Previous Article | Next Article 
Journal of Bacteriology, July 2001, p. 3931-3938, Vol. 183, No. 13
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.13.3931-3938.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Intra- and Interspecies Signaling between
Streptococcus salivarius and Streptococcus
pyogenes Mediated by SalA and SalA1 Lantibiotic Peptides
M.
Upton,1,2,
J. R.
Tagg,2
P.
Wescombe,2 and
H.
F.
Jenkinson1,*
Department of Oral and Dental Science,
University of Bristol Dental School, Bristol, BS1 2LY, United
Kingdom,1 and Department of
Microbiology, University of Otago, Dunedin, New
Zealand2
Received 28 November 2000/Accepted 10 April 2001
 |
ABSTRACT |
Streptococcus salivarius 20P3 produces a 22-amino-acid
residue lantibiotic, designated salivaricin A (SalA), that inhibits the
growth of a range of streptococci, including all strains of Streptococcus pyogenes. Lantibiotic production is
associated with the sal genetic locus comprising
salA, the lantibiotic structural gene; salBCTX
genes encoding peptide modification and export machinery proteins; and
salYKR genes encoding a putative immunity protein and
two-component sensor-regulator system. Insertional inactivation of
salB in S. salivarius 20P3 resulted in
abrogation of SalA peptide production, of immunity to SalA, and of
salA transcription. Addition of exogenous SalA peptide to
salB mutant cultures induced dose-dependent expression of
salA mRNA (0.2 kb), demonstrating that SalA production was
normally autoregulated. Inactivation of salR encoding the response regulator of the SalKR two-component system led to reduced production of, and immunity to, SalA. The sal genetic locus
was also present in S. pyogenes SF370 (M type 1), but
because of a deletion across the salBCT genes, the
corresponding lantibiotic peptide, designated SalA1, was not produced.
However, in S. pyogenes T11 (M type 4) the sal
locus gene complement was apparently complete, and active SalA1 peptide
was synthesized. Exogenously added SalA1 peptide from S. pyogenes T11 induced salA1 transcription in S. pyogenes SF370 and in an isogenic S. pyogenes T11
salB mutant and salA transcription in S. salivarius 20P3 salB. Thus, SalA and SalA1 are
examples of streptococcal lantibiotics whose production is
autoregulated. These peptides act as intra- and interspecies signaling
molecules, modulating lantibiotic production and possibly influencing
streptococcal population ecology in the oral cavity.
 |
INTRODUCTION |
Streptococcus salivarius
is a primary colonizer of neonatal oral mucosal surfaces and a
predominant component of the human adult oral microbiota and is not
associated with disease in healthy individuals (39).
Streptococcus pyogenes, on the other hand, persists in the
pharynx in a carrier state in approximately 10% of the population, is
a common cause of pharyngeal infections, especially in school-aged
children, and is usually present in high numbers only during acute
infection (1). All S. pyogenes strains tested
have been found to be susceptible to growth inhibition by salivaricin A
(SalA), a lantibiotic peptide produced by S. salivarius
(34, 37), and it has been suggested that growth of
S. pyogenes in vivo may be modulated by indigenous
SalA-producing S. salivarius.
Lantibiotics are antimicrobial peptides that are produced by, and are
active against, closely related gram-positive organisms. These peptides
are ribosomally synthesized and then undergo posttranslational modifications, including amino acid dehydration (38) and
thioether bridge formation (20). Lantibiotics form two
families; type A lantibiotics are linear, and type B lantibiotics have
more globular conformations. The peptides are synthesized as
prepropeptides consisting of an inhibitor propeptide and a leader
region, the features of which have been utilized to group the type A
lantibiotics into three subclasses (36). In the members of
one of these subclasses, subclass AII, the amino acid (aa) residues
Gly-Gly, Gly-Ser, or Gly-Ala immediately precede the site of leader
cleavage. These Gly-Gly type cleavage sites are more commonly found in
nonmodified bacteriocins or pheromones, such as the ComC peptide
responsible for competence induction in Streptococcus
pneumoniae (15). The streptococcal pheromones are
quorum-sensing molecules, analogous to the N-acyl homoserine
lactones produced by gram-negative bacteria (35), that
regulate microbial community responses.
SalA (22 aa residues) is a subclass AII lantibiotic produced by
S. salivarius 20P3 via processing of a 48-aa prepropeptide encoded by the salA gene (34). By utilizing
salA as a DNA hybridization probe it was shown that all SalA
peptide-producing strains of S. salivarius contained
salA sequences and that, somewhat surprisingly, 63 of 65 S. pyogenes strains of different M types contained a salA gene homolog designated salA1
(37). We hypothesized that S. pyogenes failed
to produce SalA1 inhibitor and was sensitive to inhibition by SalA from
S. salivarius because the genetic locus for lantibiotic
production and immunity was incomplete or transcriptionally inactive.
In the present study, the structure of the sal genetic locus
in S. salivarius 20P3 was determined and the genes necessary for regulation of lantibiotic production were identified. In S. pyogenes SF370 (M type 1), the corresponding sal
genetic locus had a deletion spanning three genes encoding peptide
modification and export proteins, and the salA1 gene was
transcriptionally inactive, thus accounting for the lack of SalA1
production. However, the salA gene was actively transcribed
in S. pyogenes T11 (M type 4), which contained a complete
sal genetic locus, and active SalA1 inhibitor peptide was
produced. To the best of our knowledge, this is the first report of an
autoregulatory lantibiotic produced by streptococci, and the evidence
presented here suggests that SalA-like peptides form a family of
signaling factors recognized by different species of streptococci.
 |
MATERIALS AND METHODS |
Bacterial strains and media.
S. salivarius 20P3
(wild type, SalA+) (34), S. pyogenes SF340 (M type 1, SalA
) (41),
and S. pyogenes T11 (M type 4, SalA+ clinical
isolate) were maintained on Columbia agar plates (Life Technologies
Ltd., Paisley, United Kingdom) supplemented with human blood (5%,
vol/vol) and CaCO3 (0.1%, wt/vol) in a 5%
CO2-air atmosphere at 37°C. Streptococcal strains were
routinely cultured in Todd-Hewitt broth (Difco Laboratories, Detroit,
Mich.) or in M17 medium (Difco) supplemented with CaCO3 (10 mM) and sucrose (10 mM) (M17CS medium) for maximal SalA peptide
production. Escherichia coli DH5
(9) and the
highly electrocompetent derivative strain DH10B (14) were
maintained on Luria-Bertani (LB) agar (Difco) or were grown in LB broth
with aeration at 37°C. The following antibiotic concentrations were
used (where appropriate): ampicillin, 100 µg/ml (E. coli);
and spectinomycin, 100 µg/ml (E. coli), 60 µg/ml
(S. pyogenes), or 600 µg/ml (S. salivarius).
PCR and sequence analysis.
Primers for PCR amplification of
salA and the regions downstream of salA in
S. salivarius 20P3 were designed on the basis of the
corresponding sal locus sequence in S. pyogenes
SF370 (University of Oklahoma Advanced Center for Genome
Technology; http://www.genome.ou.edu/strep.html). The major
primers utilized (and their corresponding target sites within the
S. salivarius 20P3 sal locus [10,610
nucleotides; GenBank accession number AY005472]) were SalAF (positions
604 to 629; 5'GATATTTTGAACAATGCTATCGAAGA), DsintF (positions
856 to 876; 5'CAACATCAGTTTTACGAATAC), ORFIR (positions 2340 to 2320; 5'GTGAACTTCAATCTTTCATCG), SalYF (positions 6665 to
6684; 5'GGTCAAGCTCTAGTTATCGC), SalYR (positions 8413 to
8393; 5'GATTATGGATGTCACTAACCG), and SalRterm (positions 10610 to 10590; 5'TCAGAAATCCATAAAATACCC). PCRs were carried
out with Taq polymerase (Roche Diagnostics Ltd., Lewes,
England) for 30 cycles consisting of denaturation at 95°C for 30 s, annealing at between 55 and 64°C (as appropriate) for 30 s,
and extension at 72°C for 1 min per kb of DNA to be amplified; this
was followed by a final elongation step at 72°C for 5 min. PCR
products were ligated into pGEM-T (Promega, Madison, Wis.) and
sequenced with a Perkin-Elmer ABI 377A sequencer. Primary sequence data
were collated with SeqEd sequencer software, and sequence alignment, translation, and general analyses were performed by using DNAMAN (Lynnon BioSoft, Vaudreuil, Canada). Deduced amino acid sequences for
open reading frames were compared with sequences in protein sequence
databases by using the BLAST facilities on the National Center for
Biotechnology Information server (www.ncbi.nlm.nih.gov) and the
University of Oklahoma server.
DNA manipulation and transformation.
Streptococcal genomic
DNA was isolated as described by Upton et al. (43).
Briefly, confluent growth from one-half of an agar plate culture was
collected in TE buffer (10 mM Tris-HCl [pH 8.0] containing 10 mM
EDTA), the cells were harvested by centrifugation (8,000 × g for 10 min) and suspended in 0.3 ml of TE buffer, and 0.3 ml of
a lysis mixture (50 mM Tris-HCl [pH 8.0] containing 10 mM EDTA and
2% [vol/vol] Triton X-100) was added. Lysis was achieved by adding
30 U of mutanolysin (Sigma) and then 0.3 mg of pronase (Sigma) and
incubating the preparation at 37°C for 2 h. The suspension was
extracted once with 0.6 ml of phenol and once with 0.6 ml of
phenol-chloroform (0.3 ml of phenol plus 0.3 ml of chloroform-isoamyl
alcohol [24:1]). Nucleic acids were precipitated from the aqueous
phase with 2 volumes of 100% ethanol at
70°C and collected by
centrifugation (12,000 × g for 20 min), and the pellet
was washed with 70% (vol/vol) ethanol, air dried, and dissolved in TE
buffer. In a number of experiments the solutions were then incubated
with 50 µg of RNase A (Sigma)/ml at 37°C for 30 min and extracted
with phenol-chloroform, and the DNA was precipitated, washed, and
dissolved in TE buffer as described above.
Plasmid DNA was isolated from E. coli by using Qantum Prep
(Bio-Rad Laboratories, Hercules, Calif.). For insertional inactivation of streptococcal genes, target fragments were generated by PCR amplification, cloned into pGEM-T, and recovered by restriction digestion with NcoI and NsiI endonucleases.
Fragments were gel purified and ligated into vector pFW5
(29) digested with NcoI and NsiI.
E. coli strains were transformed with plasmid DNA by using a
TransPorator (BTX, San Diego, Calif.) in 0.1-cm cuvettes (Bio-Rad
Laboratories, Richmond, Calif.). Following electroporation, bacteria
were incubated for 1 h in 1 ml of 2 × YT broth (16 g of
Bacto Tryptone per liter, 10 g of Bacto Yeast Extract per liter, 5 g of NaCl per liter; pH 7.0) at 37°C with shaking at 200 rpm before being spread onto LB agar plates containing the appropriate antibiotics (9). S. salivarius and S. pyogenes strains were prepared for electrotransformation by the
method of Chen et al. (4); DL-threonine was
included in the media at final concentrations of 0.6 and 0.4 M,
respectively. Electroporation was carried out in 0.1-cm cuvettes by
using a Bio-Rad Gene Pulser II set at 1.8 kV, 25 µF, and 200
, and
transformants (frequency, 50 to 100 transformants per µg of DNA) were
selected on agar containing spectinomycin.
Generation of mutants.
To generate S. salivarius
UB1309 salB::pMU1011 Spr, an internal
1.48-kb salB fragment (Fig.
1), PCR amplified from 20P3 DNA by using
primers DsintF and ORF1R, was cloned into pFW5 to produce pMU1001, and
this plasmid was then transformed onto the S. salivarius 20P3 chromosome. S. pyogenes UB1308
salB::pMU1016 Spr was generated in the
same way by transforming pMU1016 (pFW5 carrying a 1.48-kb
salB fragment from T11) onto the S. pyogenes T11
chromosome. S. salivarius UB1310
salR::pMU1002 Spr was generated by PCR
amplifying a 1.16-kb fragment from the salKR gene region
(Fig. 1) of 20P3 DNA with primers SalKF (positions 9249 to 9269;
5'GTTGGATTGTACTCATGAAGG) and SalRR (positions 10411 to
10391; 5'TCAACATAATCCTGAGATTCG), cloning this fragment into pFW5 to produce pMU1002, and transforming this plasmid into wild-type strain 20P3 as described above. Integration of pFW5 plasmid constructs onto the streptococcal chromosome was confirmed by PCR amplification with pFW5-specific primers pFW5F (5'GATCAGGAGTTGAGAGTGGAC)
and pFW5R (5'TGGAGAAGATTCAGCCACTGC).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 1.
Genetic structures of the sal loci in
S. salivarius 20P3 (A) and S. pyogenes SF370 (M
type 1) (B). Open reading frames are depicted by arrows which show the
numbers of aa residues in the deduced polypeptides. The sites of
insertional inactivation with plasmid pFW5 constructs used to generate
strains UB1309, UB1310, and UB1308 are shown. PCR-amplified segments of
DNA used for hybridization probes or cloning in pFW5 are indicated as
follows: I, 0.3-kb salA probe; II, 1.48-kb salB
fragment; III, 1.16-kb salKR fragment. Symbols: ,
putative promoter; , inverted repeat.
|
|
RNA analysis.
To prepare total RNA from streptococci, cells
were harvested by centrifugation from M17CS medium, suspended in 0.2 ml
of spheroplasting buffer (20 mM Tris-HCl [pH 6.8] containing 10 mM
MgCl2 and 26% [wt/vol] raffinose) containing 500 U of
mutanolysin/ml and 0.1 mg of spectinomycin/ml, and incubated 37°C for
30 min. Spheroplasts were collected by centrifugation, and RNA was
extracted by using a Qiagen RNAeasy kit and a Qiashredder column
(Qiagen Ltd., Crawley, England) as recommended by the manufacturer. RNA
samples (10 µg per lane) were subjected to electrophoresis through
1% (wt/vol) agarose in 1× MOPS (morpholinepropanesulfonic acid)
buffer (0.2 M MOPS containing 50 mM sodium acetate and 10 mM EDTA; pH
7.0) supplemented with 1% (wt/vol) formaldehyde at 80 V for 3 h and were vacuum blotted onto a nylon membrane. For Northern analysis of
sal transcripts, a PCR product generated with primers SalAF and SalAR (positions 901 to 883; 5'AGAAGTATCTAGTATGTCG) was
radioactively labeled with [32P]dATP by using
Prime-a-Gene (Promega) as directed by the manufacturer. Hybridization
reactions were carried out at 65°C for 18 h as described elsewhere (5). For reverse transcription (RT)-PCR
analysis, DNase-treated RNA that had been extracted from exponentially
growing cells was utilized for cDNA synthesis by using the SalRterm
oligonuclotide primer and avian myeloblastosis virus reverse
transcriptase (First Strand cDNA synthesis kit; Roche Diagnostics). PCR
amplifications were then performed by utilizing the Expand Long
Template PCR system (Roche Diagnostics) with primers SalAF and SalXR
(positions 6510 to 6490; 5'CTCTCCTCTATCGGATAAAGC), primers
SalY2S (positions 6571 to 6591; 5'CTATTTTCTAGCTACGATCGG) and
SalRterm, or primers SalAF and SalRR.
SalA production and expression.
SalA peptide was purified
from S. salivarius 20P3 M17CS broth culture supernatant as
previously described (34). To test for SalA induction of
transcription, streptococcal strains were grown for 18 h in M17CS
medium with or without SalA peptide. Cells were harvested by
centrifugation (16,000 × g for 20 min at 4°C), and
the cell-free supernatants were collected in sterile tubes. For medium
swap experiments the bacterial pellets were suspended in the
appropriate spent culture supernatant and incubated at 37°C for
4 h before RNA was extracted as described above. Levels of
inhibitor production and of immunity to inhibition were determined by
using a deferred antagonism assay performed on Columbia blood agar
plates supplemented with 0.1% (wt/vol) CaCO3 as described elsewhere (42). Levels of lantibiotic production by
producer strains and growth inhibition of test strains were scored as 0 (no inhibition zone), 1 (narrow inhibition zone that was 1 to 2 mm
wide), 2 (medium zone of inhibition that was 2 to 5 mm wide), 3 (larger
zone of inhibition that was 5 to 8 mm wide), or 4 (inhibition zone that
was more than 8 mm wide).
Nucleotide sequence accession number.
The nucleotide
sequence data for the S. salivarius 20P3 sal
locus have been deposited in the GenBank database under accession number AY005472.
 |
RESULTS |
Structure of the sal locus in S. salivarius
20P3.
To determine the sequence and genetic structure of the
S. salivarius 20P3 sal gene locus, PCR primers
were synthesized based on the nucleotide sequence of the approximately
7-kb region downstream of the salA1 gene in S. pyogenes SF370 (Fig. 1). These primers were utilized to PCR
amplify segments that comprised the complete sal
genetic locus in S. salivarius 20P3. The genetic locus
comprised eight open reading frames designated salABCTXYKR
(Fig. 1A). These open reading frame designations were assigned on the
basis of database homology searches and were in accordance with
conventional lantibiotic gene cluster nomenclature (7,
36).
The first gene (
salA), encoding the 48-aa precursor
lantibiotic peptide, was preceded by a potential ribosome binding
sequence
(GGGAG) and an AT-rich region containing putative promoter
sequences.
Downstream of
salA, the
salB and
salC genes (Fig.
1A) are predicted
to encode peptides with
significant identities to the N-terminal
and C-terminal sequences,
respectively, of lactococcin biosynthesis
protein produced by
Lactococcus lactis (
32) (Table
1). We identified
salB and
salC as separate genes because there are multiple stop
codons present in all three reading frames in the putative intergenic
sequence. SalB contains a number of motifs that are conserved
in LanM
modification peptides (
36), while SalC is predicted
to
contain at least five membrane-spanning sequences and is probably
responsible for the formation of thioether bridges in mature SalA
peptide (
12,
27). The deduced aa sequences encoded by the
next two genes,
salT and
salX, exhibit
significant identities
with ATP binding cassette (ABC) transporters
(
16,
46) (Table
1). For lantibiotics and unmodified
bacteriocins with a GG cleavage
site, the leader is removed by a
cysteine protease activity in
the N-terminal region of the LanT
polypeptide (
16). Retention
of the leader peptide might
have an immunity function (
45).
Motifs characteristic of
LanT protease regions (
36) are present
in the N-terminal
region of the SalT polypeptide. Collectively,
these data suggest that
leader peptide cleavage and export of
modified SalA are carried out by
a SalTX protein complex located
within the cell membrane.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Levels of homology of S. salivarius sal gene
product sequences to peptide database sequences and to corresponding
S. pyogenes SF370 sal gene product sequences
|
|
The
salY gene, situated upstream of the
salKR
genes at the distal end of the locus, encodes a 635-aa polypeptide for
which
there were no significant database matches. It is proposed that
the products of the
salKR genes form a two-component sensor
kinase-response
regulator system (
40) based on significant
sequence identities
between SalK and
Bacillus subtilis ComP
(
47) and between SalR
and the
Bacillus brevis
DegU transcriptional regulator (
24)
(Table
1). Other
features of the
sal locus that have relevance
for
transcriptional regulation include putative promoter regions
upstream
of the
salA and
salY genes (Fig.
1A) and inverted
repeats
with the potential to form stem-loop structures immediately
downstream
of the
salA and
salX genes (Fig.
1A).
An inverted repeat downstream
of the inhibitor peptide structural gene
is present in several
lantibiotic gene clusters (
13,
18,
23,
33). The potential
stem-loop structure that is formed functions
as a transcriptional
attenuator that allows only partial readthrough
transcription
of the downstream
genes.
Structure of the sal locus in S. pyogenes.
S. pyogenes SF370 (M type 1) contains
the salA-like gene designated salA1
(37) but does not produce detectable levels of lantibiotic
inhibitor (Table 2). While the deduced aa
sequence of the mature SalA1 peptide from strain SF370 has two
conserved changes, residue R2 to K and residue
I7 to F (Fig. 2), it is
predicted that these changes do affect the hydrophobicity of the mature peptide or the maturation process. Indeed, the deduced aa sequence of
SalA1 from the lantibiotic inhibitor-producing strain S. pyogenes T11 (M type 4) is identical to that of SF370 SalA1. In
deferred antagonism tests the inhibitory profile of S. pyogenes T11 was similar to that of S. salivarius 20P3
(Table 2).
View this table:
[in this window]
[in a new window]
|
TABLE 2.
SalA production and immunity profiles for S. salivarius and S. pyogenes strains as determined by
deferred cross-antagonism testing
|
|

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 2.
Comparison of the inferred aa sequences of the precursor
SalA peptide in S. salivarius 20P3 and SalA1 peptide in
S. pyogenes SF370. The arrow indicates the site of
proteolytic cleavage (after residue 26) to generate the 22-aa SalA or
SalA1 propeptides. The residues in boldface type are those likely to be
involved in thioether bridge formation.
|
|
A comparison of the
sal locus sequence present in
S. pyogenes SF370 with that in
S. salivarius 20P3 showed
that a 3.2-kb deletion
occurred in strain SF370, which was predicted to
result in truncation
of the
salB gene product and abrogation
of SalC and SalT production
(Fig.
1B). Thus, if the
salA1
gene was to be transcribed and translated
normally, the prepropeptide
could not be modified or exported.
Apart from the deleted region, the
genetic structure of the
sal locus in
S. pyogenes
SF370 (Fig.
1B) was similar to that in
S. salivarius 20P3
(Fig.
1A), and the corresponding polypeptide sequence
identities ranged
from 85 to 99% (Table
1). These comparisons
were based on the
available GAS genomic sequence (University of
Oklahoma), and the
results were confirmed by sequencing several
PCR products generated for
the
salYKR genes that allowed minor
corrections to be made
to the SF370 genomic sequence in this region.
By utilizing PCR
amplification with primers DsintF and SalYR to
screen a number of
S. pyogenes strains, we have shown that only
M type 4 (including
S. pyogenes T11) and M type 57 strains carry
the
complete
salBCT coding
region.
Transcriptional analysis of the sal locus in S. pyogenes and S. salivarius.
For Northern
analysis of salA mRNA transcript levels, nitrocellulose
blots of streptococcal RNAs were incubated with a PCR-generated 32P-labeled 0.3-kb DNA fragment (salA) (Fig. 1).
The salA fragment probe reacted strongly with a single mRNA
transcript approximately 200 bases long in S. salivarius
20P3 and less strongly with a band of similar size in S. pyogenes T11; no significant signal was obtained with mRNA
extracts of S. pyogenes SF370 (Fig.
3 and 4). The relative salA mRNA
levels corresponded well to the levels of inhibitor produced by these
strains, as assayed by deferred antagonism on agar (Table 2). To
confirm the identities of the other predicted transcripts of the locus,
mRNA from S. salivarius 20P3 cells was subjected to RT-PCR
analysis. A 5.9-kb product was generated with primers SalAF and SalXR
(Fig. 5A), supporting the suggestion that
the salABCTX genes were cotranscribed. In addition,
amplification of a 4-kb fragment with primers SalYS and SalRterm
demonstrated that there was transcriptional linkage of the
salYKR genes (Fig. 5A). By utilizing primers SalAF and SalRR
we were also able to demonstrate the presence of a 9.3-kb mRNA
transcript corresponding to salABCTXYKR (Fig. 5B). In all these experiments no PCR products were obtained from RNA samples that
had not been incubated with reverse transcriptase (Fig. 5).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 3.
Northern analysis of SalA1 gene transcription
in S. pyogenes probed with a salA1 fragment
corresponding to salA fragment I (Fig. 1B). Lane 1, S. pyogenes T11 grown in M17CS medium; lane 2, S. pyogenes
T11 grown in S. pyogenes UB1308 salB culture
medium; lane 3, S. pyogenes SF370 grown in M17CS medium;
lane 4, S. pyogenes SF370 grown in strain T11 culture
medium; lane 5, S. pyogenes UB1308 salB grown in
M17CS medium; lane 6, S. pyogenes UB1308 salB
grown in strain T11 culture medium. The position of the
salA1 mRNA transcript (0.2 kb) is indicated by an arrow. The
lanes contained equivalent amounts of total RNA (10 µg).
|
|

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 4.
Autoinduction of SalA in S. salivarius 20P3:
Northern analysis of salA mRNA transcripts from streptococci
grown at 37°C for 30 min in M17CS medium (lane 1) and in M17CS medium
containing purified SalA peptide at concentrations of 0.05 pmol/ml
(lane 2), 0.5 pmol/ml (lane 3), and 5 pmol/ml (lane 4). The lanes
contained equivalent amounts of total RNA (10 µg).
|
|

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 5.
RT-PCR analysis of sal locus transcripts from
S. salivarius 20P3. cDNA was generated from mRNA by using
the oligonucleotide SalRterm. (A) Lanes 2 to 5 PCRs performed with
primers SalAF and SalXR; lanes 7 to 10, PCRs performed with primers
SalY2S and SalRterm; lanes 2 and 7, cDNA template generated by RT;
lanes 3 and 8, RNA controls (no RT); lanes 4 and 9, chromosomal DNA
template; lanes 5 and 10, no-template controls. (B) PCRs performed with
primers SalAF and SalRR. Lane 2, cDNA template generated by RT; lane 3, RNA control; lane 4, chromosomal DNA; lane 5, no template. The
molecular mass markers (panel A, lanes 1 and 6; panel B, lane 1) were
DNA HindIII fragments (23.1, 9.41, 6.56, 4.36, 2.32, and 2.02 kb).
|
|
Transcription of salA depends upon SalA modification
and export.
In order to test the hypothesis that the
salBCT gene products were essential for production of SalA
inhibitor, the salB gene in S. salivarius 20P3
was inactivated by inserting integrational plasmid pMU1011 in the
salB coding region (Fig. 1A). A Northern blot analysis of
mRNA extracted from UB1309 salB::pMU1011 in which the salA probe was used demonstrated that transcription of
the salA gene was abrogated (Fig.
6, lane 1). S. salivarius
UB1309 was phenotypically SalA
as determined by an agar
inhibition assay and did not significantly inhibit growth of S. pyogenes (Table 2). The analogous salB gene inactivation experiment was then carried out with S. pyogenes T11 by integrating plasmid pMU1016 in the salB
chromosomal gene (Fig. 1B). The resulting isogenic mutant, UB1308, did
not produce a 0.2-kb salA1 transcript (Fig. 3, lane 5) and
was also inhibitor production negative (SalA1
) as
determined by the agar inhibition assay (Table 2). These results
confirmed that the salBCT gene products were essential for
production of SalA and SalA1 peptides and suggested that SalA and SalA1
lantibiotics modulated salA and salA1 gene
transcription.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 6.
Northern analysis of salA gene transcription
in S. salivarius UB1309 salB probed with
salA fragment I (Fig. 1A). mRNAs were extracted from
S. salivarius UB1309 cells grown at 37°C for 4 h.
Lane 1, cells grown in their own cell-free spent culture medium; lane
2, cells grown in fresh M17CS medium containing 5 pmol of purified
SalA/ml; lane 3, cells grown in cell-free S. salivarius 20P3
spent culture medium; lane 4, cells grown in cell-free S. pyogenes T11 spent culture medium.
|
|
Expression of SalA is autoregulated.
To test the hypothesis
that salA expression depended upon the presence of active
SalA, S. salivarius 20P3 cells were removed from a
late-exponential-phase culture in M17CS medium. The spent medium was
inoculated with S. salivarius UB1309 salB cells;
the control consisted of spent medium from a UB1309 culture. The
cultures were incubated at 37°C for 4 h, and mRNAs were then
extracted, used for Northern analysis, and probed with the
salA gene fragment as described above. Following incubation
in the S. salivarius 20P3 spent culture medium, the UB1309
salB cells produced a 0.2-kb salA mRNA transcript
(Fig. 6, lane 3) that was absent from the control cells (Fig. 6, lane 1).
In similar experiments, induction of
salA1 transcription was
observed in
S. pyogenes UB1308
salB cells when
these cells were
grown in spent culture supernatant from
S. pyogenes T11 cultures
(SalA1
+) (Fig.
3, lane 6)
but not when they were grown in fresh broth
or in spent culture
supernatant from their own cultures (Fig.
3, lane 5). In addition,
S. pyogenes SF370 cells, which did not
normally express
salA1 mRNA (Fig.
3, lane 3), were induced to
express the
salA1 mRNA transcript when they were grown in T11
culture
supernatant (Fig.
3, lane 4). These data strongly suggested
that
production of SalA and production of SalA1 were autoregulated
in
S. salivarius 20P3 and
S. pyogenes T11,
respectively. To confirm
this,
S. salivarius 20P3 cells were
grown to the mid-exponential
phase in M17CS medium, harvested, washed,
and suspended in fresh
medium containing 0 to 5 pmol of purified SalA
peptide per ml.
After incubation of the cultures at 37°C for 4 h, mRNAs were extracted
and subjected to Northern analysis. In the
absence of exogenous
SalA, no
salA mRNA transcript was
detected (Fig.
4, lane 1), but
there was a dose-dependent increase in
salA mRNA levels as the
SalA concentration increased up to 5 pmol/ml (Fig.
4). Purified
SalA peptide was also effective in inducing
salA transcription
in
S. salivarius UB1309
salB (Fig.
6, lane
2).
SalA and SalA1 are intra- and interspecies signaling
molecules.
To investigate the specificity of autoinduction by SalA
and SalA1, medium swap experiments were carried out with the
SalA1-producing organism S. pyogenes T11 and the
non-SalA-producing organism S. salivarius UB1309
salB. In the latter strain, salA mRNA
transcription was clearly induced by the S. pyogenes SalA1
peptide present in T11 culture medium (Fig. 6, lane 4), and the level
was similar to that induced by the S. salivarius peptide
SalA (Fig. 6, lane 3).
Since gene regulatory activities of other lantibiotics and peptide
pheromones are mediated through two-component systems,
it seemed likely
that SalA and SalA1 function through the
salKR gene
products, sensor kinase and response regulator proteins.
To test this
hypothesis, we attempted to inactivate the
salK gene
in
S. salivarius 20P3, but we were not successful. Attempts to
inactivate the
salY gene in
S. salivarius 20P3 or
the
salK and
salY genes in
S. pyogenes
SF370 also were unsuccessful, but we
were able to obtain an insertion
of pMU1022 in the
salR gene of
S. salivarius 20P3
(Fig.
1A). Strain UB1310 expressed
salA mRNA
at a level that
was about 50% of the level present in wild-type
20P3 (data not shown).
In deferred antagonism assays strain UB1310
was much less inhibitory to
growth of
S. salivarius UB1309 (Table
2), providing evidence
that SalR played a role in expression
of
SalA.
The inhibitory activities of the various strains and their
cross-immunity profiles are shown in Table
2.
S. salivarius
20P3
produced the highest SalA inhibitor activity of all the strains,
and growth of wild-type 20P3 cells was not inhibited by any of
the
other strains.
S. pyogenes T11 had an inhibitory and
immunity
profile similar to that of
S. salivarius 20P3, but
it was weaker.
By contrast,
S. pyogenes SF370 and UB1309 and
S. salivarius UB1308
did not produce inhibitory activities
(Table
2). These strains
were also sensitive to growth inhibition by
SalA and SalA1 peptides
produced by
S. salivarius 20P3 and
UB1310
salR and
S. pyogenes T11.
S. salivarius UB1310
salR, which exhibited a moderate
level
of inhibitory activity against
S. pyogenes T11 and
UB1308, was
sensitive only to inhibition by
S. salivarius
20P3 and
S. pyogenes T11. Thus, streptococci that produce
SalA or SalA1 peptides have
increased immunity to both lantibiotics
compared with SalA-negative
or SalA1-negative
streptococci.
 |
DISCUSSION |
It is now well established that gram-positive bacteria, especially
lactic acid bacteria, produce an array of extracellular peptides with
diverse functions. These molecules may act as highly specific
intercellular signals for controlling competence development, mating
responses, and virulence factor production in bacterial communities or
may act as bacteriocin-like inhibitors of the growth of other
neighboring species (10). Salivaricin A was one of the
first bacteriocin-like inhibitors that were purified, sequenced, and
characterized (34). This lantibiotic is produced by
S. salivarius, and homologous SalA1 peptides are produced by
M type 4 strains of S. pyogenes (37). In this
study we extended our understanding of the production and function of
this lantibiotic through comparative genetic analysis of the
sal genetic loci in S. salivarius and S. pyogenes.
The genetic organization of the sal locus in strain 20P3
resembles that of other lantibiotic synthesis gene clusters
(36). Transcriptional analyses suggested that there are at
least two sal mRNA transcripts, a major (inducible)
salA mRNA transcript approximately 200 bases long and a
salABCTXYKR readthrough transcript. RT-PCR data are
consistent with the proposal that the salBCTX genes are
cotranscribed with salA, but the presence of an inverted repeat sequence downstream of the salA structural gene would
be predicted to form a hairpin loop and attenuate transcriptional readthrough from salA into salBCTX. This would
allow production of higher levels of SalA compared with the levels of
SalBCTX, the modification and export machinery, and is a control
feature found in a number of other lantibiotic synthesis gene operons (18, 23, 33). From the sequence analysis, we predicted
that transcription of salYKR may also be initiated from a
promoter immediately upstream of salY, but transcriptional
start point mapping experiments would be necessary to confirm this. The
significance of the different transcripts to lantibiotic production and
control is not yet understood, but it is worth noting that among the
transcripts from the L. lactis nisin lantibiotic gene locus,
a transcript corresponding to the entire locus has been reported
(31).
Comparison of the polypeptide sequences encoded by the sal
gene loci in S. salivarius and S. pyogenes with
the sequences in protein sequence databases allowed us to assign
polypeptide functions. One unusual feature of the locus was the
presence of two genes (salB and salC) encoding
lantibiotic modification enzymes, since subclass AII lantibiotics with
the characteristic Gly-Gly motif are usually modified by the product of
a single gene (lanM) (36). The only gene for
which a possible function of the product could not be inferred from a
database match was salY. Since most lantibiotic gene
clusters carry a self-immunity protein gene (36), it is possible that the 635-aa SalY protein is associated with
self-protection against SalA. However, it is also possible that genetic
determinants required for immunity are located elsewhere on the
chromosome (2, 11).
Inactivation of the salB gene in S. salivarius
20P3 or S. pyogenes T11 led to a lantibiotic-negative
(SalA
or SalA1
) phenotype, confirming that
the salB gene product plays an essential role in lantibiotic
production. However, inactivation of salB also resulted in
abrogation of salA and salA1 transcription. This transcription was restored by exogenous addition of subinhibitory levels of SalA or SalA1 peptides, demonstrating that production of
these lantibiotics is autoregulated, like production of nisin and
subtilin (21, 23). Interestingly, salB mutants
were also rendered sensitive to growth inhibition by SalA or SalA1
peptides, so lantibiotic production and immunity to the lantibiotic are coregulated. These results explain clearly why S. pyogenes
strains which contain a deletion across the salBCT genes,
such as SF370 (M type 1), are not producers of SalA1 lantibiotic and
are also very sensitive to growth inhibition by SalA or SalA1 peptides.
A model for autoregulation of SalA production in S. salivarius is presented in Fig. 7;
this model is based on experimental evidence presented here and
comparative data for other lantibiotic synthesis systems (7, 8,
20, 21, 24). Transcription of the salABCTX genes is
initiated at a promoter upstream of salA. The primary
translation products include the 48-aa precursor pro-SalA and the SalB,
SalC, SalT, and SalX protein modification and transport machinery.
Modification of the precursor peptide occurs with a membrane-associated
SalB-SalC enzyme complex, and the membrane-integral SalT-SalX
polypeptides then mediate translocation of SalA across the cytoplasmic
membrane (Fig. 7). Cleavage of the precursor SalA leader peptide
results from cysteine protease activity located in the N-terminal
region of SalT, which generates extracellular mature SalA peptide. The
fate of the precursor SalA leader peptide is not known.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 7.
Model for autoregulation of SalA production in S. salivarius and S. pyogenes. The product of the
salA gene, preproSalA peptide, is modified by the
membrane-associated SalBC polypeptides and then exported with leader
peptide cleavage by the membrane-integral SalTX polypeptides.
Extracellular lantibiotic peptide from S. salivarius (SalA)
or from S. pyogenes (SalA1) is sensed at the cell surface,
possibly by the two-component SalKR system, and transcription of the
salA promoter is upregulated via a phosphorylated (P)
regulatory protein (R). Only the bacteria that respond to extracellular
SalA peptide by producing active SalA are immune to the inhibitory
effects of the lantibiotic peptide, but the mechanism of immunity is
unknown.
|
|
The gene clusters encoding production of nisin (12),
streptococcin SA-FF22 (26), and subtilin (22)
each contain two genes for a two-component (sensor-regulator) system.
It has been shown that in the nisin and subtilin systems the mature
inhibitor peptide is recognized by the sensor kinase (21, 23,
30). We propose that mature SalA peptide is sensed by the sensor
histidine kinase of a two-component system (putatively SalKR), which
leads to activation of the response regulator (SalR) and induction of transcription from the salA promoter (Fig. 7). Although we
were unable to generate a salK mutant and therefore were
unable to formally test the notion that SalK is the cognate sensor for
SalA, we generated a salR mutant that contained reduced
salA mRNA transcript levels and exhibited reduced SalA
inhibitor production. This is consistent with the proposed role for
SalR in autoregulation of SalA, but since salA mRNA
transcription was not shut down in this mutant, other regulatory
pathways must also be operative.
An interesting finding is that SalA production by one streptococcal
species may be induced by sensing of the homologous peptide from
another streptococcal species. Interspecies signaling between taxonomically diverse streptococcal species has not been demonstrated previously. Most peptide signaling molecules are specific for their
cognate sensor-response systems in streptococci (6, 10), but the SalA peptide sensing system apparently does not discriminate between SalA and SalA1 (Fig. 2). Minor modifications to other inhibitor
peptides, such as epilancin K7 (44), streptococcin SA-FF22
(19), and subtilin (3), are sufficient to
affect their biological activities, but the two conservative changes in
SalA1 do not significantly affect the inhibitor activity or profile.
Interspecies community sensing could regulate relative population
levels of streptococci. The ability of SalA1-producing S. pyogenes strains to respond to SalA from S. salivarius
(and vice versa) could provide a selective mechanism for cocolonization of the mucosal epithelium by pathogen and commensal cell populations. For example, SalA1 produced by rapidly multiplying S. pyogenes cells might stimulate production of SalA by S. salivarius strains, leading to modulation of the number of
S. pyogenes cells. In this way, the number of S. pyogenes cells may be self-limiting, thus promoting maintenance of
the population in a carrier state. An alternative scenario is that
sensing of SalA by S. pyogenes may influence expression of
other genes, including genes related to virulence. In this regard it
has recently been demonstrated that a bacteriocin-like peptide (BlpC)
in S. pneumoniae induces a set of 16 genes following
activation of its cognate two-component sensor-regulator system
(6). We are currently investigating the possibility that
SalR, like CsrR (17) or Mga (25) proteins, may have a global regulatory function in S. pyogenes and
modulate production of virulence factors, such as streptolysin S
(28).
In summary, here we describe the genetic locus encoding the
polypeptides necessary for autoregulated production of SalA and SalA1
lantibiotics by S. salivarius and S. pyogenes.
The SalA and SalA1 peptides act as inhibitors of sensitive
streptococcal strains which do not themselves produce these peptides,
but they are also sensed by other SalA-producing or SalA1-producing
strains and there is concomitant induction of lantibiotic synthesis. It could be envisaged, therefore, that SalA production and SalA1 production have a role in modulating the coexistence of streptococcal populations in vivo, where it is becoming apparent that signaling peptides are likely to have a major influence on oral microbial community structure.
 |
ACKNOWLEDGMENTS |
We thank Nancy Ragland for expert technical assistance, K. Ross
and K. Dierksen for helpful discussions, R. Burne for advice on
electroporation, A. Podbielski for kindly supplying plasmids, J. Ferretti for providing strains, and N. Jakubovics for help with
preparation of the manuscript. We gratefully acknowledge the BLAST
search facilities at the National Center for Biotechnology Information
(National Library of Medicine, Washington, D.C.) and the University of
Oklahoma Streptococcal (GAS) Genome Sequencing Project funded by a
USPHS/NIH grant to B. A. Roe, S. P. Linn, L. Song, X. Yuan,
S. Clifton, R. E. McLaughlin, M. McShan, and J. Ferretti.
This work was supported by grant UO0605 from the Marsden Fund, Royal
Society of New Zealand.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Oral and Dental Science, University of Bristol Dental School, Lower
Maudlin Street, Bristol, BS1 2LY, United Kingdom. Phone: 44 117 928 4358. Fax: 44 117 928 4313. E-mail:
howard.jenkinson{at}bristol.ac.uk.
Present address: Department of Medical Microbiology, Manchester
Royal Infirmary, Manchester M13 9WL, United Kingdom.
 |
REFERENCES |
| 1.
|
Bisno, A. L.
1991.
Group A streptococcal infections and acute rheumatic fever.
N. Engl. J. Med.
325:783-793[Medline].
|
| 2.
|
Brurberg, M. B.,
I. F. Nes, and V. G. H. Eijsink.
1997.
Pheromone-induced production of antimicrobial peptides in Lactobacillus.
Mol. Microbiol.
26:347-360[CrossRef][Medline].
|
| 3.
|
Chan, W. C.,
B. W. Bycroft,
M. L. Leyland,
L. Y. Lian, and G. C. Roberts.
1993.
A novel post-translational modification of the peptide antibiotic subtilin: isolation and characterization of a natural variant from Bacillus subtilis ATCC 6633.
Biochem. J.
291:23-27.
|
| 4.
|
Chen, Y. Y.,
C. A. Weaver,
D. R. Mendelsohn, and R. A. Burne.
1998.
Transcriptional regulation of the Streptococcus salivarius 57.I urease operon.
J. Bacteriol.
180:5769-5775[Abstract/Free Full Text].
|
| 5.
|
Church, G. M., and W. Gilbert.
1984.
Genomic sequencing.
Proc. Natl. Acad. Sci. USA
81:1991-1995[Abstract/Free Full Text].
|
| 6.
|
de Saizieu, A.,
C. Gardes,
N. Flint,
C. Wagner,
M. Kamber,
T. J. Mitchell,
W. Keck,
K. E. Amrein, and R. Lange.
2000.
Microarray-based indentification of a novel Streptococcus pneumoniae regulon controlled by an autoinduced peptide.
J. Bacteriol.
182:4696-4703[Abstract/Free Full Text].
|
| 7.
|
de Vos, W. M.,
G. Jung, and H.-G. Sahl.
1991.
Appendix: definitions and nomenclature of lantibiotics, p. 457-464.
In
G. Jung, and H.-G. Sahl (ed.), Nisin and novel lantibiotics. Escom Publishers, Leiden, The Netherlands.
|
| 8.
|
de Vos, W. M.,
O. P. Kuipers,
J. R. van der Meer, and R. J. Siezen.
1995.
Maturation pathway of nisin and other lantibiotics: post-translationally modified antimicrobial peptides exported by gram positive bacteria.
Mol. Microbiol.
17:427-437[Medline].
|
| 9.
|
Dower, W. J.,
J. F. Miller, and C. W. Ragsdale.
1988.
High efficiency transformation of E. coli by high voltage electroporation.
Nucleic Acids Res.
16:6127-6145[Abstract/Free Full Text].
|
| 10.
|
Dunny, G. M., and B. A. B. Leonard.
1997.
Cell-cell communication in gram-positive bacteria.
Annu. Rev. Microbiol.
51:527-564[CrossRef][Medline].
|
| 11.
|
Eijsink, V. G. H.,
M. Skeie,
H. Middelhove,
M. B. Brurberg, and I. F. Nes.
1998.
Comparative studies of class IIa bacteriocins of lactic acid bacteria.
Appl. Environ. Microbiol.
64:3275-3281[Abstract/Free Full Text].
|
| 12.
|
Engelke, G.,
Z. Gutowski-Eckel,
M. Hammelmann, and K.-D. Entian.
1992.
Biosynthesis of the lantibiotic nisin: genomic organization and membrane localization of the NisB protein.
Appl. Environ. Microbiol.
58:3730-3743[Abstract/Free Full Text].
|
| 13.
|
Engelke, G.,
Z. Gutowski-Eckel,
P. Kiesau,
K. Siegers,
M. Hammelmann, and K.-D. Entian.
1994.
Regulation of nisin biosynthesis and immunity in Lactococcus lactis 6F3.
Appl. Environ. Microbiol.
60:814-825[Abstract/Free Full Text].
|
| 14.
|
Hanahan, D.,
J. Jessee, and F. R. Bloom.
1991.
Plasmid transformation of Escherichia coli and other bacteria.
Methods Enzymol.
204:63-113[Medline].
|
| 15.
|
Havarstein, L. S.,
G. Coomaraswamy, and D. A. Morrison.
1995.
An unmodified heptadecapeptide pheromone induces competence for genetic transformation in Streptococcus pneumoniae.
Proc. Natl. Acad. Sci. USA
92:11140-11144[Abstract/Free Full Text].
|
| 16.
|
Havarstein, L. S.,
D. B. Diep, and I. F. Nes.
1995.
A family of bacteriocin ABC transporters carry out proteolytic processing of their substrates comcomitant with export.
Mol. Microbiol.
16:229-240[Medline].
|
| 17.
|
Heath, A.,
V. J. Di Rita,
N. L. Barg, and N. C. Engleberg.
1999.
A two-component regulatory system, CsrR-CsrS, represses expression of three Streptococcus pyogenes virulence factors, hyaluronic acid capsule, streptolysin S, and pyogenic extoxin B.
Infect. Immun.
67:5298-5305[Abstract/Free Full Text].
|
| 18.
|
Hynes, W. L.,
J. J. Ferretti, and J. R. Tagg.
1993.
Cloning of the gene encoding Streptococcin A-FF22, a novel lantibiotic produced by Streptococcus pyogenes, and determination of its nucleotide sequence.
Appl. Environ. Microbiol.
59:1969-1971[Abstract/Free Full Text].
|
| 19.
|
Jack, R. W., and J. R. Tagg.
1991.
Isolation and partial structure of streptococcin SA-FF22, p. 171-179.
In
G. Jung, and H.-G. Sahl (ed.), Nisin and novel lantibiotics. Escom Publishers, Leiden, The Netherlands.
|
| 20.
|
Jung, G.
1991.
Lantibiotics: a survey, p. 1-34.
In
G. Jung, and H.-G. Sahl (ed.), Nisin and novel lantibiotics. Escom Publishers, Leiden, The Netherlands.
|
| 21.
|
Kleerebezem, M.,
W. M. de Vos, and O. P. Kuipers.
1999.
The lantibiotics nisin and subtilin act as extracellular regulators of their own biosynthesis, p. 159-174.
In
G. M. Dunny, and S. C. Winans (ed.), Cell-cell signaling in bacteria. American Society for Microbiology, Washington, D.C.
|
| 22.
|
Klein, C.,
C. Kaletta, and K.-D. Entian.
1993.
Biosynthesis of the lantibiotic subtilin is regulated by a histidine kinase/response regulator system.
Appl. Environ. Microbiol.
59:296-303[Abstract/Free Full Text].
|
| 23.
|
Kuipers, O. P.,
M. M. Beerthuyzen,
P. G. G. A. de Reuyter,
E. J. Luesink, and W. M. de Vos.
1995.
Autoregulation of nisin biosynthesis in Lactococcus lactis by signal transduction.
J. Biol. Chem.
270:27299-27304[Abstract/Free Full Text].
|
| 24.
|
Louw, M. E.,
S. J. Reid,
D. M. James, and T. G. Watson.
1994.
Cloning and sequencing the degS-degU operon from an alkalophilic Bacillus brevis.
Appl. Microbiol. Biotechnol.
42:78-84[CrossRef][Medline].
|
| 25.
|
McIver, K.,
A. S. Thurman, and J. R. Scott.
1999.
Regulation of mga transcription in the group A streptococcus: specific binding of Mga within its own promoter and evidence for a negative regulator.
J. Bacteriol.
181:5373-5383[Abstract/Free Full Text].
|
| 26.
|
McLaughlin, R. E.,
J. J. Ferretti, and W. L. Hynes.
1999.
Nucleotide sequence of the streptococcin A-FF22 lantibiotic regulon: model for the production of the lantibiotic SA-FF22 by strain of Streptococcus pyogenes.
FEMS Microbiol. Lett.
175:171-177[CrossRef][Medline].
|
| 27.
|
Meyer, C.,
G. Bierbaum,
C. Heidrich,
M. Reis,
J. Suling,
M. I. Iglesias-Wind,
C. Kempter,
E. Molitor, and H.-G. Sahl.
1995.
Nucleotide sequence of the lantibiotic Pep5 biosynthetic gene cluster and functional analysis of PepP and PepC. Evidence for a role of PepC in thiether formation.
Eur. J. Biochem.
232:478-489[Medline].
|
| 28.
|
Nizet, V.,
B. Beall,
D. J. Bast,
V. Datta,
L. Kilburn,
D. E. Low, and J. C. S. de Azavedo.
2000.
Genetic locus for streptolysin S production by group A streptococcus.
Infect. Immun.
68:4245-4254[Abstract/Free Full Text].
|
| 29.
|
Podbielski, A.,
B. Spellberg,
M. Woschnik,
B. Pohl, and R. Lüticken.
1996.
Novel series of plasmid vectors for gene inactivation and expression analysis in group A streptococci (GAS).
Gene
177:137-147[CrossRef][Medline].
|
| 30.
|
Ra, S. R.,
M. Qiao,
T. Immonen,
I. Pujana, and P. E. J. Saris.
1996.
Genes responsible for nisin synthesis, regulation and immunity form a regulon of two operons and are induced by nisin in Lactococcus lactis N8.
Microbiology
142:1281-1288[Abstract/Free Full Text].
|
| 31.
|
Ra, S. R.,
M. M. Beerthuyzen,
W. M. de Vos,
P. E. J. Saris, and O. P. Kuipers.
1999.
Effects of gene disruptions in the nisin gene cluster of Lactococcus lactis on nisin production and producer immunity.
Microbiology
145:1227-1233[Abstract/Free Full Text].
|
| 32.
|
Rince, A.,
A. Dufour,
S. Le Pogam,
D. Thuault,
C. M. Bourgeois, and J. Le Pennec.
1994.
Cloning, expression, and nucleotide sequence of genes involved in production of lactococcin DR, a bacteriocin from Lactococcus lactis subsp. lactis.
Appl. Environ. Microbiol.
60:1652-1657[Abstract/Free Full Text].
|
| 33.
|
Rince, A.,
A. Dufour,
P. Uguen,
J. Le Pennec, and D. Haras.
1997.
Characterization of the lacticin 481 operon: the Lactococcus lactis genes lctF, lctE, and lctG encode a putative ABC transporter involved in bacteriocin immunity.
Appl. Environ. Microbiol.
63:4252-4260[Abstract].
|
| 34.
|
Ross, K. F.,
C. W. Ronson, and J. R. Tagg.
1993.
Isolation and characterization of the lantibiotic salivaricin A and its structural gene salA from Streptococcus salivarius 20P3.
Appl. Environ. Microbiol.
59:2014-2021[Abstract/Free Full Text].
|
| 35.
|
Salmond, G. P.,
B. W. Bycroft,
G. S. Stewart, and P. Williams.
1995.
The bacterial enigma: cracking the code of cell-cell communication.
Mol. Microbiol.
16:615-624[CrossRef][Medline].
|
| 36.
|
Siezen, R. J.,
O. P. Kuipers, and W. M. De Vos.
1996.
Comparison of lantibiotic gene clusters and encoded proteins.
Antonie Leeuwenhoek
69:171-184[CrossRef][Medline].
|
| 37.
|
Simpson, W. J.,
N. L. Ragland,
C. W. Ronson, and J. R. Tagg.
1995.
A lantibiotic gene family widely distributed in Streptococcus salivarius and Streptococcus pyogenes.
Dev. Biol. Stand.
85:639-643[Medline]. Karger, Basel.
|
| 38.
|
Skaugen, M.,
J. Nissen-Meyer,
G. Jung,
S. Stevanovic,
K. Sletten,
C. I. M. Abildgaard, and I. F. Nes.
1994.
In vivo conversion of L-serine to D-alanine in a ribosomally synthesised polypeptide.
J. Biol. Chem.
269:27183-27185[Abstract/Free Full Text].
|
| 39.
|
Smith, D. J.,
J. M. Anderson,
W. F. King,
J. van Houte, and M. A. Taubman.
1993.
Oral streptococcal colonization of infants.
Oral Microbiol. Immunol.
8:1-4[Medline].
|
| 40.
|
Stock, J. B.,
A. J. Ninfa, and A. M. Stock.
1989.
Protein phosphorylation and regulation of adaptive responses in bacteria.
Microbiol. Rev.
53:450-490[Abstract/Free Full Text].
|
| 41.
|
Suvrov, A. N., and J. J. Ferretti.
1996.
Physical and genetic map of an M type 1 strain of Streptococcus pyogenes.
J. Bacteriol.
178:5546-5549[Abstract/Free Full Text].
|
| 42.
|
Tagg, J. R., and L. V. Bannister.
1979.
"Fingerprinting" haemolytic streptococci by their production of and sensitivity to bacteriocin-like inhibitors.
J. Med. Microbiol.
12:379-411[Abstract/Free Full Text].
|
| 43.
|
Upton, M.,
P. E. Carter,
M. Morgan,
G. F. S. Edwards, and T. H. Pennington.
1995.
Clonal structure of invasive Streptococcus pyogenes strains in Northern Scotland.
Epidemiol. Infect.
115:231-241[Medline].
|
| 44.
|
van de Kamp, M.,
L. M. Horstink,
H. W. van den Hooven,
R. N. Konings,
C. W. Hilbers,
A. Frey,
H.-G. Sahl,
J. W. Metzger, and F. J. van de Ven.
1995.
Sequence analysis by NMR spectroscopy of the peptide lantibiotic epilancin K7 from Staphylococcus epidermidis.
Eur. J. Biochem.
227:757-771[Medline].
|
| 45.
|
van der Meer, J. R.,
J. Polman,
M. M. Beerthuyzen,
R. J. Siezen,
O. P. Kuipers, and W. M. De Vos.
1993.
Characterization of the Lactococcus lactis nisin A operon genes nisP, encoding a subtilisin-like serine protease involved in precursor processing, and nisR, encoding a regulatory protein involved in nisin biosynthesis.
J. Bacteriol.
175:2578-2588[Abstract/Free Full Text].
|
| 46.
|
Walker, J. E.,
M. Sarste,
M. J. Runswick, and N. J. Gay.
1982.
Distantly related sequences in the - and -subunits of ATP synthase, myosin, kinase and other ATP-requiring enzymes and a common nucleotide binding fold.
EMBO J.
1:945-951[Medline].
|
| 47.
|
Weinrauch, Y.,
R. Penchev,
E. Dubnau,
I. Smith, and D. Dubnau.
1990.
A Bacillus subtilis regulatory gene product for genetic competence and sporulation resembles sensor protein members of the bacterial two-component signal-transduction systems.
Genes Dev.
4:860-872[Abstract/Free Full Text].
|
Journal of Bacteriology, July 2001, p. 3931-3938, Vol. 183, No. 13
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.13.3931-3938.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Liu, G., Zhong, J., Ni, J., Chen, M., Xiao, H., Huan, L.
(2009). Characteristics of the bovicin HJ50 gene cluster in Streptococcus bovis HJ50. Microbiology
155: 584-593
[Abstract]
[Full Text]
-
Ryan, R. P., Dow, J. M.
(2008). Diffusible signals and interspecies communication in bacteria. Microbiology
154: 1845-1858
[Abstract]
[Full Text]
-
Kuramitsu, H. K., He, X., Lux, R., Anderson, M. H., Shi, W.
(2007). Interspecies Interactions within Oral Microbial Communities. Microbiol. Mol. Biol. Rev.
71: 653-670
[Abstract]
[Full Text]
-
Lux, T., Nuhn, M., Hakenbeck, R., Reichmann, P.
(2007). Diversity of Bacteriocins and Activity Spectrum in Streptococcus pneumoniae. J. Bacteriol.
189: 7741-7751
[Abstract]
[Full Text]
-
Phelps, H. A., Neely, M. N.
(2007). SalY of the Streptococcus pyogenes Lantibiotic Locus Is Required for Full Virulence and Intracellular Survival in Macrophages. Infect. Immun.
75: 4541-4551
[Abstract]
[Full Text]
-
Robson, C. L., Wescombe, P. A., Klesse, N. A., Tagg, J. R.
(2007). Isolation and partial characterization of the Streptococcus mutans type AII lantibiotic mutacin K8. Microbiology
153: 1631-1641
[Abstract]
[Full Text]
-
Hyink, O., Wescombe, P. A., Upton, M., Ragland, N., Burton, J. P., Tagg, J. R.
(2007). Salivaricin A2 and the Novel Lantibiotic Salivaricin B Are Encoded at Adjacent Loci on a 190-Kilobase Transmissible Megaplasmid in the Oral Probiotic Strain Streptococcus salivarius K12. Appl. Environ. Microbiol.
73: 1107-1113
[Abstract]
[Full Text]
-
Marri, P. R., Hao, W., Golding, G. B.
(2006). Gene Gain and Gene Loss in Streptococcus: Is It Driven by Habitat?. Mol Biol Evol
23: 2379-2391
[Abstract]
[Full Text]
-
Schmitz, S., Hoffmann, A., Szekat, C., Rudd, B., Bierbaum, G.
(2006). The Lantibiotic Mersacidin Is an Autoinducing Peptide. Appl. Environ. Microbiol.
72: 7270-7277
[Abstract]
[Full Text]
-
de Been, M., Francke, C., Moezelaar, R., Abee, T., Siezen, R. J.
(2006). Comparative analysis of two-component signal transduction systems of Bacillus cereus, Bacillus thuringiensis and Bacillus anthracis.. Microbiology
152: 3035-3048
[Abstract]
[Full Text]
-
Han, C. S., Xie, G., Challacombe, J. F., Altherr, M. R., Bhotika, S. S., Bruce, D., Campbell, C. S., Campbell, M. L., Chen, J., Chertkov, O., Cleland, C., Dimitrijevic, M., Doggett, N. A., Fawcett, J. J., Glavina, T., Goodwin, L. A., Hill, K. K., Hitchcock, P., Jackson, P. J., Keim, P., Kewalramani, A. R., Longmire, J., Lucas, S., Malfatti, S., McMurry, K., Meincke, L. J., Misra, M., Moseman, B. L., Mundt, M., Munk, A. C., Okinaka, R. T., Parson-Quintana, B., Reilly, L. P., Richardson, P., Robinson, D. L., Rubin, E., Saunders, E., Tapia, R., Tesmer, J. G., Thayer, N., Thompson, L. S., Tice, H., Ticknor, L. O., Wills, P. L., Brettin, T. S., Gilna, P.
(2006). Pathogenomic Sequence Analysis of Bacillus cereus and Bacillus thuringiensis Isolates Closely Related to Bacillus anthracis. J. Bacteriol.
188: 3382-3390
[Abstract]
[Full Text]
-
Burton, J. P., Wescombe, P. A., Moore, C. J., Chilcott, C. N., Tagg, J. R.
(2006). Safety Assessment of the Oral Cavity Probiotic Streptococcus salivarius K12. Appl. Environ. Microbiol.
72: 3050-3053
[Abstract]
[Full Text]
-
Wescombe, P. A., Upton, M., Dierksen, K. P., Ragland, N. L., Sivabalan, S., Wirawan, R. E., Inglis, M. A., Moore, C. J., Walker, G. V., Chilcott, C. N., Jenkinson, H. F., Tagg, J. R.
(2006). Production of the Lantibiotic Salivaricin A and Its Variants by Oral Streptococci and Use of a Specific Induction Assay To Detect Their Presence in Human Saliva. Appl. Environ. Microbiol.
72: 1459-1466
[Abstract]
[Full Text]
-
Shelburne, S. A. III, Sumby, P., Sitkiewicz, I., Granville, C., DeLeo, F. R., Musser, J. M.
(2005). Central role of a bacterial two-component gene regulatory system of previously unknown function in pathogen persistence in human saliva. Proc. Natl. Acad. Sci. USA
102: 16037-16042
[Abstract]
[Full Text]
-
Hale, J. D. F., Heng, N. C. K., Jack, R. W., Tagg, J. R.
(2005). Identification of nlmTE, the Locus Encoding the ABC Transport System Required for Export of Nonlantibiotic Mutacins in Streptococcus mutans. J. Bacteriol.
187: 5036-5039
[Abstract]
[Full Text]
-
Joseph, P., Guiseppi, A., Sorokin, A., Denizot, F.
(2004). Characterization of the Bacillus subtilis YxdJ response regulator as the inducer of expression for the cognate ABC transporter YxdLM. Microbiology
150: 2609-2617
[Abstract]
[Full Text]
-
Dirix, G., Monsieurs, P., Marchal, K., Vanderleyden, J., Michiels, J.
(2004). Screening genomes of Gram-positive bacteria for double-glycine-motif-containing peptides. Microbiology
150: 1121-1126
[Full Text]
-
Scheie, A. A., Petersen, F. C.
(2004). THE BIOFILM CONCEPT: CONSEQUENCES FOR FUTURE PROPHYLAXIS OF ORAL DISEASES?. CROBM
15: 4-12
[Abstract]
[Full Text]
-
Walls, T., Power, D., Tagg, J.
(2003). Bacteriocin-like inhibitory substance (BLIS) production by the normal flora of the nasopharynx: potential to protect against otitis media?. J Med Microbiol
52: 829-833
[Abstract]
[Full Text]
-
Wescombe, P. A., Tagg, J. R.
(2003). Purification and Characterization of Streptin, a Type A1 Lantibiotic Produced by Streptococcus pyogenes. Appl. Environ. Microbiol.
69: 2737-2747
[Abstract]
[Full Text]
-
Kolenbrander, P. E., Andersen, R. N., Blehert, D. S., Egland, P. G., Foster, J. S., Palmer, R. J. Jr.
(2002). Communication among Oral Bacteria. Microbiol. Mol. Biol. Rev.
66: 486-505
[Abstract]
[Full Text]
-
Gomez, A., Ladire, M., Marcille, F., Fons, M.
(2002). Trypsin Mediates Growth Phase-Dependent Transcriptional Regulation of Genes Involved in Biosynthesis of Ruminococcin A, a Lantibiotic Produced by a Ruminococcus gnavus Strain from a Human Intestinal Microbiota. J. Bacteriol.
184: 18-28
[Abstract]
[Full Text]
-
Guder, A., Schmitter, T., Wiedemann, I., Sahl, H.-G., Bierbaum, G.
(2002). Role of the Single Regulator MrsR1 and the Two-Component System MrsR2/K2 in the Regulation of Mersacidin Production and Immunity. Appl. Environ. Microbiol.
68: 106-113
[Abstract]
[Full Text]