Previous Article | Next Article 
Journal of Bacteriology, July 2001, p. 3982-3990, Vol. 183, No. 13
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.13.3982-3990.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Localization of a Germinant Receptor Protein
(GerBA) to the Inner Membrane of Bacillus subtilis
Spores
Madan
Paidhungat and
Peter
Setlow*
Department of Biochemistry, University of
Connecticut Health Center, Farmington, Connecticut
Received 18 December 2000/Accepted 26 March 2001
 |
ABSTRACT |
Dormant Bacillus subtilis spores germinate in response
to specific nutrients called germinants, which are recognized by
multisubunit receptor complexes encoded by members of the
gerA family of operons, of which the gerB
operon is a member. The germinant receptors are expected to be membrane
associated, but there is some debate about whether they are located in
the inner or outer spore membrane. In this study we have used Western
blot analysis to determine the precise location of GerBA, a
gerB-encoded receptor protein, in various spore fractions.
GerBA was not extracted from spores by a decoating treatment that
removes the coat and outer membrane but was present in lysates from
decoated spores and in the insoluble fraction (termed P100) from such
lysates that contained inner-membrane vesicles. GerBA was also
solubilized from the P100 fraction with detergent but not with high
salt. These findings suggest that GerBA is an integral membrane protein
located in the spore's inner membrane. Consistent with this idea,
GerBA was present in the cell membrane of the outgrowing spore, a
membrane that is derived from the dormant spore's inner membrane.
Based on these observations we propose that GerBA and probably the
entire GerB germinant receptor are located in the inner membrane of the
dormant spore. We also estimated that there are only 24 to 40 molecules
of GerBA per spore, a number that is consistent with the previously
reported low level of gerB operon expression and with the
putative receptor function of the proteins encoded by the
gerB operon.
 |
INTRODUCTION |
Dormant spores of Bacillus
subtilis are metabolically inert structures that are formed when
growing cells are starved for particular nutrients. Despite their
dormancy, these spores can detect nutrients in the environment and
respond to such cues by triggering a number of reactions that result in
the resumption of metabolism and growth. The initial steps in this
process, called spore germination, thus represent a novel paradigm for
studying the communication between a cell and its surroundings.
A variety of nutrients can induce spore germination, and in B. subtilis two such germinants have been extensively studied: L-alanine (L-Ala) and a combination of
L-asparagine, D-fructose, D-glucose, and potassium ions (AFGK) (19).
Previous work suggested that germinants act by binding to and
activating spore receptors (9, 13, 19). This idea has been
substantiated by several types of experiments which suggest that a
family of homologous operons (the gerA family, which
includes gerA, gerB, and gerK) encode the
predicted receptors. First, mutations in gerA, gerB, and
gerK block germination in a germinant-specific manner
(17-19). Second, missense mutations in one family member,
gerB, allow spores to recognize novel germinants
(23). Finally, spores lacking all of the gerA
family members show a severe defect in nutrient-induced germination
(24). At the DNA sequence level, each gerA
family member is a tricistronic operon that encodes three predicted
proteins named A, B, and C, and there is evidence that the germinant
receptor is a multisubunit complex consisting of at least the A and B
proteins (23). The A and B proteins contain several
putative transmembrane domains and have been suggested to be integral
membrane proteins, whereas the C proteins contain a potential signal
sequence for lipid modification (34). Thus, it is
reasonable to postulate that the receptor complex is associated with a
membrane in the dormant spore.
There are two membranes in the dormant spore
a consequence of the
spore's development as a double membrane-bound endospore within a
mother cell (8). The inner membrane is derived from the
forespore compartment, and the outer membrane is derived from the
mother cell. The two membranes are separated by two layers of
peptidoglycan
the inner germ cell wall and the outer, less cross-linked cortex
and the outer membrane is overlain by a
proteinaceous coat (8). The position of the outer
membrane-coat in the spore make it a likely location for receptors that
detect environmental cues. However, this location is not supported by
the finding that detergent treatments that remove the outer
membrane-coat do not abolish nutrient-induced spore germination
(24, 32). Direct localization of the GerA receptor
proteins has been attempted, but their location has not been determined
unambiguously. One study which used immunoelectron microscopy claimed
that GerAA, GerAB, and GerAC were located at the cortex-coat boundary
(i.e., in the outer membrane) (27, 33), while another
study which used Western blot analysis suggested that GerAA was located
in the inner membrane and GerAC was located in the integument fraction (coats plus cortex) (17).
To further attempt to pinpoint the location of the germinant receptors
in dormant spores, we immunolocalized a GerB receptor component, GerBA,
in spore fractions. The antiserum against GerBA was produced against a
fusion protein containing two-thirds of GerBA, affinity purified and
shown to be specific for GerBA. The GerBA protein was not removed by
detergent treatment of dormant spores, which removes the outer membrane
and coat (4, 32). After disruption of dormant decoated
spores, GerBA was localized in an insoluble pellet fraction which
contained the inner membrane, and GerBA was located in the membrane of
outgrowing spores that had shed their coat-outer membrane complex.
Together, these observations indicate that GerBA is located in the
inner membrane of the spore and suggest that the inner membrane is the
site of germinant-receptor interaction. A very recent study also
concluded that GerAA and -AC are located in the spore's inner membrane (11a).
 |
MATERIALS AND METHODS |
Construction of strains and plasmids.
The B. subtilis strains used in this study are listed in Table
1. B. subtilis transformations
were performed as described previously (1), and Southern
blot analysis (28) was used to confirm the proper
integration of plasmids during strain construction. The
Escherichia coli strain TG1 was used for plasmid
manipulation (28), and strain BL21
(DE3) (Novagen) was
used for protein expression. E. coli was transformed by the
CaCl2 method (28).
Plasmid pFE254, which was used to overexpress the N-terminal two-thirds
of GerBA as a 10× His tag fusion, was derived from
plasmid pET16b
(Novagen). The 5' region of the
gerBA gene (from
nucleotide

3 to +566 relative to the +1 translation start site
of
gerBA) was PCR amplified from wild-type
B. subtilis chromosomal
DNA with primers pETBA-5
(5'-G
CATATGCAAATCGACTCTGATCTC) and pETBA-3
(5'-
AGATCTCGGCCGGGGCGATATCCTGAATATAAG). The
pETBA-5 primer introduced
an
NdeI site (underlined) at the
translation start site of
gerBA,
while primer pETBA-3
introduced
EagI and
BglII sites (underlined)
at
the 3' end of the amplified fragment. The PCR product was cloned
into
the TA vector pCR2.1 (Invitrogen) to create plasmid pFE112.
A 1.4-kb
EcoRV-
EagI fragment containing the remainder of
the
gerBA gene was excised from plasmid pFE24
(
23) and inserted between
the same sites in plasmid
pFE112. The resulting plasmid, pFE113,
contained the entire
gerBA open reading frame bracketed by an
NdeI
site at the start codon and a
BglII site 500 bp downstream
of the stop codon. The
NdeI-
BamHI (internal site
in
gerBA) fragment
from pFE113, which encodes the N-terminal
two-thirds of GerBA,
was inserted between the same sites in plasmid
pET16b (Novagen)
to generate plasmid
pFE254.
Plasmid pFE135A, which was used to overexpress the
gerB
operon during sporulation, was prepared by fusing the
gerB
operon
to the promoter (P
sspB) of the
sspB gene, which is expressed
at high levels during
sporulation in a forespore-specific manner
(
5). The
promoter (from nucleotide

191 to +10 relative to
the +1 translation
start site of
sspB) was amplified from wild-type
chromosomal
DNA with primers PsspB (5'-AAGCTTTTTTTATTTCTC) and
PsspBNdeI
(5'-AAGCTTGGTTAGC
CATATGTAAAATCTCC). Primer
PsspBNdeI
contains an
NdeI site (underlined) at the
sspB initiating codon,
which can be used to fuse open
reading frames directly downstream
of the
sspB promoter and
ribosome-binding sequence. The PCR product
was cloned into the TA
vector pCR2.1 to create plasmid pFE136A,
whose insert was confirmed by
sequencing. The 220-bp
HindIII fragment
containing
P
sspB from pFE136A was inserted into the
HindIII
site of plasmid pUC19M (Clontech Laboratories), and
one resulting
plasmid in which the fragment had inserted so that its
NdeI site
was closer to the unique
BamHI site in
pUC19M was selected as
plasmid pFE133. The
NdeI-
BglII fragment from plasmid pFE113, which
contains the entire
gerBA coding region, was inserted
between
the
NdeI and
BamHI sites of plasmid
pFE133 to generate plasmid
pFE134. The
HindIII fragment from
plasmid pFE134, which contains
P
sspB fused to
1,316 bp (about 90%) of the
gerBA gene,
was inserted into
the
HindIII site of plasmid pFE52, a pBlueScript
plasmid
(Stratagene) containing the spectinomycin-resistance gene
(
spc) derived from pJL74 (
15), to create
plasmid pFE135A. Plasmid
pFE135A was integrated into the chromosome at
the
gerB locus by
transformation of
B. subtilis
to spectinomycin resistance, resulting
in the insertion of
P
sspB directly upstream of an intact
gerB operon.
Spore preparation, cleaning, and decoating.
Spores were
prepared by the nutrient exhaustion method (22) or the
resuspension method (30) and cleaned by washing as previously described (22). All of the spore preparations
contained >95% phase-bright spores and were essentially free of
sporulating cells and cell debris. Spores were decoated by treatment
for 30 min at 70°C with 0.1 M NaCl-0.1 M NaOH-1% sodium dodecyl
sulfate (SDS)-0.1 M dithiothreitol, and the treated spores were washed as described previously (2). This decoating procedure also removes outer spore membrane proteins (4 and data not shown).
Preparation of spore extracts.
Spore extracts were prepared
by a modification of a previously described method (2).
Untreated or decoated spores (~20 mg [dry weight]) were lyophilized
and pulverized with 100 mg of glass beads in a dental amalgamator
(Wig-L-Bug) for 20 pulses of 30 s each with a 30-s cooling period
between pulses. Proteins were extracted from the disrupted spores with
0.5 ml of TEP buffer (50 mM Tris-HCl [pH 7.4], 5 mM EDTA, 1 mM
phenylmethylsulfonyl fluoride) containing 1% SDS and 0.15 M
-mercaptoethanol by incubation at 70°C for 30 min, and the
insoluble material was removed by centrifugation in a microcentrifuge
(13,000 × g for 5 min at 4°C).
Preparation of spore lysates and their fractionation.
Lysates and membranes from dormant spores were prepared as described
previously (2). Briefly, decoated dormant spores were resuspended at an optical density at 600 mm (OD600) of 50 to 70 in 0.5 ml of TEP buffer containing 1 mg of lysozyme, 1 µg each of RNase A and DNase I, and 20 µg of MgCl2, incubated at
37°C for 5 min, and then kept on ice for 20 min. The spore suspension was then sonicated with 100 mg of glass beads and examined
microscopically for lysis. After >80% of the spores had lysed
(approximately five 15-s bursts of sonication), the fluid was
recovered, the glass beads were washed with 0.5 ml of TEP buffer, and
the wash was pooled with the recovered fluid and centrifuged for 5 min
in a microcentrifuge to remove unbroken spores and integument debris. This first supernatant fluid (termed the lysate) was centrifuged at
100,000 × g for 1 h, giving a soluble fraction
(S100) and a pellet fraction (P100); the latter was resuspended in 40 to 80 µl of TEP buffer containing 1% Triton X-100. The lysate and
S100 fractions were concentrated 10- to 20-fold in a centrifugal filter device (Microcon YM-3, with a 3,000-molecular-weight cutoff) as recommended by the manufacturer (Millipore, Bedford, Mass.).
Membranes from outgrowing spores were prepared as follows.
Heat-activated (70°C, 30 min) spores (OD
600 of 50) were
germinated
in 5 ml of 10 mM Tris-HCl (pH 8.4) and 10 mM
L-Ala for 1 h at
37°C, diluted into 45 ml of 2× YT
medium (
2), and incubated
with shaking at 28°C for
2 h, by which time

70% of the outgrowing
spores had a rod-like
morphology. The outgrowing spores were harvested
by centrifugation at
3,000 ×
g, resuspended in 1 ml of TEP buffer
containing 1 µg of DNase I, 1 µg of RNase A, 20 µg of
MgCl
2, and
1 mg of lysozyme, incubated for 3 min at 37°C
followed by 30 min
on ice, and then sonicated (three 15-s bursts). Cell
debris and
unbroken cells were removed by centrifugation in a
microcentrifuge
for 5 min at 13,000 ×
g. The resultant
supernatant fluid was centrifuged
at 100,000 ×
g for
1 h, and the pellet fraction (P100) was resuspended
in 40 to 80 µl of TEP
buffer.
Production and purification of antibodies.
The His10-GerBA
fusion protein was produced in BL21
(DE3) E. coli cells
carrying plasmid pFE254. Fusion protein expression was induced by
addition of isopropyl-
-D-thiogalactoside (IPTG) to 2 mM
to an actively growing (OD600 of ~0.6) culture at 25°C in 2× YT medium; cells were harvested 4 h after IPTG addition. The
growth temperature of 25°C was chosen to increase the amount of
soluble GerBA formed, because the inclusion bodies formed at 37°C
were not solubilized with 8 M urea or 6 M guanidinium hydrochloride and
interfered with subsequent purification. The soluble His10-GerBA protein was purified by Ni2+ affinity chromatography as
specified by the supplier of the Ni2+ resin (Novagen). The
purified protein had a tendency to precipitate in concentrated solution
and therefore was supplied for antibody production (Pocono Rabbit Farm
and Laboratory, Canadensis, Pa.) as a sonicated suspension at 0.8 mg
per ml in 20 mM Tris-HCl (pH 8.0)-50 mM NaCl-0.1 mM
phenylmethylsulfonyl fluoride. Anti-His10-GerBA antibodies were
detected in a bleed 2 months after initial antigen injection, at which
time the animals were exsanguinated.
The antiserum was purified by affinity chromatography as follows.
Purified His10-GerBA (1 mg/ml) was dialyzed exhaustively
against 0.1 M
sodium phosphate (pH 7.4) at 4°C, solubilized with
0.5% SDS, and
covalently attached to CNBr-activated Sepharose
4 Fast Flow beads
(Amersham Pharmacia Biotech AB) by incubation
at 4°C according to the
manufacturer's specifications, and the
beads were packed into a 2-ml
affinity column. The antiserum (80
ml) was initially partially purified
by ammonium sulfate precipitation
and then affinity purified as
described previously (
11). The
purified antiserum was
concentrated to 3 mg of protein per ml
in a Centriprep concentrator
(Amicon) and stored at

20°C in phosphate-buffered
saline. The
antiserum recognized a 45- to 50-kDa protein in extracts
made from
E. coli cells expressing the untagged full-length GerBA
protein, suggesting that at least some of the purified antibodies
recognized the GerBA
moiety.
Western blot analysis.
GerBA in extracts, lysates, and
lysate fractions was detected by Western blot analysis. The protein
preparations were suspended in 1× sample buffer (11),
heated to 80°C for 15 min, and separated by 10% SDS-polyacrylamide
gel electrophoresis (SDS-PAGE), and the proteins were transferred to a
polyvinylidenedifluoride membrane (Immobilon) (11). The
GerBA protein on the membrane was detected using a 1:1,000 dilution of
the affinity-purified anti-His10-GerBA serum and a 1:10,000 dilution of
goat anti-rabbit immunoglobulin G-alkaline phosphatase conjugate
(Southern Biotechnology Associates, Birmingham, Ala.) in 1×
Tris-buffered saline as described previously (11).
 |
RESULTS |
Detection of GerBA.
We chose to study the localization of the
GerBA protein because of the strong evidence that it functions in a
complex with at least the GerBB protein as a germinant receptor
(23). The gerB operon is expressed at only a
very low level in wild-type spores (6), and efforts to
visualize GerBA by Coomassie blue staining of total spore proteins or
spore membrane proteins resolved by one- or two-dimensional gel
electrophoresis systems were unsuccessful (data not shown).
Overexpressing the gerB operon in B. subtilis, either on a multicopy (pUB110-based) plasmid or by fusing it to the
vegetative xylA or forespore-specific sspB
promoters, also did not result in a detectable GerBA signal on
Coomassie blue-stained gels (data not shown). Epitope tagging of GerBA
was also not possible because both N- and C-terminal tags resulted in
nonfunctional GerBA protein (data not shown). Therefore, we decided to
detect GerBA by immunoblot analysis. While some previous attempts at germinant receptor protein localization have used antipeptide antibodies (27, 33), we decided to prepare polyclonal
antiserum against GerBA itself. Although full-length GerBA would have
made the ideal antigen for antiserum production, we could not
overexpress this protein at detectable levels in any of several
E. coli expression systems (data not shown). Consequently,
we used a fusion protein, His10-GerBA, which contains the N-terminal
two-thirds of GerBA fused downstream from a 10× His tag. The fusion
protein was expressed at high levels (about 20% of total protein) in
E. coli, and the soluble fraction was purified by
Ni2+ affinity chromatography. SDS-PAGE analysis of the
purified protein preparation showed that it contained a major species
of 29 kDa, which is the expected size of the His10-GerBA fusion
protein, and minor species of 18, 20, and 25 kDa (Fig.
1). N-terminal sequence analysis showed
that the proteins in all four of the latter bands had the same
His-tagged amino terminus, indicating that the smaller species are
degradation products of the His10-GerBA fusion protein. The purified
His10-GerBA was used to immunize naive rabbits, and the resulting
antiserum was affinity purified as described in Materials and Methods.

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 1.
SDS-PAGE analysis of purified His10-GerBA protein.
Synthesis of the His10-GerBA protein was induced in E. coli
cells of strain BL21 (DE3) carrying plasmid pFE254, the soluble
proteins were isolated, and GerBA was purified as described in
Materials and Methods. An aliquot (8 µg) of the purified protein
preparation (lane P) was run on an SDS-10% PAGE gel and visualized by
Coomassie blue staining. The arrowhead points to the major species that
was purified, and asterisks mark the smaller species, which are
degradation products of the major protein (see text). Arrows indicate
the migration positions of the molecular mass markers in kilodaltons
(lane M).
|
|
To test the specificity of the antiserum towards GerBA, total
SDS-soluble proteins from disrupted spores (henceforth referred
to as
"extracts") of strains lacking the
gerB operon (FB60) or
overexpressing it (FB58, about 500-fold overexpression; see below)
under the control of the strong, forespore-specific,
sspB
promoter
(P
sspB::
gerB) were
run on an SDS-PAGE gel and subjected
to Western blot analysis (Fig.
2, lanes A and C). Although a number
of
bands were detected in both the
gerB and the
P
sspB::
gerB spore extracts
(Fig.
2, marked with asterisks), these same bands
were also detected
with preimmune serum (data not shown). However,
a set of bands was
detected which was specific to the
P
sspB::
gerB spore extract
(Fig.
2, lane A). This latter set included a series
of four bands in
the 40- to 50-kDa range (Fig.
2, lane A; region
labeled II); since the
predicted molecular mass of GerBA is ~54
kDa, this set of bands very
likely represents GerBA. Additional
bands (Fig.
2, lane A; region
labeled I) were observed at higher
positions (

100 kDa) in the gel; a
putative GerBA degradation
product was also seen much lower (30 kDa) in
the gel (data not
shown). In contrast to the specific GerBA signal in
extracts from
the
P
sspB::
gerB spores, we
failed to detect any GerBA
signal in extracts from wild-type spores
(data not shown). This
is probably due to the extremely low level of
gerB expression
in wild-type spores (
6)
because, as described below, we could
detect GerBA in specific
fractions from wild-type spores.

View larger version (116K):
[in this window]
[in a new window]
|
FIG. 2.
GerBA in extracts from untreated and decoated spores.
Extracts from identical amounts (~3 OD600 units) of
disrupted spores without (lanes A and C) or with (lanes B and D) prior
decoating treatment as described in Materials and Methods were run on
an SDS-PAGE gel and transferred to an Immobilon membrane, and GerBA was
detected as described in Materials and Methods. The spores were from
strains FB58 (PsspB::gerB;
lanes A and B) and FB60 ( gerB; lanes C and D). Bands
marked with an asterisk are nonspecific background bands, whereas those
in regions marked I and II represent GerBA-specific signals; bands in
region II lie close to the predicted GerBA molecular mass (53 kDa),
whereas those in region I probably contain highly modified or complexed
forms of GerBA. Migration positions of molecular mass markers in
kilodaltons are indicated with arrows.
|
|
Effect of decoating on levels of GerBA in spores.
A
proteinaceous coat and an underlying outer membrane form the outermost
layers of the spore integument
a possible site for germinant receptor
location. To determine if GerBA is located in these outer layers, we
subjected spores to a decoating treatment (see Materials and Methods)
which removes the coat and outer membrane (4, 14, 32) and
examined treated spores for GerBA. Extracts (see above and Materials
and Methods) from untreated or decoated spores of a
gerB
strain (FB60) and a
PsspB::gerB strain (FB58)
were run on an SDS-PAGE gel and analyzed for GerBA by Western blotting
(Fig. 2). As noted above, some nonspecific bands (Fig. 2, marked with
asterisks) were seen in extracts from
PsspB::gerB and
gerB spores and a subset of these bands appeared to be
stronger in the extracts from decoated spores. In contrast, the GerBA
signal was similar in the extracts from untreated or decoated
PsspB::gerB spores (Fig. 2,
lanes A and B) and, as expected, absent in extracts from
gerB spores (Fig. 2, lanes C and D). Thus, GerBA was not removed by treatments that remove the spore coat and outer membrane. Consistent with this observation, we did not detect any GerBA in the
coat extracts themselves (data not shown). Thus, GerBA is not extracted
by treatments that solubilize the outer layers of the spore integument.
One might argue that the validity of the above conclusion is contingent
upon the overexpressed GerBA being both functional
and correctly
located. To address these issues, we first determined
if the
P
sspB::
gerB operon was
functional by examining
the ability of the overexpressed GerB proteins
to induce spore
germination in response to AFGK. Spores of strain FB58,
in which
P
sspB::
gerB
represents the only complete copy of the
gerB operon,
germinated similarly to wild-type (PS832) spores
in AFGK (data not
shown) while spores lacking the
gerB operon
do not
(
19,
24). Since the
P
sspB::
gerB construct
complemented the disrupted
gerB operon in strain FB58, this
suggests
that at least a portion of the overexpressed GerB proteins is
functional and therefore likely to be correctly located. In addition,
the absence of any overexpressed GerBA in coat extracts did not
suggest
an outer membrane location for this protein and other
experiments (see
below) showed that the location of the overexpressed
GerBA protein
mirrored the location of the endogenous protein.
Thus, although we
cannot completely rule out that some of the
overexpressed GerBA protein
was localizing incorrectly, at least
the great majority of the
overexpressed GerBA protein did localize
correctly.
Location of GerBA protein in spore lysates.
Because GerBA was
not removed from spores by a decoating treatment, it seemed likely that
GerBA is located within the spore, presumably in the inner membrane. To
more precisely locate GerBA within spores, we made lysates from
decoated spores by treatment with lysozyme. These detergent-free
lysates, which contain spore core proteins as well as inner membrane
vesicles, were concentrated 20-fold by filtration and subjected to
Western blot analysis (Fig. 3). A GerBA
signal was detected in the lysates from spores of wild-type (PS832) and
gerA
gerK (FB86) strains but not in those of the
gerB (FB60) or
gerA
gerB
gerK (FB72) strain. The size and
distribution of the 40- to 50-kDa GerBA signal in the lysates from
wild-type spores (Fig. 3, region labeled II) were essentially identical
to those observed with extracts from disrupted spores of the
PsspB::gerB strain (Fig. 2,
bands in region labeled II). This observation supports the earlier
conclusion that the 40- to 50-kDa signal represents the GerBA protein.
The lysates also contained several background bands that were distinct
from those seen in the extracts (compare Fig. 2 and 3); consequently, a
gerB lysate was included as a control in subsequent
experiments to facilitate unambiguous identification of GerBA. Note
that the background bands could not be attributed to the homologous
proteins encoded by the gerA or gerK operons
(Fig. 3, lanes C and D).

View larger version (101K):
[in this window]
[in a new window]
|
FIG. 3.
GerBA in spore lysates. Lysates from equal amounts (15 OD600 units) of spores of strains PS832 (wild type; lane
A), FB60 ( gerB; lane B), FB86 ( gerA
gerK; lane C), and FB72 ( gerA
gerB gerK; lane D) were run on an SDS-PAGE
gel and transferred to an Immobilon membrane, and GerBA was detected as
described in Materials and Methods. The arrowhead points to GerBA bands
in region II as described in the legend to Fig. 2. Background bands and
molecular mass markers are labeled as in Fig. 2. Note that the samples
run in Fig. 2 were from spores that overexpressed GerBA while the
samples run in this experiment were from spores that did not
overexpress GerBA. That difference and the low exposure level of the
Western blot shown here account for the relative lack of higher
molecular mass GerBA observed in this figure compared to Fig. 2 and
6.
|
|
To further define the location of GerBA, the lysates were fractionated
by centrifugation at 100,000 ×
g into supernatant
(S100)
and pellet (P100) fractions. The P100 fraction is expected to
contain large nucleoprotein complexes as well as inner membrane
vesicles (
25,
26,
31), and YhcN, a putative inner spore
membrane protein, has been found in this fraction (
2). The
total lysate and S100 and P100 fractions from equal amounts of
spores
were subjected to Western blot analysis, and most of the
GerBA protein
from the total lysate was recovered in the P100
fraction (Fig.
4, lanes A, B, E, and F) with no
detectable GerBA
signal in the S100 fraction (Fig.
4, lanes C and D).
Since the
lysates had been treated with nucleases prior to
centrifugation
to minimize the level of nucleoprotein complexes in the
P100 fraction
(
25,
26), these observations suggest that
GerBA is associated
with the spore inner membrane.

View larger version (74K):
[in this window]
[in a new window]
|
FIG. 4.
GerBA in fractionated spore lysates. Lysates from equal
amounts (15 OD600 units) of decoated spores of strains
PS832 (wild type; lanes A, C, and E) and FB60 ( gerB;
lanes B, D, and F) were subjected to centrifugation at
100,000 × g for 1 h. The initial lysate (lanes A
and B), S100 supernatant fractions (lanes C and D), and P100 pellet
fractions (lanes E and F) were run on an SDS-PAGE gel, proteins were
transferred to an Immobilon membrane, and GerBA was detected as
described in Materials and Methods. The arrowheads denoting GerBA
bands, the background bands, and molecular mass markers are labeled as
in Fig. 2.
|
|
To further characterize the location of GerBA, we determined if
detergent and salt treatment affected GerBA partitioning into
the P100
fraction. Lysates from
gerB or wild-type spores were
divided into aliquots that were subjected to no treatment or incubated
with 1% Triton X-100 or 0.5 M NaCl for 30 min on ice. Each aliquot
was
centrifuged at 100,000 ×
g for 1 h, and GerBA in
the P100
and S100 fractions was analyzed by Western blot analysis (Fig.
5). Triton X-100 treatment markedly
reduced (by about 70%) the
amount of GerBA protein recovered in the
P100 fraction (Fig.
5,
lanes D and E) with a comparable increase in
GerBA in the S100
fraction (Fig.
5, lanes D' and E'). In contrast,
treatment with
high salt did not affect GerBA location (Fig.
5, lanes
D, F, D',
and F'). These data suggest that GerBA is an integral
membrane
protein, which agrees with the hydropathy profile of the
predicted
GerBA protein (
17,
34).

View larger version (88K):
[in this window]
[in a new window]
|
FIG. 5.
Effects of detergent and salt treatments on GerBA
fractionation. Lysates from decoated spores (15 OD600
units) of strain FB60 ( gerB; lanes A to C and A' to C')
or strain PS832 (wild type; lanes D to F and D' to F') were incubated
with no additions (lanes A, D, A', and D'), with 1% Triton X-100
(lanes B, E, B', and E'), or with 0.5 M NaCl (lanes C, F, C', and F')
for 30 min on ice, followed by centrifugation at 100,000 × g to obtain the P100 pellet (lanes A to F) and S100 supernatant
(lanes A' to F') fractions. The P100 fractions from 10 OD600 units of spores and S100 fractions from 7 to 8 OD600 units of spores were run on an SDS-PAGE gel and
transferred to an Immobilon membrane, and GerBA was detected as
described in Materials and Methods. The arrowheads denoting GerBA
bands, the background bands, and molecular mass markers are labeled as
in Fig. 2. Note that detergent and salt treatments also affect
fractionation of some of the background bands.
|
|
Abundance of GerBA in spores.
Our ability to detect
GerBA in extracts from disrupted spores of a strain that overexpressed
the gerB operon but not in those from wild-type spores
suggested that GerBA might be a low-abundance protein. Indeed, studies
with a gerB-lacZ fusion have indicated that the
gerB operon is expressed at a rather low level
(6). To estimate the number of GerBA molecules per spore,
the GerBA signal in the P100 fraction from a known quantity of spores
was compared to that obtained from a known amount of the purified His10-GerBA fusion protein. With the P100 fraction, the intensity of
each of the four GerBA bands in the 40- to 50-kDa region appeared similar in intensity to the signal generated by 3 × 10
14 mol of the His10-GerBA protein (data not shown).
Since the P100 fraction was obtained from 15 OD600 units of
spores (~3 × 109 spores), these findings suggest
that there are about 24 molecules of GerBA per spore (4 × 3 × 10
14 × 6 × 1023/3 × 109 = 24). In other experiments (data not shown), this
number ranged between 24 and 40 molecules per spore. While this value
may well be a slight underestimate due to losses during P100 isolation, it clearly shows that GerBA is a very-low-abundance protein.
We also compared the relative abundance of GerBA in spores from strains
that carried different doses of the
gerB operon. Western
blot analysis was used to compare the amounts of GerBA protein
in P100
fractions from equivalent amounts of spores of strains
FB60, PS832, and
FB49, which contain zero, one, or two copies
of
gerB,
respectively, and of strain FB58, which contains the
P
sspB::
gerB construct (Fig.
6). As expected, the strength
of the
GerBA signal increased with increasing dosage or expression
of the
gerB operon. Comparison of the strength of the GerBA signal
in dilutions of the P100 fractions from
P
sspB::
gerB spores
and
wild-type spores showed that the former contained at least
500-fold
more GerBA than wild-type spores (data not shown). These
findings
further indicate that bands in regions I and II are due
to the GerBA
protein and also suggest that the overexpressed GerBA
mirrors the
normal level of this protein in its inner membrane
localization.

View larger version (112K):
[in this window]
[in a new window]
|
FIG. 6.
GerBA signal in spores with different levels of
expression of gerB. The P100 pellet fractions of spores (15 OD600 units) from strains FB60 ( gerB; lane
A), PS832 (wild type; lane B), FB49 (PS832
amyE::gerB; lane C), or FB58
(PsspB::gerB; lane D) were
run on an SDS-PAGE gel, transferred to an Immobilon membrane, and
probed for GerBA as described in Materials and Methods. The arrowheads
labeled I and II denote the GerBA-specific signals in the 100-kDa and
40- to 50-kDa ranges, respectively. Background bands and molecular mass
markers are labeled as in Fig. 2.
|
|
GerBA location in outgrowing spores.
The inner membrane
of the dormant spore becomes the cell membrane in the outgrowing spore,
whereas the outer membrane and coat layers of the dormant spore are
shed during spore germination. Thus, inner membrane proteins persist in
the outgrowing spore, unlike those of the outer membrane and coat
layers. If, as suggested above, GerBA is located in the inner membrane,
then assuming that there is no significant degradation of GerBA during
spore germination and outgrowth, GerBA should be present in outgrowing
spores (29). To test this prediction, we germinated spores
of
gerB (FB60) and wild-type (PS832) strains in
L-Ala and allowed them to outgrow in rich medium. When the
spores were predominantly rod-shaped, they were harvested and used to
prepare lysates and P100 fractions which were examined for GerBA by
Western blot analysis (Fig. 7). GerBA was
detected in the P100 fraction of outgrowing wild-type spores 2 h
after initiation of spore germination (Fig. 7), and the amount
recovered was comparable to that from a similar quantity of decoated
wild-type spores (data not shown). This finding is again consistent
with an inner membrane location for GerBA. Note that the GerBA signal
was unlikely to arise from spores that had failed to shed their coats
because the coats would be removed along with cell wall debris in the
low-speed centrifugation of lysates prior to the ultracentrifugation
used to pellet the membranes.

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 7.
GerBA in outgrowing spores. P100 fractions from
outgrowing (10 OD600 units) spores of strains FB60
( gerB; lane A) and PS832 (wild type; lane B) prepared as
described in Materials and Methods were run on an SDS-PAGE gel,
proteins were transferred to an Immobilon membrane, and GerBA was
detected as described in Materials and Methods. Arrowheads labeled I
and II denote GerBA bands in regions I and II, respectively, and
background bands and molecular mass markers are labeled as in Fig. 2.
|
|
 |
DISCUSSION |
Dormant B. subtilis spores detect specific nutrients in
the environment and respond to that stimulus by germinating. Previous work showed that this response is mediated by germinant receptor proteins that are encoded by the gerA family of operons
(17, 19). In this study we used Western blot analysis to
follow one gerB-encoded protein, GerBA, in spore fractions
and our observations showed that GerBA is located in the inner membrane
of the dormant spore. Previous studies (23) have suggested
that the GerB receptor is a membrane-associated, multisubunit complex
consisting of GerBA, GerBB, and probably other proteins. Thus, in light
of our observations with GerBA, we propose that the entire GerB
receptor is located in the inner membrane of the dormant spore. Future
studies addressing the location of GerBB and other putative receptor
components, for example GerBC, will be needed to fully test this hypothesis.
In contrast to our evidence for an inner membrane location of the GerB
receptor, previous studies which used antisera against GerA peptides
and immunoelectron microscopy led to the claim that the GerA receptor
proteins were located at the cortex-coat boundary in dormant spores and
were thus likely to be in the outer membrane (27, 33). The
results of these studies also suggested that the GerAB protein
redistributes throughout the cortex shortly after the initiation of
spore germination (27). Although it is possible that the
GerA and GerB receptors are located in different places, this seems
unlikely given the high degree of homology between the proteins encoded
by the gerA and gerB operons. Indeed, it is
possible that the observations which suggested that the GerA proteins
are located in the outer membrane-coat were compromised by some
reactivity of the antisera used with proteins other than GerA proteins
(27, 33), and the specificity of those antibodies was
never unambiguously demonstrated. In addition, if we assume that the
number of GerAB molecules per spore is similar to that for GerBA, then
the immunoelectron micrographs of spore sections often detected more
molecules of GerAB than the expected total number in the entire spore
(27). Finally, a separate study using antipeptide antisera
to detect GerA proteins in spore fractions by Western blot analysis
also reported that GerAA was located in the inner membrane
(17), and this has been confirmed for both GerAA and GerAC
in a recent study (11a). Taking all of the available data into account,
we would argue that as is almost certainly the case with the GerB
receptor, the GerA receptor and by analogy the GerK receptor are also
located in the spore's inner membrane.
The possible inner membrane localization of GerB and other germinant
receptors raises several interesting mechanistic questions. First, how
do germinants reach receptors in the inner membrane, which lies below
the germ cell wall, cortex, outer membrane, and coat layers? The
peptidoglycan cortex and germ cell wall are thought to be freely
permeable to small germinants (14), and the integrity of
the outer membrane, which is ill-defined in electron micrographs, has
been questioned (7). However, biochemical studies which measured the spore volume that is accessible for diffusion of small
molecules suggested that a permeability barrier may exist for molecules
such as glucose and ribose in the coat-outer membrane region
(14). If true, this would require the existence of special systems that allow germinants to traverse this barrier and reach the
inner spore membrane. Although no such permeability systems have been
unequivocally identified, recent work described mutations in the
gerP operon that blocked germination in intact but not in
decoated spores (3). Thus, a gerP-dependent
system might allow germinants to traverse the coat-outer membrane
barrier. A second question raised by an inner membrane location of the germinant receptor concerns how the germinant-binding signal is transduced outward into the cortex where the cortex-lytic enzymes (CLEs) such as SleB and CwlJ are most likely located (12,
20). The CLEs are necessary for hydrolysing the cortex during
germination but their activity is repressed during dormancy;
consequently, a signal from the site of the germinant-receptor
interaction must ultimately activate these quiescent enzymes. One might
imagine that the activated receptors locally change inner-membrane
permeability and thereby affect the hydration level in the spore core.
However, no specific second messenger or mechanism has yet been
identified or proposed to explain the transduction of this signal to
the CLEs in the spore cortex. An interesting possibility is suggested by the finding that some CLEs act only on the spore cortex as it exists
in situ and have minimal activity on isolated spore cortex (10,
16, 20, 21). Thus, receptor-triggered changes in the inner
membrane might stress the cortex by stimulating core rehydration and
thereby trigger cortex hydrolysis. Although the precise mechanism(s) of
signal transduction during spore germination remains to be elucidated
and confirmed, the inner membrane is certainly a plausible location for
the receptors for nutrient germinants.
The observations presented here also present new strategies to study
germinant receptor biochemistry, which has lagged behind the genetic
analysis of these spore components. We observed that GerBA appeared as
a series of four or more bands in the 40- to 50-kDa range on SDS-PAGE,
suggesting that the protein is subject to either modification or
degradation or both. There is also a significant amount of GerBA signal
at higher molecular mass on SDS-PAGE, suggesting that some GerBA can be
either covalently attached to another molecule or associated in a very
strong complex. Indeed, genetic studies have suggested that the
receptor is a multicomponent system (23), but questions
concerning the orientation, transport, and breakdown of the receptor
proteins remain to be addressed. In this study, we found that GerBA can
be appreciably overexpressed in spores and is also found in outgrowing
spore membranes, which are easier to prepare than membranes from
dormant spores. These findings may aid in the biochemical analysis of germinant receptors by overcoming some of the problems, in particular receptor abundance, that have limited such research in the past.
 |
ACKNOWLEDGMENTS |
We thank members of this laboratory for their comments and
criticisms on the manuscript and are grateful to A. Moir for sharing results prior to their publication.
The work was supported by a grant from the National Institutes of
Health, GM19698.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry, MC 3305, University of Connecticut Health Center, 263 Farmington Ave., Farmington, CT 06030. Phone: (860) 679-2607. Fax:
(860) 679-3408. E-mail: setlow{at}sun.uchc.edu.
 |
REFERENCES |
| 1.
|
Anagnostopoulos, C., and J. Spizizen.
1961.
Requirements for transformation in Bacillus subtilis.
J. Bacteriol.
81:74-76.
|
| 2.
|
Bagyan, I.,
M. Noback,
S. Bron,
M. Paidhungat, and P. Setlow.
1998.
Characterization of yhcN, a new forespore-specific gene of Bacillus subtilis.
Gene
212:179-188[CrossRef][Medline].
|
| 3.
|
Behravan, J.,
H. Chirakkal,
A. Masson, and A. Moir.
2000.
Mutations in the gerP locus of Bacillus subtilis and Bacillus cereus affect access of germinants to their targets in spores.
J. Bacteriol.
182:1987-1994[Abstract/Free Full Text].
|
| 4.
|
Buchanan, C. E., and S. L. Neyman.
1986.
Correlation of penicillin-binding protein composition with different functions of two membranes in Bacillus subtilis forespores.
J. Bacteriol.
165:498-503[Abstract/Free Full Text].
|
| 5.
|
Connors, M. J.,
J. M. Mason, and P. Setlow.
1986.
Cloning and nucleotide sequence of genes for three small acid-soluble proteins of Bacillus subtilis spores.
J. Bacteriol.
166:417-425[Abstract/Free Full Text].
|
| 6.
|
Corfe, B. M.,
R. L. Sammons,
D. A. Smith, and C. Mauël.
1994.
The gerB region of the Bacillus subtilis 168 chromosome encodes a homologue of the gerA spore germination operon.
Microbiology
140:471-478[Abstract/Free Full Text].
|
| 7.
|
Crafts-Lighty, A., and D. J. Ellar.
1980.
The structure and function of the spore outer membrane in dormant and germinating spores of Bacillus megaterium.
J. Appl. Bacteriol.
48:135-145[Medline].
|
| 8.
|
Errington, J.
1993.
Bacillus subtilis sporulation: regulation of gene expression and control of morphogenesis.
Microbiol. Rev.
57:1-33[Abstract/Free Full Text].
|
| 9.
|
Foster, S. J., and K. Johnstone.
1990.
Pulling the trigger: the mechanism of bacterial spore germination.
Mol. Microbiol.
4:137-141[CrossRef][Medline].
|
| 10.
|
Foster, S. J., and K. Johnstone.
1987.
Purification and properties of a germination-specific cortex-lytic enzyme from spores of Bacillus megaterium KM.
Biochem. J.
242:573-579[Medline].
|
| 11.
|
Harlow, E., and D. Lane.
1988.
Antibodies: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 11a.
| Hudson, K. D., B. M. Corfe, E. H. Kemp, I. M. Feavers, P. J. Coote, and A. Moir. 2001. Localization of
GerAA and GerAC germination proteins in the Bacillus
subtilis spore. J. Bacteriol., in press.
|
| 12.
|
Ishikawa, S.,
K. Yamane, and J. Sekiguchi.
1998.
Regulation and characterization of a newly deduced cell wall hydrolase gene (cwlJ) which affects germination of Bacillus subtilis spores.
J. Bacteriol.
180:1375-1380[Abstract/Free Full Text].
|
| 13.
|
Johnstone, K.
1994.
The trigger mechanism of spore germination: current concepts.
J. Appl. Bacteriol. Symp. Suppl.
76:17S-24S.
|
| 14.
|
Koshikawa, T.,
T. C. Beaman,
H. S. Pankratz,
S. Nakashio,
T. R. Corner, and P. Gerhardt.
1984.
Resistance, germination, and permeability correlates of Bacillus megaterium spores successively divested of integument layers.
J. Bacteriol.
159:624-632[Abstract/Free Full Text].
|
| 15.
|
LeDeaux, J. R., and A. D. Grossman.
1995.
Isolation and characterization of kinC, a gene that encodes a sensor kinase homologous to the sporulation sensor kinases KinA and KinB in Bacillus subtilis.
J. Bacteriol.
177:166-175[Abstract/Free Full Text].
|
| 16.
|
Miyata, S.,
R. Moriyama,
K. Sugimoto, and S. Makino.
1995.
Purification and partial characterization of a spore cortex-lytic enzyme of Clostridium perfringens S40 spores.
Biosci. Biotech. Biochem.
59:514-515[Medline].
|
| 17.
|
Moir, A.,
E. H. Kemp,
C. Robinson, and B. M. Corfe.
1994.
The genetic analysis of bacterial spore germination.
J. Appl. Bacteriol. Symp. Suppl.
76:9S-16S.
|
| 18.
|
Moir, A.,
E. Lafferty, and D. A. Smith.
1979.
Genetic analysis of spore germination mutants of Bacillus subtilis 168: the correlation of phenotype and map location.
J. Gen. Microbiol.
111:165-180[Abstract/Free Full Text].
|
| 19.
|
Moir, A., and D. A. Smith.
1990.
The genetics of bacterial spore germination.
Annu. Rev. Microbiol.
44:531-553[CrossRef][Medline].
|
| 20.
|
Moriyama, R.,
H. Fukuoka,
S. Miyata,
S. Kudoh,
A. Hattori,
S. Kozuka,
Y. Yasuda,
K. Tochikubo, and S. Makino.
1999.
Expression of a germination-specific amidase, SleB, of Bacilli in the forespore compartment of sporulating cells and its localization on the exterior side of the cortex in dormant spores.
J. Bacteriol.
181:2373-2378[Abstract/Free Full Text].
|
| 21.
|
Moriyama, R.,
S. Kudoh,
S. Miyata,
S. Nonobe,
A. Hattori, and S. Makino.
1996.
A germination-specific spore cortex-lytic enzyme from Bacillus cereus spores: cloning and sequencing of the gene and molecular characterization of the enzyme.
J. Bacteriol.
178:5330-5332[Abstract/Free Full Text].
|
| 22.
|
Nicholson, W. L., and P. Setlow.
1990.
Sporulation, germination, and outgrowth, p. 391-450.
In
C. R. Harwood, and S. M. Cutting (ed.), Molecular biological methods for Bacillus. John Wiley & Sons Ltd., Chichester, England.
|
| 23.
|
Paidhungat, M., and P. Setlow.
1999.
Isolation and characterization of mutations in Bacillus subtilis that allow spore germination in the novel germinant D-alanine.
J. Bacteriol.
181:3341-3350[Abstract/Free Full Text].
|
| 24.
|
Paidhungat, M., and P. Setlow.
2000.
Role of Ger proteins in nutrient and nonnutrient triggering of spore germination in Bacillus subtilis.
J. Bacteriol.
182:2513-2519[Abstract/Free Full Text].
|
| 25.
|
Racine, F. M., and J. C. Vary.
1982.
Improved method for purification of membranes from spores of Bacillus megaterium.
Prep. Biochem.
12:265-273[Medline].
|
| 26.
|
Racine, F. M., and J. C. Vary.
1980.
Isolation and properties of membranes from Bacillus megaterium spores.
J. Bacteriol.
143:1208-1214[Abstract/Free Full Text].
|
| 27.
|
Sakae, Y.,
Y. Yasuda, and K. Tochikubo.
1995.
Immunoelectron microscopic localization of one of the spore germination proteins, GerAB, in Bacillus subtilis spores.
J. Bacteriol.
177:6294-6296[Abstract/Free Full Text].
|
| 28.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 29.
|
Santo, L. Y., and R. H. Doi.
1974.
Ultrastructural analysis during germination and outgrowth of Bacillus subtilis spores.
J. Bacteriol.
120:475-481[Abstract/Free Full Text].
|
| 30.
|
Sterlini, J. M., and J. Mandelstam.
1969.
Commitment to sporulation in Bacillus subtilis and its relationship to development of actinomycin resistance.
Biochem. J.
113:29-37[Medline].
|
| 31.
|
Swerdlow, R. D., and P. Setlow.
1984.
Isolation and characterization of two distinct fractions from the inner membrane of dormant Bacillus megaterium spores.
J. Bacteriol.
158:9-15[Abstract/Free Full Text].
|
| 32.
|
Vary, J. C.
1973.
Germination of Bacillus megaterium spores after various extraction procedures.
J. Bacteriol.
95:1327-1334.
|
| 33.
|
Yasuda, Y.,
Y. Sakae, and K. Tochikubo.
1996.
Immunological detection of the GerA spore germination proteins in the spore integuments of Bacillus subtilis using scanning electron microscopy.
FEMS Microbiol. Lett.
139:235-238[Medline].
|
| 34.
|
Zuberi, A. R.,
A. Moir, and I. M. Feavers.
1987.
The nucleotide sequence and gene organization of the gerA spore germination operon of Bacillus subtilis 168.
Gene
51:1-11[CrossRef][Medline].
|
Journal of Bacteriology, July 2001, p. 3982-3990, Vol. 183, No. 13
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.13.3982-3990.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Paredes-Sabja, D., Udompijitkul, P., Sarker, M. R.
(2009). Inorganic Phosphate and Sodium Ions Are Cogerminants for Spores of Clostridium perfringens Type A Food Poisoning-Related Isolates. Appl. Environ. Microbiol.
75: 6299-6305
[Abstract]
[Full Text]
-
Ghosh, S., Zhang, P., Li, Y.-q., Setlow, P.
(2009). Superdormant Spores of Bacillus Species Have Elevated Wet-Heat Resistance and Temperature Requirements for Heat Activation. J. Bacteriol.
191: 5584-5591
[Abstract]
[Full Text]
-
Paredes-Sabja, D., Setlow, P., Sarker, M. R.
(2009). GerO, a Putative Na+/H+-K+ Antiporter, Is Essential for Normal Germination of Spores of the Pathogenic Bacterium Clostridium perfringens. J. Bacteriol.
191: 3822-3831
[Abstract]
[Full Text]
-
Mongkolthanaruk, W., Robinson, C., Moir, A.
(2009). Localization of the GerD spore germination protein in the Bacillus subtilis spore. Microbiology
155: 1146-1151
[Abstract]
[Full Text]
-
Ghosh, S., Setlow, P.
(2009). Isolation and Characterization of Superdormant Spores of Bacillus Species. J. Bacteriol.
191: 1787-1797
[Abstract]
[Full Text]
-
Christie, G., Lowe, C. R.
(2008). Amino Acid Substitutions in Transmembrane Domains 9 and 10 of GerVB That Affect the Germination Properties of Bacillus megaterium Spores. J. Bacteriol.
190: 8009-8017
[Abstract]
[Full Text]
-
Pelczar, P. L., Setlow, P.
(2008). Localization of the Germination Protein GerD to the Inner Membrane in Bacillus subtilis Spores. J. Bacteriol.
190: 5635-5641
[Abstract]
[Full Text]
-
Paredes-Sabja, D., Setlow, B., Setlow, P., Sarker, M. R.
(2008). Characterization of Clostridium perfringens Spores That Lack SpoVA Proteins and Dipicolinic Acid. J. Bacteriol.
190: 4648-4659
[Abstract]
[Full Text]
-
Christie, G., Lazarevska, M., Lowe, C. R.
(2008). Functional Consequences of Amino Acid Substitutions to GerVB, a Component of the Bacillus megaterium Spore Germinant Receptor. J. Bacteriol.
190: 2014-2022
[Abstract]
[Full Text]
-
Christie, G., Lowe, C. R.
(2007). Role of Chromosomal and Plasmid-Borne Receptor Homologues in the Response of Bacillus megaterium QM B1551 Spores to Germinants. J. Bacteriol.
189: 4375-4383
[Abstract]
[Full Text]
-
Costa, T., Serrano, M., Steil, L., Volker, U., Moran, C. P. Jr., Henriques, A. O.
(2007). The Timing of cotE Expression Affects Bacillus subtilis Spore Coat Morphology but Not Lysozyme Resistance. J. Bacteriol.
189: 2401-2410
[Abstract]
[Full Text]
-
Masayama, A., Kuwana, R., Takamatsu, H., Hemmi, H., Yoshimura, T., Watabe, K., Moriyama, R.
(2007). A Novel Lipolytic Enzyme, YcsK (LipC), Located in the Spore Coat of Bacillus subtilis, Is Involved in Spore Germination. J. Bacteriol.
189: 2369-2375
[Abstract]
[Full Text]
-
Igarashi, T., Setlow, P.
(2006). Transcription of the Bacillus subtilis gerK Operon, Which Encodes a Spore Germinant Receptor, and Comparison with That of Operons Encoding Other Germinant Receptors. J. Bacteriol.
188: 4131-4136
[Abstract]
[Full Text]
-
Hornstra, L. M., de Vries, Y. P., Wells-Bennik, M. H. J., de Vos, W. M., Abee, T.
(2006). Characterization of Germination Receptors of Bacillus cereus ATCC 14579. Appl. Environ. Microbiol.
72: 44-53
[Abstract]
[Full Text]
-
Vepachedu, V. R., Setlow, P.
(2005). Localization of SpoVAD to the Inner Membrane of Spores of Bacillus subtilis. J. Bacteriol.
187: 5677-5682
[Abstract]
[Full Text]
-
Igarashi, T., Setlow, P.
(2005). Interaction between Individual Protein Components of the GerA and GerB Nutrient Receptors That Trigger Germination of Bacillus subtilis Spores. J. Bacteriol.
187: 2513-2518
[Abstract]
[Full Text]
-
Hornstra, L. M., de Vries, Y. P., de Vos, W. M., Abee, T., Wells-Bennik, M. H. J.
(2005). gerR, a Novel ger Operon Involved in L-Alanine- and Inosine-Initiated Germination of Bacillus cereus ATCC 14579. Appl. Environ. Microbiol.
71: 774-781
[Abstract]
[Full Text]
-
Cowan, A. E., Olivastro, E. M., Koppel, D. E., Loshon, C. A., Setlow, B., Setlow, P.
(2004). Lipids in the inner membrane of dormant spores of Bacillus species are largely immobile. Proc. Natl. Acad. Sci. USA
101: 7733-7738
[Abstract]
[Full Text]
-
Igarashi, T., Setlow, B., Paidhungat, M., Setlow, P.
(2004). Effects of a gerF (lgt) Mutation on the Germination of Spores of Bacillus subtilis. J. Bacteriol.
186: 2984-2991
[Abstract]
[Full Text]
-
Chada, V. G. R., Sanstad, E. A., Wang, R., Driks, A.
(2003). Morphogenesis of Bacillus Spore Surfaces. J. Bacteriol.
185: 6255-6261
[Abstract]
[Full Text]
-
Igura, N., Kamimura, Y., Islam, M. S., Shimoda, M., Hayakawa, I.
(2003). Effects of Minerals on Resistance of Bacillus subtilis Spores to Heat and Hydrostatic Pressure. Appl. Environ. Microbiol.
69: 6307-6310
[Abstract]
[Full Text]
-
Cabrera-Martinez, R.-M., Tovar-Rojo, F., Vepachedu, V. R., Setlow, P.
(2003). Effects of Overexpression of Nutrient Receptors on Germination of Spores of Bacillus subtilis. J. Bacteriol.
185: 2457-2464
[Abstract]
[Full Text]
-
Ragkousi, K., Eichenberger, P., van Ooij, C., Setlow, P.
(2003). Identification of a New Gene Essential for Germination of Bacillus subtilis Spores with Ca2+-Dipicolinate. J. Bacteriol.
185: 2315-2329
[Abstract]
[Full Text]
-
Chirakkal, H., O'Rourke, M., Atrih, A., Foster, S. J., Moir, A.
(2002). Analysis of spore cortex lytic enzymes and related proteins in Bacillus subtilis endospore germination. Microbiology
148: 2383-2392
[Abstract]
[Full Text]
-
Barlass, P. J., Houston, C. W., Clements, M. O., Moir, A.
(2002). Germination of Bacillus cereus spores in response to L-alanine and to inosine: the roles of gerL and gerQ operons. Microbiology
148: 2089-2095
[Abstract]
[Full Text]
-
Paidhungat, M., Setlow, B., Daniels, W. B., Hoover, D., Papafragkou, E., Setlow, P.
(2002). Mechanisms of Induction of Germination of Bacillus subtilis Spores by High Pressure. Appl. Environ. Microbiol.
68: 3172-3175
[Abstract]
[Full Text]
-
Bagyan, I., Setlow, P.
(2002). Localization of the Cortex Lytic Enzyme CwlJ in Spores of Bacillus subtilis. J. Bacteriol.
184: 1219-1224
[Abstract]
[Full Text]
-
Tovar-Rojo, F., Chander, M., Setlow, B., Setlow, P.
(2002). The Products of the spoVA Operon Are Involved in Dipicolinic Acid Uptake into Developing Spores of Bacillus subtilis. J. Bacteriol.
184: 584-587
[Abstract]
[Full Text]
-
Paidhungat, M., Ragkousi, K., Setlow, P.
(2001). Genetic Requirements for Induction of Germination of Spores of Bacillus subtilis by Ca2+-Dipicolinate. J. Bacteriol.
183: 4886-4893
[Abstract]
[Full Text]
-
Hudson, K. D., Corfe, B. M., Kemp, E. H., Feavers, I. M., Coote, P. J., Moir, A.
(2001). Localization of GerAA and GerAC Germination Proteins in the Bacillus subtilis Spore. J. Bacteriol.
183: 4317-4322
[Abstract]
[Full Text]