activities located elsewhere in the cell. To detect
these activities, and to elucidate the subsequent processing steps, we
began with analyzing the processing of the short substrate in the
presence of different protein fractions as the source of processing
enzymes. These were a postribosomal supernatant (S-100) and a high-salt
RW fraction obtained by treating purified S. solfataricus
ribosomes with 2 M NH4Cl. RW fractions are known to be good
sources of processing activities in Escherichia coli
(23). As a control, we also employed a chaperonin
preparation made as described by Ruggero et al. (21).
In the presence of the chaperonin, as observed previously
(21), the short RNA was cleaved only at position
94
(site 0). The same occurred with both the S-100 fraction and the RW
fraction (which contained a substantial amount of chaperonin) (Fig. 1). At incubation times higher than 10 min, the S-100 fraction also introduced a few cuts in the 16S rRNA coding sequence, probably because
of the presence of unspecific nucleases (not shown). However, cleavage
at either position
31 or at the mature 5' end of the 16S rRNA was
never observed. We concluded that the only bona fide in vitro
processing site in the short substrate was site 0.
Processing of a complete pre-16S RNA.
We next analyzed the
processing of a more physiological substrate, a longer transcript
spanning the 5'ETS, the entire 16S gene, and the ITS. This RNA molecule
contains both inverted repeats flanking the 16S rRNA and is therefore
able to form the processing stem, including the canonical BHB motif
(Fig. 2). The cleavage sites were mapped
by primer extension analysis and confirmed by analyzing on a denaturing
gel the fragments obtained upon processing of a uniformly labeled RNA
substrate (not shown).

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 2.
In vitro processing of the complete 16S pre-rRNA. The
structure of the long transcript is schematized on the right. The
sequences and secondary structures of the 5'ETS and of the ITS are
shown in full, while the 16S sequence is represented schematically as a
loop on top of the processing stem. The locations of the processing
sites (site 0, site 1, and site 1') and that of the 5' terminus of the
16S rRNA are indicated. The left and top panels show the positions of
the processing cuts as revealed by primer extension experiments. Ch,
chaperonin.
|
|
In the presence of the chaperonin, only processing at site 0 was
observed, confirming that this site was uniquely recognized by a
specific endonuclease. With the S-100 fraction, two distinct cleavage
sites within the 5'ETS and one within the ITS were apparent (Fig. 2).
The 5'ETS was cut at
94 (site 0) and also at
16 (site 1), within
the upper bulge of the BHB motif in the processing stem. The ITS was
cut at
146 relative to the 5' end of the 23S RNA (site 1'), i.e., in
the lower bulge of the BHB motif. Site 1 and site 1' cleavages
conformed to the canonical pattern of processing stem truncation in
archaea, and both were probably introduced by the same enzyme, the BHB
endonuclease. Essentially the same results were obtained with the RW
fraction (Fig. 2). However, neither the S-100 fraction nor the RW
fraction yielded any maturation of the 5' or the 3' end of the 16S RNA.
Instead, as already noted with the short substrate, the S-100 proteins introduced several unspecific cuts within the 16S coding sequence, especially if incubation was prolonged above 10 min (not shown).
In summary, the results of the in vitro processing experiments showed
that a pre-16S rRNA substrate complete with the 5'ETS and the ITS was
cut at three distinct sites, all corresponding to expected processing
sites on the basis of previous in vivo and/or in vitro observations
with Sulfolobus itself (site 0) or other archaea (sites 1 and 1'). Thus, the situation in S. solfataricus differed
from that observed in S. acidocaldarius (6),
first because we did detect canonical processing at the BHB motif in the processing stem and second because no maturation at the 5' (or 3')
end of the 16S rRNA was obtained.
RNA features determining cleavage site specificity.
The in
vitro cleavage pattern illustrated in the previous paragraphs suggested
that a minimum of two different enzymatic activities were at play. The
first of these was a site-specific endonuclease, cleaving uniquely at
site 0. The two symmetrical cuts at sites 1 and 1' were probably
introduced by the same structure-specific enzyme, predicted to be able
to recognize the BHB motif in the processing stem. To obtain better
insight into the nature of the processing nucleases, the RNA features
required for the specific recognition of the cleavage sites were
investigated by engineering a series of mutant RNA substrates.
(i) Site 0 cleavage is sequence specific.
In vitro cleavage at
site 0, as demonstrated here and in previous works (6,
21), did not require the formation of the processing stem or
most of the 16S coding sequence. To determine whether other sequences
or structures in the 5'ETS were involved in site 0 recognition, we
analyzed the processing behavior of a minimal pre-RNA derived from
runoff transcription of a HindIII-linearized DNA
substrate. This transcript was only about 100 nt long and lacked all of
the 16S rRNA coding sequences plus a large tract of the 5'ETS
comprising most of the secondary-structure elements downstream of site
0 (Fig. 1).
When incubated under the appropriate conditions with chaperonin, the
minimal substrate was efficiently cleaved at site 0, yielding one 60-nt
and one 40-nt fragment (Fig. 1). This result strongly suggested that
the site itself contained its own recognition determinants. Indeed, as
shown in Fig. 3, site 0 spans a conserved sequence, including a consensus CUU motif, that is found in the 5'ETSs
of other archaeal pre-rRNAs as well as around the A0 and 0 sites of
yeast and higher eukaryotes. Computer-aided secondary-structure modelling of the secondary structure of the 5'ETS of
Sulfolobus (and other archaea) indicated that the tract
containing the conserved sequence is single stranded (Fig. 1). To
obtain direct experimental information about this point, however, we
probed the structure of the pre-rRNA substrates prepared by in vitro
transcription by means of chemical-modification and primer extension
assays (24). Since the region containing site 0 is very uracil rich, the short pre-rRNA was treated with CMCT, which selectively modifies single-stranded uracils. As shown in Fig. 3, all uracil residues contained in, and surrounding, site 0 were modified, demostrating that
they were fully accessible to the reagent and therefore not engaged in
higher-order structures.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 3.
Site 0 is located in a single-stranded region, and
cleavage is sequence specific. (Left panel) Primer extension analysis
performed on an unmodified short transcript (lane ) and on the same
transcript modified with CMCT (lane +). The main stop signals
corresponding to modified uracil residues are indicated with arrows;
the sequence at site 0 is evidenced. (Top middle panel) Alignment of
the sequences around site 0 in several archaea and around sites A0 and
0 in yeast and mouse. The positions of the processing cuts, when known,
are marked with arrows. The conserved CUU motif is underlined. (Bottom
middle panel) Analysis by site-directed mutagenesis of the sequence
determinants essential for processing at site 0. The nucleotides
modified in each experiment are underlined; the efficiency of
processing was assayed by incubating a uniformly labeled minimal
transcript with the purified chaperonin. +, complete cleavage; +/ ,
partial cleavage; , no cleavage. (Right panel) Structure of the short
transcript. The uracil residues modified by CMCT are indicated with
arrows.
|
|
The sequence determinants essential for processing were further
analyzed in detail by site-directed mutagenesis, whereby the conserved
5'CUU3' motif was systematically modified. As shown in Fig. 3, the
modification of the first two nucleotides (C and U), both separately
and together, completely abolished cleavage at site 0 while mutation of
the third nucleotide (U) strongly impaired it. By contrast, the
modification of a fourth nucleotide (A), which is also conserved in
archaea, had essentially no effect. These data demonstrate that site 0 endonuclease is indeed sequence specific and that the CU motif
immediately to the right of the cleavage site is required for
processing. Also, it is worth noting that cleavage at site 1 of long
substrates with an inactive site 0 remained undistrurbed (not shown),
thus showing that the two sites behave in an independent fashion, at
least in vitro.
It is known that the nucleases cutting at the eukaryotic sites A0 and 0 are ribonucleoproteins. To learn whether this was also true of S. solfataricus site 0 endonuclease, we treated with micrococcal
RNase the chaperonin preparation containing the enzyme in order to
destroy any catalytic RNA molecule that might be associated with it.
This procedure, however, did not inhibit cleavage activity significantly (not shown), indicating that the site 0 endonuclease is
probably independent of any trans-acting RNA molecules.
(ii) Cleavage at sites 1 and 1' is structure specific.
Next,
the determinants required for cleavage at sites 1 and 1' were
investigated. If both of these cuts were introduced by an endonuclease
that recognized the BHB motif, we expected that any mutation destroying
the integrity of the BHB structure would simutaneously abolish
processing at both sites 1 and 1'.
To demonstrate this point, we created a mutant construct (mut
1) in which the sequence GG within the stem of the BHB motif was
changed to UC. This mutation was expected to prevent the formation of
the 4-bp stem, transforming the BHB structure into a large internal
loop (Fig. 4). In fact, as shown in Fig.
4, a mut 1 long transcript could not be cleaved at either
site 1 or site 1', demonstrating that the enzyme indeed recognized the
BHB structure and was therefore very likely to be the same endonuclease
involved in the splicing of tRNA transcripts (18, 19).
Cleavage at site 0 in a mut 1 transcript remained unaffected
(Fig. 4).

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 4.
Cleavage in the processing stem is structure specific.
(Left panel) Sequence and predicted structure of the wild-type and
mutated processing stems. The modified nucleotides (GG to CU) are
boxed. (Right panels) Primer extension analysis of processing at sites
0 and 1 (top) and 1' (bottom) by the S-100 fraction in the wild-type
(wt) and mutated (mut 1) long transcripts.
|
|

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 5.
Processing on ribonucleoprotein particles. (Top panel)
Primer extension analysis of the processing cuts introduced by either
the chaperonin (Ch) or the S-100 proteins on a long pre-rRNA, in the
absence and in the presence of the total small-subunit proteins (TP30).
(Bottom panel) Density gradient analysis showing that the TP30 and the
long pre-rRNA assemble to form a 30S particle when incubated at 80°C
under the conditions described in Materials and Methods. The gradients,
10 to 30% sucrose in reconstitution buffer, were run for 4 h at
38,000 rpm in a Beckman SW41 rotor.
|
|
Cleavage at site 0 and within the BHB motif are independent
events.
Besides revealing the RNA features required for enzymatic
recognition, the results with the mutant constructs showed that site 0 cleavage and processing stem truncation were independent of each other.
In fact, an RNA with a mutated site 0 was normally cleaved at sites 1 and 1' (not shown), while an RNA that had lost the BHB motif was still
efficiently cut at site 0 (Fig. 4).
To determine whether in vitro processing on a wild-type substrate
followed a definite order, a long transcript was incubated with the
S-100 fraction and samples were withdrawn at increasing incubation
times. The extents of cleavage at sites 0 and 1 were monitored at each
time point by primer extension analysis (not shown). However, no
correlation between the cleavage sites was apparent. Stop signals at
both site 0 and site 1 increased linearly up to 15 min of incubation,
indicating that the first cut in a given RNA molecule could be
introduced at either location with equal likelihood.
Processing on ribonucleoprotein particles.
The observations
described in the previous paragraphs were made with naked RNA
molecules. However, it is known that in vivo pre-rRNA processing and
ribosome assembly are contemporaneous, so that processing takes place
on RNA substrates that are already coated to some extent with ribosomal
proteins. Even in vitro, some aspects of rRNA processing in bacteria
can be observed only on ribonucleoprotein substrates and are not
reproducible with naked rRNA. Notably, this is true for terminal
maturation of the 5' and 3' ends of the 16S rRNA in E. coli
(23).
To determine whether the presence of the ribosomal proteins allowed the
maturation of 16S RNA termini, in vitro processing was coupled with 30S
rRNA subunit assembly. Functional in vitro reconstitution of S. solfataricus ribosomal subunits was achieved about a decade ago
for the 50S particles (16). Recently, it was found that
the 30S subunits can also be reconstructed under somewhat different
conditions (D. Ruggero, A. Ciammaruconi, and P. Londei, unpublished
data). Notably, in vitro assembly of structurally complete (albeit
poorly active) 30S subunits may be achieved with a 16S RNA precursor
still containing the 5'ETS and ITS, namely, the long transcript
employed in this study (Fig. 4). Accordingly, the processing
experiments were performed under reconstitution conditions in the
presence of the small-ribosomal-subunit proteins. Preliminarily, we
checked that the different ionic conditions did not impair the correct
cleavage of a naked RNA substrate.
As shown in Fig. 5, the processing pattern of a ribonucleoprotein
substrate in the presence of either chaperonin or the S-100 fraction
was the same as that of a naked pre-16S RNA. Again, cleavages were
detected at sites 0 and 1 while no maturation at the 5' end of the 16S
RNA was apparent. To determine whether the presence of the ribosomal
proteins introduced a definite processing order, we also analyzed the
cleavage kinetics (not shown). However, these were similar to those
obtained with the naked RNA: the ribonucloprotein substrate was still
randomly cut at either site 0 or site 1. The only difference was that
processing was somewhat slower, presumably because the nucleases took
longer to recognize their target sites on a ribonucleoprotein substrate.
Site 0 is a distinctive feature of the
Crenarchaeota.
Cleavage within the BHB motif is
probably a universal processing mode in archaea, since such motifs are
found in pre-rRNAs from both major branches of archaeal descent, the
Euryarchaeota and the Crenarchaeota. By contrast,
the presence of a sequence-specific early processing site (site 0) has
so far been demonstrated for only two species of the
Sulfolobus genus. Therefore, the question is whether site 0 cleavage is a general feature of archaeal rRNA processing or whether it
exists only in a subclass of archaea. Given the similarity of site 0 with the eukaryal site A0 or 0, this question has implications as
regards archaeal evolution and the relationship of archaea with the
eukaryotic lineage.
Sequence analysis of available archaeal pre-rRNA 5'ETS tracts revealed
the presence of homologies with the site 0 consensus in several
Crenarchaeota (Fig. 3) but not in Euryarchaeota.
To assess experimentally the significance of this finding, we tested the ability of S-100 extracts from the euryarchaeon T. celer
and the crenarchaeon D. mobilis to process S. solfataricus pre-rRNA. These organisms were chosen because they
are extreme thermophiles, as is S. solfataricus.
As illustrated in Fig. 6, primer
extension analysis following incubation of S. solfataricus
pre-16S RNA with the heterologous extracts showed that both D. mobilis and T. celer proteins recognized the BHB motif
(i.e., cut at site 1). However, only the D. mobilis S-100
fraction was able to cleave at site 0, in agreement with the
observation that a site 0 consensus exists in the 5'ETS of D. mobilis but not in that of T. celer. The recognition of
the site by the heterologous endonuclease was sequence specific, as demonstrated by the fact that a mutant transcript with an inactive site
0 was not cut (not shown). These results indicate that the occurrence
of an early, sequence-specific, pre-rRNA processing site in the 5'ETS
may be restricted to the Crenarchaeota.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 6.
Processing of the S. solfataricus pre-16S RNA
by heterologous enzymes. The results of primer extension analysis of in
vitro cleavage at sites 0 and 1 of a long transcript in the presence of
the S-100 fractions from S. solfataricus (Sso), D. mobilis (Dmo), and T. celer (Tce) are shown.
|
|
 |
DISCUSSION |
In the present work we have analyzed the in vitro processing of
the 16S RNA of the crenarchaeon S. solfataricus, using
different in vitro transcripts and various protein preparations as the
source of the processing enzymes. Our findings, along with earlier in vivo observations (20), suggest that the maturation of
S. solfataricus pre-rRNA is initiated by a
single-strand-specific endonuclease that recognizes a U-rich sequence
located 94 nt upstream of the mature 5' end of the 16S RNA. The
sequence at this processing site (which we have termed site 0) is
conserved in several members of the Crenarchaeota (but not
in the Euryarchaeota); accordingly, we show that the
relevant endonucleolytic activity is present in the crenarchaeon
D. mobilis but not in the euryarchaeon T. celer.
A homologous endonucleolytic cleavage site was also shown to exist in
S. acidocaldarius (6, 22). We propose,
therefore, that cleavage at site 0 is a common distinctive feature of
early pre-rRNA processing in the Crenarchaeota.
Furthermore, we show that S. solfataricus pre-16S rRNA is
also processed at the canonical archaeal site formed by the BHB motif
within the processing stem and that the relevant nucleolytic acitivity
is, as expected, universally distributed within archaea. Finally, we
find that site 0 endonuclease and the BHB endonuclease are not
sufficient to complete the maturation of the 5' and 3' ends of the 16S
RNA. In fact, under conditions allowing cleavage by both activities,
the 16S RNA termini remained unprocessed, regardless of whether the
substrate was the naked RNA or a 30S ribonucleoprotein particle. This
result may indicate that 16S rRNA terminal maturation in S. solfataricus requires specific enzymatic activities that are,
however, too scarce in the protein preparations employed in this work.
In this respect, it may be observed that in vitro terminal maturation
of eukaryotic pre-rRNA transcripts can be reproduced only with
nucleolar extracts (10). Alternatively, completing the
processing of pre-16S RNA may require finely tuned conditions not
easily reproducible in vitro, such as a precise coordination between
transcription, processing, and ribosome assembly.
The present results differ in several aspects from those obtained from
processing studies of the pre-rRNA of S. acidocaldarius, a
species closely related to S. solfataricus (6,
22). In S. acidocaldarius pre-rRNA, the removal of
the 5'ETS was found to entail three consecutive endonucleolytic cuts,
the last of which generated the mature 5' terminus of the 16S RNA. It
was suggested that all three cleavages, including the one determining 5' end maturation, were performed by the same site-specific
endonuclease which recognized a common consensus sequence at the
cleavage sites (6). It was subsequently shown that
processing at one of these sites indeed required the presence of a
specific sequence (22). However, in the S. solfataricus 5'ETS (and in those of other
Crenarchaeota) the target sequence is found only at site 0, corresponding to the most distal of the three S. acidocaldarius sites. Therefore, even if the site 0 endonuclease
does mature the 5' end of S. acidocaldarius 16S RNA, this
cannot be generalized to other archaea. Also, it was observed that the
pre-16S RNA of S. acidocaldarius is not cleaved within the
processing stem because it contains a defective BHB motif
(6). Again, this is a specific feature of S. acidocaldarius, since, as we show here, the S. solfataricus pre-16S RNA does contain a canonical BHB motif which
is regularly cleaved by the specific endonuclease. Therefore, the
present results demonstrate that cleavage at site 0 is not an
alternative to processing stem truncation.
Upon the whole, the present work supports the notion that certain
similarities exist between the pre-rRNA maturation pathways in
eukaryotes and in archaea, more specifically in the
Crenarchaeota. In both cases, early pre-rRNA processing
entails the introduction of a site-specific cleavage in the 5'ETS:
indeed, we called 0 the archaeal site to stress its similarity with the
A0 and 0 sites of yeast and vertebrates. Strikingly, the archaeal and
eukaryotic A0 and 0 sites also share a consensus sequence (Fig. 3),
which in archaea is essential for cleavage. However, a meaningful
evaluation of the real degree of homology between the archaeal and the
eukaryal early processing steps is hampered by our poor understanding
of their functions and enzymology. In spite of its general occurrence in eukaryotes, site A0 or 0 does not seem to be essential for correct
pre-rRNA processing; in Sulfolobus, we have shown that cleavage at site 0 is not a prerequisite for further processing, at
least in vitro. As to the enzymes involved, much evidence indicates that processing at site A0 or 0 in eukaryotes is performed by ribonucleoproteins containing the essential small nucleolar RNA U3
(2, 11, 12). Recently, however, it has been found that, in
yeast, cleavage at site A0 may also occur, both in vivo and in vitro,
independently of U3 by an RNase homologous to bacterial RNase III
(1). The relationship between the two modes of site A0
processing is not yet understood. In Sulfolobus, as we show here, site 0 cleavage very probably does not require a
trans-acting catalytic RNA activity. However, the enzyme
involved cannot be RNase III, which has no obvious homologues in
archaea. Thus, Sulfolobus site 0 endonuclease may be a novel
archaeon-specific protein or it may have homology with some component
of the eukaryotic U3-containing RNase, although it dispenses with a
trans-acting small RNA, just as RNase III does in eukaryotes.
As to cleavage within the processing stems, the resemblance of this
process in yeast and eukaryotes to the corresponding process in
bacteria is more apparent than real. In fact, in bacteria these stems
are truncated by RNase III while in archaea the same task seems to be
performed by an altogether different protein, specifically recognizing
the BHB motif and very likely to be the same enzyme that removes tRNA
and rRNA introns (although its identity, to the best of our knowledge,
has never been demonstrated formally). The archaeal splicing
endonuclease, which may be a dimer or a tetramer depending on the
species, has no resemblance to RNase III but is homologous to one of
the subunits of the eukaryotic tRNA-splicing endonuclease (14,
18). Thus, archaea may employ eukaryotic-like enzymes for a
number of key pre-rRNA processing events.
Further work involving the isolation and characterization of archaeal
processing enzymes is needed to trace the evolutionary history of
pre-rRNA processing and help in the understanding of its mechanisms and
pathways in the three primary domains of life.
 |
ACKNOWLEDGMENTS |
This work has been supported in part by funds from the Italian
Ministry of University and Research (MURST). A.C. was the recipient of
a fellowship from the Institute Pasteur-Cenci Bolognetti Foundation at
the University of Rome "La Sapienza."
We thank Laura Nicolini of the Istituto Superiore di Sanità
(Rome, Italy) for her kind help in growing Sulfolobus cells.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Dpt.
Biotecnologie Cellulari ed Ematologia, Policlinico Umberto I,
Università di Roma "La Sapienza," Viale Regina Elena 324, 00161 Rome, Italy. Phone: 39-06-4940463. Fax: 39-06-4462891. E-mail:
londei{at}bce.med.uniroma1.it.
 |
REFERENCES |
| 1.
|
Abou Elela, S.,
H. Igel, and M. Ares, Jr.
1996.
RNase III cleaves eukaryotic pre-ribosomal RNA at a U3 snoRNP-dependent site.
Cell
85:115-124[CrossRef][Medline].
|
| 2.
|
Beltrame, M., and D. Tollervey.
1995.
Base-pairing between U3 and the pre-ribosomal RNA is required for 18S RNA synthesis.
EMBO J.
14:4350-4356[Medline].
|
| 3.
|
Deng, W. P., and J. A. Nickoloff.
1992.
Site-directed mutagenesis of virtually any plasmid by eliminating a unique site.
Anal. Biochem.
200:81-88[CrossRef][Medline].
|
| 4.
|
Dennis, P. P.
1985.
Multiple promoters for the transcription of the ribosomal RNA gene cluster in Halobacterium cutirubrum.
J. Mol. Biol.
186:457-461[CrossRef][Medline].
|
| 5.
|
De Rosa, M.,
A. Gambacorta, and J. D. Bu'lock.
1975.
Extremely thermoacidophilic bacteria convergent with Sulfolobus acidocaldarius.
J. Gen. Microbiol.
86:156-164[Medline].
|
| 6.
|
Durovic, P., and P. P. Dennis.
1994.
Separate pathways for excision and processing of 16S and 23S rRNA from the primary rRNA operon transcript from the hyperthermophilic archaebacterium Sulfolobus acidocaldarius: similarities to eukaryotic rRNA processing.
Mol. Microbiol.
13:229-242[CrossRef][Medline].
|
| 7.
|
Eichler, D. C., and N. Craig.
1994.
Processing of eukaryotic ribosomal RNA.
Prog. Nucleic Acid Res. Mol. Biol.
49:197-239[Medline].
|
| 8.
|
Garrett, R. A.,
J. Dalgaard,
N. Larsen,
J. Kjems, and A. S. Mankin.
1991.
Archaeal rRNA operons.
Trends Biochem. Sci.
16:22-26[CrossRef][Medline].
|
| 9.
|
Gegenheimer, P., and D. Apirion.
1981.
Processing of procaryotic ribonucleic acid.
Microbiol. Rev.
45:502-541[Free Full Text].
|
| 10.
|
Hannon, G. J.,
P. A. Maroney,
A. Branch,
B. J. Benenfield,
H. D. Robertson, and T. W. Nilsen.
1989.
Accurate processing of human pre-rRNA in vitro.
Mol. Cell. Biol.
9:4422-4431[Abstract/Free Full Text].
|
| 11.
|
Hughes, J. M., and M. Ares, Jr.
1991.
Depletion of U3 small nucleolar RNA inhibits cleavage in the 5' external transcribed spacer of yeast pre-ribosomal RNA and impairs formation of 18S ribosomal RNA.
EMBO J.
10:4231-4239[Medline].
|
| 12.
|
Kass, S.,
K. Tyc,
J. A. Steitz, and B. Sollner-Webb.
1990.
The U3 small nucleolar ribonucleoprotein functions in the first step of preribosomal RNA processing.
Cell
60:897-908[CrossRef][Medline].
|
| 13.
|
Kjems, J.,
H. Leffers,
R. A. Garrett,
G. Wich,
W. Leinfelder, and A. Bock.
1987.
Gene organization, transcription signals and processing of the single ribosomal RNA operon of the archaebacterium Thermoproteus tenax.
Nucleic Acids Res.
15:4821-4835[Abstract/Free Full Text].
|
| 14.
|
Kleman-Leyer, K.,
D. Armbruster, and C. J. Daniels.
1997.
Properies of H. volcanii tRNA intron endonuclease reveal a relationship between the archaeal and eucaryal tRNA intron processing system.
Cell
89:839-847[CrossRef][Medline].
|
| 15.
|
Leffers, H.,
J. Kjems,
L. Ostergaard,
N. Larsen, and R. A. Garrett.
1987.
Evolutionary relationships amongst archaebacteria. A comparative study of 23 S ribosomal RNAs of a sulphur-dependent extreme thermophile, an extreme halophile and a thermophilic methanogen.
J. Mol. Biol.
195:43-61[CrossRef][Medline].
|
| 16.
|
Londei, P.,
J. Teixido,
M. Acca,
P. Cammarano, and R. Amils.
1986.
Total reconstitution of functionally active ribosomal subunits of the extremely thermoacidophilic archaebacterium Sulfolobus solfataricus.
Nucleic Acids Res.
14:2269-2285[Abstract/Free Full Text].
|
| 17.
|
Londei, P.,
S. Altamura,
P. Cammarano, and L. Petrucci.
1986.
Differential properties of ribosomes and of poly(U) directed cell-free systems from sulphur-dependent archaebacterial species.
Eur. J. Biochem.
157:455-462[Medline].
|
| 18.
|
Lykke-Andersen, J., and R. A. Garrett.
1997.
RNA-protein interactions of an archaeal homotetrameric splicing endoribonuclease with an exceptional evolutionary history.
EMBO J.
16:6290-6300[CrossRef][Medline].
|
| 19.
|
Lykke-Andersen, J.,
C. Aagaard,
M. Semionenkov, and R. A. Garrett.
1997.
Archaeal introns: splicing, intercellular mobility and evolution.
Trends Biochem. Sci.
22:326-331[CrossRef][Medline].
|
| 20.
|
Reiter, W. D.,
P. Palm,
W. Voos,
J. Kaniecki,
B. Grampp,
W. Schulz, and W. Zillig.
1987.
Putative promoter elements for the ribosomal RNA genes of the thermoacidophilic archaebacterium Sulfolobus sp. strain B12.
Nucleic Acids Res.
15:5581-5595[Abstract/Free Full Text].
|
| 21.
|
Ruggero, D.,
A. Ciammaruconi, and P. Londei.
1998.
The 60 kD chaperonin of the thermophilic archaeon Sulfoibus solfataricus is an RNA binding protein that participates in ribosomal RNA processing.
EMBO J.
17:3471-3477[CrossRef][Medline].
|
| 22.
|
Russell, A. G.,
H. Ebhard, and P. P. Dennis.
1999.
Substrate requirements for a novel archaeal endonuclease that cleaves within the 5' external transcribed spacer of Sulfolobus acidocaldarius precursor rRNA.
Genetics
152:1373-1385[Abstract/Free Full Text].
|
| 23.
|
Srivastava, A. K., and D. Schlessinger.
1989.
Processing pathway of Escherichia coli 16S precursor rRNA.
Nucleic Acids Res.
17:1649-1663[Abstract/Free Full Text].
|
| 24.
|
Stem, S.,
D. Moazed, and H. F. Noller.
1988.
Structural analysis of RNA using chemical and enzymatic probing monitored by primer extension.
Methods Enzymol.
164:481-489[Medline].
|
| 25.
|
Venema, J., and D. Tollervey.
1995.
Processing of pre-ribosomal RNA in Saccharomyces cerevisiae.
Yeast
11:1629-1650[CrossRef][Medline].
|
Journal of Bacteriology, July 2001, p. 3866-3874, Vol. 183, No. 13
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.13.3866-3874.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
MARCK, C., GROSJEAN, H.
(2003). Identification of BHB splicing motifs in intron-containing tRNAs from 18 archaea: evolutionary implications. RNA
9: 1516-1531
[Abstract]
[Full Text]
-
SALGIA, S. R., SINGH, S. K., GURHA, P., GUPTA, R.
(2003). Two reactions of Haloferax volcanii RNA splicing enzymes: Joining of exons and circularization of introns. RNA
9: 319-330
[Abstract]
[Full Text]
-
Brinkman, A. B., Bell, S. D., Lebbink, R. J., de Vos, W. M., van der Oost, J.
(2002). The Sulfolobus solfataricus Lrp-like Protein LysM Regulates Lysine Biosynthesis in Response to Lysine Availability. J. Biol. Chem.
277: 29537-29549
[Abstract]
[Full Text]
-
Tang, T. H., Rozhdestvensky, T. S., d'Orval, B. C., Bortolin, M.-L., Huber, H., Charpentier, B., Branlant, C., Bachellerie, J.-P., Brosius, J., Huttenhofer, A.
(2002). RNomics in Archaea reveals a further link between splicing of archaeal introns and rRNA processing. Nucleic Acids Res
30: 921-930
[Abstract]
[Full Text]