Previous Article | Next Article 
Journal of Bacteriology, July 2001, p. 3875-3884, Vol. 183, No. 13
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.13.3875-3884.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Promoters of the CATG-Specific Methyltransferase
Gene hpyIM Differ between iceA1 and
iceA2 Helicobacter pylori Strains
Qing
Xu1,* and
Martin J.
Blaser1,2,3
Department of Microbiology and
Immunology,1 and Division of Infectious
Diseases,2 Department of Medicine, Vanderbilt
University School of Medicine and VA Medical Center, Nashville,
Tennessee 37232, and Department of Medicine, New York
University School of Medicine, New York, New York
100163
Received 2 January 2001/Accepted 13 April 2001
 |
ABSTRACT |
Helicobacter pylori strains can be divided into two
groups, based on the presence of two unrelated genes,
iceA1 and iceA2, that occupy the same
genomic locus. hpyIM, located immediately downstream of
either gene, encodes a functional CATG-specific methyltransferase.
Despite the strong conservation of the hpyIM open
reading frame (ORF) among all H. pylori strains, the
sequences upstream of the ORF in iceA1 and
iceA2 strains are substantially different. To explore
the roles of these upstream sequences in hpyIM
regulation, promoter analysis of hpyIM was performed.
Both deletion mutation and primer extension analyses demonstrate that the hpyIM promoters differ between H.
pylori strains 60190 (iceA1) and J188
(iceA2). In strain 60190, hpyIM has two
promoters, Pa or PI, which may function
independently, whereas only one hpyIM promoter,
Pc, was found in strain J188. The XylE assay showed that
the hpyIM transcription level was much higher in strain
60190 than in strain J188, indicating that regulation of
hpyIM transcription differs between the H. pylori
iceA1 strain (60190) and iceA2 strains (J188).
Since the iceA1 and iceA2 sequences are
highly conserved within iceA1 or iceA2
strains, we conclude that promoters of the CATG-specific methylase gene
hpyIM differ between iceA1 and
iceA2 strains, which leads to differences in regulation
of hpyIM transcription.
 |
INTRODUCTION |
In bacteria, DNA methylation
is performed by methyltransferases (methylases). Each methylase has its
own recognition sequence, and the nucleotide to be methylated is
present within this sequence. Site-specific DNA methylation can change
the three-dimensional structure of DNA, affect interactions between DNA
and sequence-specific DNA binding proteins, and consequently have
varied cellular functions. Among these functions are host-specific
defense mechanisms (3). Bacteria usually possess two
opposing enzyme activities, DNA restriction and methylation. By
working together, they limit the spread of invading DNA molecules
within the bacterial population and protect host DNA from digestion. In
addition, DNA methylation may be involved in other cellular processes,
including DNA mismatch repair, regulation of chromosomal DNA
replication, and transposon movement (4).
Helicobacter pylori colonizes the human stomach (6,
7), which enhances the risk of peptic ulcer disease and gastric adenocarcinoma. H. pylori DNA is highly methylated on both
adenine and cytosine residues, and the methylation patterns appear
unique among various strains (26). However, despite their
potential importance, mechanisms of DNA methylation in H. pylori are not well studied. hpyIM, a CATG-specific
methylase gene (27) in H. pylori, has been
cloned and identified. Study of hpyIM may help us understand
DNA methylation in H. pylori.
The hpyIM open reading frame (ORF) is highly conserved among
various strains (27). However, the sequences upstream of
hpyIM, where its promoter presumably is located, are
substantially different, as shown in studies of iceA, the
gene immediately upstream (19). Two families of
iceA sequences are present at the same genomic location and
are designated iceA1 and iceA2. iceA1 has strong homology to nlaIIIR, which encodes a CATG-specific
restriction endonuclease (NlaIII) in Neisseria
lactamica, but iceA2 has no homology to any known gene
(11, 17). U.S. and Dutch patients colonized by strains of
the iceA1 genotypes have significantly higher levels of the
proinflammatory cytokine interleukin 8 in the gastric mucosa and higher
rates of peptic ulcer disease than those carrying iceA2
strains (19, 23), but the specific mechanisms involved are
not known.
To test whether these two unrelated genes, iceA1 and
iceA2, function as two different types of promoters for
hpyIM expression (iceA1 and iceA2
types), we sought to identify the necessary promoter regions of
hpyIM among iceA1 and iceA2 strains. A
series of deletion mutations was created in the genomes of H. pylori strains 60190 (iceA1) and J188
(iceA2), and the hpyIM promoter regions were determined based on the CATG modification status of the genomic DNAs
from each deletion mutant. The hpyIM transcriptional start sites also were determined. To evaluate the effect of the two types of
promoters on hpyIM gene expression and regulation, XylE assays were performed in this study.
 |
MATERIALS AND METHODS |
Bacterial strains, plasmids, growth conditions, and
reagents.
The strains and plasmids used in this study are listed
in Table 1. Growth conditions for
Escherichia coli and H. pylori strains were
similar to those described previously (27). Restriction enzymes and digestion buffers were obtained from New England Biolabs (Beverly, Mass.) or Promega (Madison, Wis.). Oligonucleotides used in
this study were synthesized at the Vanderbilt University Cancer Center
DNA Core Facility using a Milligen 7500 DNA synthesizer.
DNA techniques.
All DNA techniques, including chromosomal
and plasmid DNA preparation, PCR, Southern blotting, DNA sequencing,
and DNA transformation, have been described (27). Computer
analyses of DNA sequences and database similarity searches were
performed with the Genetics Computer Group programs (2).
Construction of plasmids.
Plasmids pSM1/60190, pSM2/60190,
pSM3/60190, and pSM4/60190 were constructed as follows. An insert was
constructed by ligation of three DNA fragments: 5' and 3' flanking
fragments from the cysE-iceA-hpyIM
locus and a central fragment (xylE/kan cassette). The 2.4-kb xylE/kan cassette containing a reporter gene and
a kanamycin resistance gene was generated as described previously (27). The 5' flanking fragment was created by PCR using
60190 chromosomal DNA as a template and CysE-1
(5'TCATGCTAGATCTGTTTTATAGCCT3') and IceA-R as primers,
followed by digestion with KpnI. Each 3' flanking fragment
that carried a deletion in the iceA1-hpyIM region was made by PCR using 60190 DNA as a template and the primers RM8
(5'CTTATTCAAGCGGTATTTAAGCGA3') and SM-1, SM-2, SM-3, or
SM-4. The resulting fragments were ligated with the xylE/kan
cassette and then with pT7blue, transformed into DH5
competent
cells, and selected on Luria-Bertani medium with carbenicillin.
Carr clones were examined by using both PCR and
DNA sequencing to confirm the correct constructions. The plasmids
pSM1/J188, pSM2/J188, pSM3/J188, and pSM4/J188 were constructed in a
way parallel to that used for their respective plasmids designed
for strain 60190, using J188 DNA as a template and CysE-2
(5'CTAGCGCATGCGTTGCACAAG3') with IceA-R2 or Meth-5
(5'GCTCTTCAATTTTAGACGC3') with JSM-1, JSM-2, JSM-3, or JSM-4
as primers. The plasmid pSM-1
was constructed by inserting a 175-bp
omega terminator from the plasmid pBlue
(20) at the
NotI site downstream of the xylE/kan
cassette in the plasmid pSM-1/6 0190.
Construction of H. pylori
iceA-hpyIM deletion mutants.
H.
pylori cells from 24- to 36-h cultures of strain 60190 or strain
J188 were used as recipient cells, and plasmid DNA (pSM-1/60190, pSM-2/60190, pSM-3/60190, or pSM-4/60190 for 60190; pSM-1/J188, pSM-2/J188, pSM-3/J188, or pSM-4/J188 for J188) was used as donor DNA.
Transformation and selection for kanamycin-resistant colonies were
described previously (27). The Kanr
clones were examined by PCR and by Southern hybridization using probes
corresponding to either hpyIM or the
xylE/kan cassette.
RNA techniques.
H. pylori was grown in Brucella
broth for 20 to 24 h and then harvested by centrifugation.
Preparation of total RNA was performed using the TRI REAGENT (Molecular
Research Center Inc., Cincinnati, Ohio). Primer extension was performed
as described previously (10). To perform primer extension
analysis, the oligonucleotides Meth3
(5'ATCATGGCCTACAACCGCATGGAT3') or Meth3p
(5'TTCATTGCAACCGCTATAAAGTAG3') were used to localize
transcriptional initiation sites for hpyIM. A sequencing
ladder with the same primer was generated using a sequencing kit from
Amersham Life Science (Cleveland, Ohio) and the plasmids pQX2201 or
pQX2301 as templates.
XylE enzyme activity assay.
xylE encodes catechol
2,3-dioxygenase, a ring cleavage enzyme converting catechol to
2-hydroxymuconic semialdehyde, producing a bright yellow color
(16). The xylE assay was performed as described
previously (12, 16, 28). H. pylori cells were grown in Brucella broth for 24 h. The cell density was quantified and standardized by measuring the optical density at 600 nm
(OD600). One unit of XylE enzyme activity is defined as the
amount of enzyme that oxidizes 1 mmol of catechol per min per
OD600 of cells at 24°C. The molar
extinction coefficient of 2-hydroxymuconic semialdehyde is 4.4 × 104 (28).
Nucleotide sequence accession number.
The DNA sequence of
the iceA2-hpyIM locus in H. pylori
strain J188 has been submitted to the GenBank database under accession number AF250225.
 |
RESULTS |
Diversity of sequences upstream of hpyIM in
iceA1 and iceA2 strains.
The
sequence of the cysE-iceA-hpyIM locus
in H. pylori strain J188 was determined and compared to that
in strain 60190 (Fig. 1). cysE
and hpyIM are conserved (with 85 and 94% identity) between the two strains, whereas iceA is not (with only 38%
identity), which is consistent with previous findings (11,
19). The ORFs of cysE and hpyIM are 516 and 990 bp, respectively (Fig. 1), while the longest potential
iceA1 ORF in strain 60190 is 537 bp, starting from TTG, and
the longest iceA2 ORF in strain J188 is 336 bp, starting
from CTG (Fig. 1). The diversity between the two loci begins 81 bp
after the cysE ORF and ends just before the hpyIM ORF. We sought to investigate whether these two unrelated regions in
H. pylori 60190 (iceA1 strain) and J188
(iceA2 strain) function as different promoters for
hpyIM.

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 1.
Comparison of H. pylori iceA1 and
iceA2 loci. Schematic representation of the
cysE-iceA-hpyIM loci in
H. pylori strains 60190 (iceA1)
and J188 (iceA2). The ORFs are represented by open
boxes. The lines between the boxes represent noncoding regions. Each
arrow represents the deduced direction of transcription.
|
|
Construction of H. pylori strain 60190 mutants with
deletions upstream of hpyIM
To define the region
necessary for hpyIM expression in iceA1
strains, we constructed isogenic mutants of H. pylori
strain 60190 with a series of deletions in the
iceA1-hpyIM locus (Fig. 2 and 3A).
In each mutant, the deleted region was replaced by the
xylE/kan cassette, which has the same orientation as for
iceA1 and hpyIM, and the promoterless
xylE reporter was located immediately downstream of one
of the predicted iceA1 start sites (TTG) in H.
pylori 60190 (19). Thus, the mutant strains
60190SM1, 60190SM2, 60190SM3, and 60190SM4 are identical upstream of
xylE/kan and possess 334, 216, 128, or 0 bp, respectively, of the intact region between
xylE/kan and the hpyIM
ORF.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 2.
The 937-bp
cysE-iceA1-hpyIM region in
H. pylori strain 60190. Partial cysE and
hpyIM sequences and full iceA1 DNA
sequences with their deduced protein sequences are presented. The
potential translation start sites in iceA1 and
hpyIM are in bold letters. The sequences of primers
IceA-R1, SM-1, SM-2, SM-3, and SM-4 are underlined, and the arrows
indicate the directions of primers. The sequences between IceA-R1 and
SM-1, SM-2, SM-3, or SM-4 are deleted in plasmids pSM-1, pSM-2, pSM-3,
or pSM-4 and mutants 60190SM1, 60190SM2, 60190SM3, or 60190SM4. The
transcription start (+1) sites mapped by primer extension analysis are
shaded. The bent arrows, labeled with the designated promoter names
Pa and PI, indicate the direction of RNA. The
putative 10 and 35 hexamers are boxed.
|
|

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 3.
Deletion analysis of the hpyIM promoter
of the iceA1 H. pylori strain 60190. (A) Schematic
representation of hpyIM structures in wild-type
H. pylori 60190 (60190wt), hpyIM mutant
(60190M ), and mutants with deletion upstream of
hpyIM (60190SM1, 60190SM2, 60190SM3, and 60190SM4). The
dotted lines represent the deleted regions upstream of
hpyIM, and the solid lines represent the intact regions.
The positions of the deletion regions are labeled under the lines.
Susceptibility to NlaIII digestion and DNA modification
status at CATG sites are indicated in the panels at the right. Plus
signs represent "digestible by NlaIII" or "with
modification at CATG sites"; minus signs carry the opposite meanings.
(B) Examination of the effects of deleting sequences upstream of
hpyIM on CATG modification of the DNA. Chromosomal DNA
from wild-type H. pylori 60190, its hpyIM
mutant, and its deletion mutants was digested with
NlaIII or HindIII or left uncut, and the
digested products were resolved on a 1% agarose gel. The recognition
sequences for NlaIII or HindIII are shown
at the right.
|
|
Assay of hpyIM promoter activities in the H.
pylori 60190 deletion mutants.
H. pylori hpyIM
encodes a methylase that specifically modifies DNA at CATG sites,
providing resistance to NlaIII digestion (27).
The mutated hpyIM in 60190M
has no
methylase function, which renders its chromosomal DNA susceptible to
NlaIII digestion. Therefore, we used the CATG modification status of H. pylori DNA in each of the mutants to determine
the effect of the deletion on hpyIM expression. Chromosomal
DNA was isolated from these mutant strains and subjected to digestion by restriction endonucleases, NlaIII and
HindIII (as a control) (Fig. 3B). DNAs from 60910wt and
60190M
, as positive and negative controls for
CATG modification, respectively, were digested in parallel. As
expected, DNA from all strains was digested by HindIII,
indicating that each DNA was of sufficient purity to permit
endonuclease digestion. Also, as expected, the DNA from the wild-type
strain was resistant to NlaIII, while the DNA from the
hpyIM::xylE mutant was digestible,
indicating that CATG modification was present in 60190wt but not in
60190M
. DNA from the deletion mutant 60190SM1
was completely resistant to digestion. In contrast, DNA from 60190SM2
was partially digested, and DNA from 60190SM3 and 60190SM4 was
completely digestible by NlaIII. These results indicate that
the mutant strain 60190SM1, with a 334-bp intact sequence upstream of
hpyIM, had CATG modification in its chromosomal DNA, and
thus hpyIM was functional, whereas the mutant strains
60190SM2, 60190SM3, and 60190SM4, with a
215-bp intact sequence
upstream of hpyIM, either partially or completely lost their
ability to modify DNA at CATG sites. Thus, these data indicate that the
promoter of hpyIM in strain 60190 is located in the 334-bp
upstream region of hpyIM.
In each of the deletion mutants, the
kan cassette was
located upstream of and in the same orientation as
hpyIM
(Fig.
3A),
a location suggesting the possibility that the
kan promoter may
affect
hpyIM expression.
However, the fact that DNA from 60190SM3
and 60190SM4 was completely
digestible by
NlaIII suggests that
the
kan
promoter had little effect on
hpyIM expression. To rule
out
the possibility that any part of the
kan sequence
contributes
to the full expression of
hpyIM in the mutant
60190SM1, a 140-bp
T4 phage translational and transcriptional
terminator from the
omega cassette (
20) was inserted
downstream of the
xylE/
kan cassette to create the
mutant strain 60190SM1

. DNA from this
mutant was resistant to
NlaIII and susceptible to
HindIII digestion,
respectively (data not shown), which confirms that the 334-bp
region
upstream of
hpyIM itself possesses a functional promoter
sufficient to drive full expression of
hpyIM.
Primer extension analysis to identify hpyIM
transcription start sites in H. pylori 60190.
To
determine the transcription initiation sites of hpyIM in
strain 60190, primer extension analysis was performed. Extension from
the oligonucleotide Meth3 resulted in one product (232 nucleotides long) corresponding to an initiation site at the A residue (Fig. 4A) 157 nucleotides upstream of the start
site of the hpyIM ORF (Fig. 2). This result is consistent
with the deletion analysis results, in which mutant 60190SM3 (having a
128-bp upstream sequence intact of the hpyIM ORF) had no
hpyIM activity. To further confirm this result, the
oligonucleotide Meth3p, which is 70 bp upstream of Meth3, also was used
for primer extension studies. Extension from this primer resulted in
two products. One product (162 nucleotides long) corresponded to the
same initiation site, as indicated by the Meth3 study (data not shown),
confirming the presence of a promoter, designated
Pa, upstream of this site (Fig. 2). Another product (445 to 458 nucleotides long) corresponded to a region, 5'GTTTTTAACCAAAG3' (Fig. 4B), that is 441 to 454 nucleotides
upstream of the hpyIM ORF (Fig. 2). The exact location of
this extremely long product is difficult to determine because the
sequencing ladder becomes compressed in this region. However, the
presence of this extension product is consistent with our previous
analysis of the strain 60190 iceA1 transcripts
(10), in which two initiation sites (G and A) were
identified 454 and 456 nucleotides upstream of the hpyIM ORF
(Fig. 2) when the primer R7 (356 bp upstream of Meth3p) was used. This
upstream promoter, designated PI (Fig. 2),
was deleted in mutants 60190SM1, 60190SM2, 60190SM3, and 60190SM4. However, hpyIM was functional in strain 60190SM1, indicating
that in addition to the upstream promoter (PI),
the promoter Pa located in the 177-bp region
upstream of the +1 site may function independently to drive
hpyIM expression and provides full protection of cellular DNA from digestion by its cognate endonuclease.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 4.
Primer extension analysis of the hpyIM
transcript in the iceA1 H. pylori strain 60190. (A) The
32P-labeled Meth3 primer was used in this analysis. The
corresponding sequencing ladder is shown, and the arrow indicates the
nucleotide position of the +1 site (residue A) that is 157 nt upstream
of the hpyIM ORF (see Fig. 2). (B) The
32P-labeled Meth3p primer was used in this analysis. The
arrow indicates the position of the extension product, which
corresponds to a region 441 to 454 nt upstream of the translation start
site (see Fig. 2).
|
|
There is a 157-nucleotide (nt) untranslated region in the
hpyIM transcript derived from the P
a
promoter. Analysis of the sequences
upstream of the transcription
initiation sites also reveals that
hexamers with homology to the

10
consensus sequence (TATAAT)
in
E. coli (
9,
15)
are present at

10 positions, TTCTAT for
the P
a
promoter and TATAAT for the P
I promoter. A
sequence homologous
to the
E. coli 
35 (TTGACA) hexamer
(
9,
15) is present at
the

35 position of the
P
I promoter (TTGATA) but not for the
P
a promoter. The mutant 60190SM2 has a 216-bp
intact sequence upstream
of the
hpyIM ORF that includes the

10 and

35 regions. However,
DNA from this mutant was only partially
resistant to
NlaIII digestion,
indicating that additional
elements are needed for full
hpyIM expression.
Construction of H. pylori strain J188 mutants with a
series of deletions upstream of hpyIM.
To define
the region that is necessary for hpyIM expression in
iceA2 strains, we constructed isogenic mutants of H. pylori strain J188 that targeted the
iceA2-hpyIM locus, in parallel to the
hpyIM deletion mutants of strain 60190 (Fig.
5). As with the 60190 deletion
mutants, the deleted regions were replaced by the xylE/kan
cassette, in the same orientation as iceA2. Mutant strains J188SM1, J188SM2, J188SM3, and J188SM4 are identical upstream of the
promoterless reporter xylE, located downstream of one of the
predicted iceA2 start sites (CTG) in H. pylori
strain J188, and possess 304, 200, 100, or 0 bp, respectively, of
intact region upstream of hpyIM (Fig. 6A).

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 5.
The 1,023-bp
cysE-iceA2-hpyIM region in
H. pylori strain J188. Partial cysE and
hpyIM sequences and full iceA2 DNA
sequences with their deduced amino acid sequences are presented.
Potential translational start sites in iceA2 and
hpyIM are in bold letters. The sequences of primers
IceA-R2, SM-1, JSM-2, JSM-3, and JSM-4 are underlined, and the
arrows show the directions of primers. The sequences between
IceA-R2 and JSM-1, JSM-2, JSM-3, or JSM-4 are deleted in plasmids
pSM-1/J188, pSM-2/J188, pSM-3/J188, and pSM-4/J188 and in mutants
J188SM1, J188SM2, J188SM3, and J188SM4. A transcriptional
initiation(+1) site is shaded (G). A bent arrow, labeled with the
designated promoter name Pc, indicates the direction of
transcription. The putative 10 and TTTTAA regions for the promoter
Pc are boxed.
|
|
Assay of hpyIM promoter activities in the H.
pylori J188 deletion mutants.
To analyze the CATG
modification status of the hpyIM mutants of strain
J188, chromosomal DNA from these mutants was digested with
the restriction endonucleases NlaIII and
HindIII (Fig. 6B). DNA
from J188wt and J188M
, used as positive and
negative controls for CATG modification, respectively, was digested in
parallel. As expected, DNA from all strains was digested by
HindIII, and DNA from the
hpyIM::xylE mutant was digestible by
NlaIII, whereas DNA from the wild-type strain was resistant.
DNA from mutants J188SM1, J188SM2, and J188SM3 was completely
resistant, while DNA from J188SM4 was digestible by NlaIII.
The results indicate that J188 mutants with as little as 100 bp of
intact sequence upstream of the translational start site in
hpyIM have a functional hpyIM gene and that in
strain J188, a sufficient hpyIM promoter is located within
100 bp upstream of this start site.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 6.
Deletion analysis of the hpyIM promoter
of the iceA2 H. pylori strain J188. (A) Schematic
representation of hpyIM structures in the wild-type
strain J188 (J188wt), hpyIM mutant
(J188M ), and mutants with deletions upstream of
hpyIM (J188SM1, J188SM2, J188SM3, and J188SM4). (B)
Examination of the effects of deleting sequences upstream of
hpyIM on CATG modification of the DNA. Chromosomal DNA
from the wild-type strain J188, its hpyIM mutant, and
its deletion mutants was digested with NlaIII and
HindIII or was uncut, and the digested products were
resolved on a 1% agarose gel.
|
|
Primer extension analysis to identify hpyIM
transcription start sites in H. pylori J188.
Next,
primer extension analysis was performed to determine the transcription
initiation site of hpyIM in strain J188. Extension from the
primer Meth3 resulted in a product corresponding to an initiation site
at a G residue (Fig. 7), 21 nucleotides
upstream of the start of the hpyIM ORF (Fig. 5). This
transcription initiation site of the J188 hpyIM promoter,
designated Pc, is consistent with results of
NlaIII digestion, in which DNA of J188SM3 (with a 100-bp
intact region upstream of hpyIM) was completely resistant, while DNA of J188SM4 (with no intact region upstream of
hpyIM) was NlaIII digestible. Sequences with
partial homology to the
10 promoter element in E. coli
were found at the
10 (TTTATT) position of the
Pc promoter, but no E. coli
35
element was found at the
35 position. The motif TTTTAA, conserved in
H. pylori promoters (24), was identified 11 bp
upstream of the
10 element.

View larger version (97K):
[in this window]
[in a new window]
|
FIG. 7.
Primer extension analysis of the hpyIM
transcript in the iceA2 H. pylori strain J188. The
32P-labeled Meth3 primer was used for the analysis. The
corresponding sequencing ladder is shown, and the arrow indicates the
nucleotide position of the +1 site (residue G), which is 21 nucleotides
upstream of the hpyIM ORF (see Fig. 5).
|
|
Comparison of hpyIM transcription levels in
H. pylori strains 60190 and J188.
In the
hpyIM mutants 60190M
and J188
M
, promoterless xylE carrying a
ribosomal binding site was inserted into the middle of the
hpyIM ORF, forming
xylE::hpyIM transcriptional fusions
(Fig. 3A and 6A). To investigate whether the different hpyIM
promoters among the iceA1 and iceA2 strains
differentially regulate hpyIM at the transcriptional level,
60190M
and J188M
and
their wild-type strains, 60190wt and J188wt, were examined for XylE
activity. The XylE activity in the reporter strain
60190M
was 653 ± 38 mU/OD600 (Fig. 8),
substantially greater than the basal level of xylE activity
(21 ± 4 mU/OD600) in the control (xylE
) 60190wt strain (Fig. 8),
indicating the presence of hpyIM promoter activity in 60190. In contrast, the xylE activity in H. pylori J188M
was similar to the basal level of XylE
activity in J188wt (Fig. 8), indicating no detectable hpyIM
promoter activity in J188. These data indicate that hpyIM
expression between H. pylori 60190 and J188 differs at the
transcriptional level.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 8.
XylE activity of H. pylori strains
60190M and J188M (H. pylori
hpyIM::xylE transcriptional reporter
strains). Specific XylE activities (milliunits per OD600
per milliliter) were determined by using H. pylori cells
that had been grown for 24 h. Results represent the mean ± standard deviation for three assays.
|
|
 |
DISCUSSION |
This study demonstrates that the promoters for hpyIM
differ between H. pylori strains possessing iceA1
(60190) and iceA2 (J188). Comparison of iceA1
sequences from 37 H. pylori strains available in
GenBank demonstrated that the sequences are either identical or nearly
identical to that of strain 60190 in the hpyIM promoter regions (data not shown). Alignment of the J188 iceA2
sequences with those from six other iceA2 strains in GenBank
also showed strong similarities in the hpyIM promoter
regions (data not shown). Thus, the respective hpyIM
promoters identified in this study likely represent these in other
iceA1 and iceA2 strains.
In the iceA1 strain 60190, hpyIM transcripts have
two initiation sites, located 157 or 454 to 456 bp upstream of the
hpyIM ORF start site, driven by the promoters
Pa and PI, respectively. hpyIM is cotranscribed with a 384-bp ORF in iceA1
(Fig. 2) to produce an ~1,460-nt major mRNA transcript
(10), suggesting that the PI
promoter is a major promoter for hpyIM expression. However,
the mutant 60190SM1, in which the PI promoter was
deleted, had full M.HpyI activity, indicating that
the promoter Pa may function independently and
sufficiently to drive hpyIM expression. While
hpyIM transcription in the iceA1 strain 60190 is
regulated by two promoters, only one hpyIM promoter,
Pc, has been identified in strain J188. The
initiation site of hpyIM transcription is 21 nt upstream of
the hpyIM translational start site, and deletion studies
indicate that the promoter Pc is located between
the
79 and +1 sites.
Both hpyIM::xylE transcriptional fusion and
Northern hybridization studies (J. P. Donahue and G. G. Miller, unpublished data) indicate that hpyIM transcription
levels are much higher in iceA1 strains (60190 and J166)
than in iceA2 strains (J188 and J178). The presence of
different hpyIM promoters in these two types of strains
could explain such differential hpyIM transcription.
However, other factors also may contribute to the difference in
hpyIM transcription. For H. pylori strains 26695 (iceA1) and J99 (iceA2), 6 to 7% of the genes
are strain specific (1). Trans-acting factors
among iceA1 and iceA2 strains may be varied and
may regulate hpyIM differently. In addition, variation in
mRNA stability may affect hpyIM mRNA levels. The
hpyIM transcripts from the Pa and
PI promoters in strain 60190 are substantially
longer than in strain J188, which may affect mRNA stability.
The H. pylori 26695 genome contains rpoA,
rpoB, and rpoD-like genes that separately encode
the RNA polymerase
and
subunits and the major
factor
(22). H. pylori possesses
80 but not
70, and
its RpoD cannot complement an E. coli rpoD mutant
(5), suggesting that initiation of RNA transcription is
not identical for these organisms. The hpyIM promoters
contain
10 hexamers with homology to the E. coli
10
consensus sequence; however, except for the promoter
PI, which exhibits a
35 hexamer with similarity
to the E. coli
35 consensus sequence, no obvious
35 box
was found in the hpyIM promoters. Promoter differences
between H. pylori and other bacteria, including E. coli, have been reported (13, 21, 24). New motifs,
TTAAGC or TTTTAA, have been proposed to be combined with the
10
hexamer in H. pylori promoters (24). However,
TTAAGC was not present in the hpyIM promoters, whereas TTTTAA was found in the promoter Pc.
hpyIM is well conserved (27), and
iceA1-hpyIM is a homolog of a CATG-specific type
II restriction-modification (R-M) system in N. lactamica.
However, due to the presence of mutations, H. pylori iceA1
appears to be degenerate in most strains (11; Q. Xu and
M. J. Blaser, unpublished data). These data and its presence in
iceA2 strains that lack any nlaIIIR-homologs
indicate that hpyIM is not primarily involved in
host-specific defense mechanisms. R-M systems in H. pylori
are highly diverse among different strains (26). Strong
conservation of hpyIM in contrast to the varied R-M systems
among H. pylori strains suggests that CATG methylation may
be involved in other important cellular processes. DNA methylation is
involved in virulence-related function, as shown in studies of the
pyelonephritis-associated pili (Pap) operon in E. coli (8) and the fimbriae (Pef) operon in Salmonella
enterica serovar Typhimurium (18). Expression
of Pap and Pef is transcriptionally regulated by methylation of GATC
sites in their promoters; the methylation status of these sites
controls phase variation, which facilitates bacterial adherence to host
tissues, and thus colonization. DNA adenine methylation driven by Dam
in serovar Typhimurium has an essential role in bacterial virulence
(14). The iceA1 (but not iceA2)
strains are significantly associated with high levels of the
proinflammatory cytokine interleukin 8 in the gastric mucosa and with
peptic ulcer disease in Western populations (19, 23). Whether hpyIM-regulated methylation is involved in
virulence-related functions and whether the differing regulation of
CATG methylation among iceA1 and iceA2 strains is
related to the different clinical outcomes among these strains remain
to be determined.
 |
ACKNOWLEDGMENTS |
We thank J. P. Donahue, G. G. Miller, and G. Mosig for
useful discussions.
This work was supported in part by the Vanderbilt Cancer Center Core
Grant and National Institutes of Health grants RO1 DK53707 and GM63270.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Molecular Genetics, Harvard Medical School, Rm. 408, Building D1, 200 Longwood Ave., Boston, MA 02115. Phone: (617) 432-1937. Fax: (617) 738-7664. E-mail:
qing_xu{at}hms.harvard.edu.
 |
REFERENCES |
| 1.
|
Alm, R. A.,
L. L. Ling,
D. T. Moir,
B. L. King,
E. D. Brown,
P. C. Doig,
D. R. Smith,
B. C. Guild,
B. L. deJonge,
G. Carmel,
P. J. Tummino,
A. Caruso,
M. Uria-Nickelsen,
D. M. Mills,
C. Ives,
R. Gibson,
D. Merberg,
S. D. Mills,
Q. Jiang,
D. E. Taylor,
G. F. Vovis, and T. J. Trust.
1999.
Genomic sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori.
Nature
397:176-180[CrossRef][Medline].
|
| 2.
|
Altschul, S. F.,
W. Gish,
W. Miller,
E. W. Myers, and D. J. Lipman.
1990.
Basic local alignment search tool.
J. Mol. Biol.
215:403-410[CrossRef][Medline].
|
| 3.
|
Arber, W.
1965.
Host-controlled restriction and modification of bacteriophage.
Annu. Rev. Microbiol.
19:365-378[CrossRef][Medline].
|
| 4.
|
Barras, F., and M. G. Marinus.
1989.
The great GATC: DNA methylation in E. coli.
Trends Genet.
5:138-143[CrossRef][Medline].
|
| 5.
|
Beier, D.,
G. Spohn,
R. Rappuoli, and V. Scarlato.
1998.
Functional analysis of the Helicobacter pylori principal sigma subunit of RNA polymerase reveals that the spacer region is important for efficient transcription.
Mol. Microbiol.
30:121-134[CrossRef][Medline].
|
| 6.
|
Berg, D. E., and R. P. H. Logan.
1997.
Helicobacter pylori, individual host specificity and human disease.
Bioessays
19:86-90[CrossRef][Medline].
|
| 7.
|
Blaser, M. J.
1997.
Ecology of Helicobacter pylori in the human stomach.
J. Clin. Investig.
100:759-762[Medline].
|
| 8.
|
Braaten, B. A.,
X. Nou,
L. S. Kaltenbach, and D. A. Low.
1994.
Methylation patterns in pap regulatory DNA control pyelonephritis-associated pili phase variation in E. coli.
Cell
76:577-588[CrossRef][Medline].
|
| 9.
|
deHaseth, P. L.,
M. L. Zupancic, and M. T. Record, Jr.
1998.
RNA polymerase-promoter interactions: the comings and goings of RNA polymerase.
J. Bacteriol.
180:3019-3025[Free Full Text].
|
| 10.
|
Donahue, J. P.,
R. M. Peek, Jr.,
S. A. Thompson,
Q. Xu,
M. J. Blaser, and G. G. Miller.
2000.
Analysis of iceA1 transcription in the Helicobacter pylori.
Helicobacter
5:1-12[Medline].
|
| 11.
|
Figueiredo, C.,
W. G. V. Quint,
R. Sanna,
E. Sablon,
J. P. Donahue,
Q. Xu,
G. G. Miller,
R. M. Peek,
M. J. Blaser, and L. J. van Doorn.
2000.
Genetic organization and heterogeneity of the iceA locus of Helicobacter pylori.
Gene
246:59-68[CrossRef][Medline].
|
| 12.
|
Forsyth, M. H.,
J. C. Atherton,
M. J. Blaser, and T. L. Cover.
1998.
Heterogeneity in levels of vacuolating cytotoxin gene (vacA) transcription among Helicobacter pylori strains.
Infect. Immun.
66:3088-3094[Abstract/Free Full Text].
|
| 13.
|
Forsyth, M. H., and T. L. Cover.
1999.
Mutational analysis of the vacA promoter provides insight into gene transcription in Helicobacter pylori.
J. Bacteriol.
181:2261-2266[Abstract/Free Full Text].
|
| 14.
|
Heithoff, D. M.,
R. L. Sinsheimer,
D. A. Low, and M. J. Mahan.
1999.
An essential role for DNA adenine methylation in bacterial virulence.
Science
284:967-970[Abstract/Free Full Text].
|
| 15.
|
Ishihama, A.
1990.
Molecular assembly and functional modulation of Escherichia coli RNA polymerase.
Adv. Biophys.
26:19-31[CrossRef][Medline].
|
| 16.
|
Konyecsni, W., and V. Deretic.
1988.
Broad-host-range plasmid and M13 bacteriophage-derived vectors for promoter analysis in Escherichia coli and Pseudomonas aeruginosa.
Gene
74:375-386[CrossRef][Medline].
|
| 17.
|
Morgan, R. D.,
R. R. Camp,
G. G. Wilson, and S. Y. Xu.
1996.
Molecular cloning and expression of NlaIII restriction-modification system in E. coli.
Gene
183:215-218[CrossRef][Medline].
|
| 18.
|
Nicholson, B., and D. Low.
2000.
DNA methylation-dependent regulation of Pef expression in Salmonella typhimurium.
Mol. Microbiol.
35:728-742[CrossRef][Medline].
|
| 19.
|
Peek, R. M., Jr.,
J. P. Donahue,
K. T. Tham,
S. A. Thompson,
J. C. Atherton,
M. J. Blaser, and G. G. Miller.
1998.
Adherence to gastric epithelial cells induces expression of a Helicobacter pylori gene, iceA, that is associated with clinical outcome.
Proc. Assoc. Am. Physi.
110:531-544.
|
| 20.
|
Prentki, P., and H. M. Krisch.
1984.
In vitro insertional mutagenesis with a selectable DNA fragment.
Gene
29:303-313[CrossRef][Medline].
|
| 21.
|
Spohn, G.,
D. Beier,
R. Rappuoli, and V. Scarlato.
1997.
Transcriptional analysis of the divergent cagAB genes encoded by the pathogenicity island of Helicobacter pylori.
Mol. Microbiol.
26:361-372[CrossRef][Medline].
|
| 22.
|
Tomb, J. F.,
O. White,
A. R. Kerlavage,
R. A. Clayton,
G. Sutton,
R. D. Fleischmann,
K. A. Ketchum,
H. P. Klenk,
S. Gill,
B. A. Dougherty,
K. Nelson,
J. Quackenbush,
L. Zhou,
E. F. Kirkness,
S. Peterson,
B. Loftus,
D. Richardson,
R. Dodson,
H. G. Khalak,
A. Glodek,
Keith McKenney,
L. M. Fitzegerald,
N. Lee,
M. D. Adama,
E. K. Hickey,
D. E. Berg,
J. D. Gocayne,
T. Utterback,
J. D. Peterson,
J. Kelley,
M. D. Cotton,
J. M. Weidman,
C. Fujii,
C. Bowman,
L. Watthey,
E. Wallin,
W. S. Hayes,
M. Borodovsky,
P. D. Karp,
H. O. Smith,
C. Fraser, and J. C. Venter.
1997.
The complete genome sequence of the gastric pathogen Helicobacter pylori.
Nature
388:539-547[CrossRef][Medline].
|
| 23.
|
van Doorn, L. J.,
C. Figueiredo,
R. Sanna,
A. Plaisier,
P. Schneeberger,
W. A. de Boer, and W. Quint.
1998.
Clinical relevance of the cagA, vacA, and iceA status of Helicobacter pylori.
Gastroenterology
115:58-66[CrossRef][Medline].
|
| 24.
|
Vanet, A.,
L. Marsan,
A. Labigne, and M. F. Sagot.
2000.
Inferring regulation elements from a whole genome. An analysis of Helicobacter pylori 80 family of promoter signals.
J. Mol. Biol.
297:335-353[CrossRef][Medline].
|
| 25.
|
Woodcock, D. M.,
P. J. Crowther,
J. Doherty,
S. Jefferson,
E. Decruz,
M. Noyer-weiner,
S. S. Smith,
M. Z. Michael, and M. W. Graham.
1989.
Quantitative evaluation of E. coli host strains for tolerance to cytosine methylation in plasmid and phage recombinants.
Nucleic Acids Res.
17:3469-3478[Abstract/Free Full Text].
|
| 26.
|
Xu, Q.,
R. D. Morgan,
R. J. Roberts, and M. J. Blaser.
2000.
Identification of type II restriction and modification systems in Helicobacter pylori reveals their substantial diversity among strains.
Proc. Natl. Acad. Sci. USA
97:9671-9676[Abstract/Free Full Text].
|
| 27.
|
Xu, Q.,
R. M. Peek, Jr.,
G. G. Miller, and M. J. Blaser.
1997.
The Helicobacter pylori genome is modified at CATG by the product of hpyIM.
J. Bacteriol.
179:6807-6815[Abstract/Free Full Text].
|
| 28.
|
Zukowski, M. M.,
D. F. Gaffney,
D. Speck,
M. Kauffmann,
A. Findeli, and J. P. Lecocq.
1983.
Chromogenic identification of genetic regulation signals in Bacillus subtilis based on expression of a cloned Pseudomonas gene.
Proc. Natl. Acad. Sci. USA
80:1101-1105[Abstract/Free Full Text].
|
Journal of Bacteriology, July 2001, p. 3875-3884, Vol. 183, No. 13
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.13.3875-3884.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Tsao, M.-Y., Lin, T.-L., Hsieh, P.-F., Wang, J.-T.
(2009). The 3'-to-5' Exoribonuclease (Encoded by HP1248) of Helicobacter pylori Regulates Motility and Apoptosis-Inducing Genes. J. Bacteriol.
191: 2691-2702
[Abstract]
[Full Text]
-
Aras, R. A., Small, A. J., Ando, T., Blaser, M. J.
(2002). Helicobacter pylori interstrain restriction-modification diversity prevents genome subversion by chromosomal DNA from competing strains. Nucleic Acids Res
30: 5391-5397
[Abstract]
[Full Text]
-
Xu, Q., Morgan, R. D., Roberts, R. J., Xu, S. Y., van Doorn, L. J., Donahue, J. P., Miller, G. G., Blaser, M. J.
(2002). Functional analysis of iceA1, a CATG-recognizing restriction endonuclease gene in Helicobacter pylori. Nucleic Acids Res
30: 3839-3847
[Abstract]
[Full Text]
-
Chattopadhyay, S., Datta, S., Chowdhury, A., Chowdhury, S., Mukhopadhyay, A. K., Rajendran, K., Bhattacharya, S. K., Berg, D. E., Nair, G. B.
(2002). Virulence Genes in Helicobacter pylori Strains from West Bengal Residents with Overt H. pylori-Associated Disease and Healthy Volunteers. J. Clin. Microbiol.
40: 2622-2625
[Abstract]
[Full Text]
-
Takata, T., Aras, R., Tavakoli, D., Ando, T., Olivares, A. Z., Blaser, M. J.
(2002). Phenotypic and genotypic variation in methylases involved in type II restriction-modification systems in Helicobacter pylori. Nucleic Acids Res
30: 2444-2452
[Abstract]
[Full Text]
-
Ando, T., Wassenaar, T. M., Peek, R. M. Jr., Aras, R. A., Tschumi, A. I., van Doorn, L.-J., Kusugami, K., Blaser, M. J.
(2002). A Helicobacter pylori Restriction Endonuclease-replacing Gene, hrgA, Is Associated with Gastric Cancer in Asian Strains. Cancer Res.
62: 2385-2389
[Abstract]
[Full Text]