Previous Article | Next Article 
Journal of Bacteriology, August 2001, p. 4459-4467, Vol. 183, No. 15
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.15.4459-4467.2001
Identification of Some DNA Damage-Inducible Genes
of Mycobacterium tuberculosis: Apparent Lack of
Correlation with LexA Binding
Patricia C.
Brooks,
Farahnaz
Movahedzadeh,
and
Elaine O.
Davis*
Division of Mycobacterial Research, National
Institute for Medical Research, The Ridgeway, Mill Hill, London NW7
1AA, England
Received 15 February 2001/Accepted 10 May 2001
 |
ABSTRACT |
The repair of DNA damage is expected to be particularly important
to intracellular pathogens such as Mycobacterium
tuberculosis, and so it is of interest to examine the response of
M. tuberculosis to DNA damage. The expression of
recA, a key component in DNA repair and recombination, is
induced by DNA damage in M. tuberculosis. In this study, we
have analyzed the expression following DNA damage in M. tuberculosis of a number of other genes which are DNA damage inducible in Escherichia coli. While many of these genes
were also induced by DNA damage in M. tuberculosis, some
were not. In addition, one gene (ruvC) which is not induced
by DNA damage in E. coli was induced in M. tuberculosis, a result likely linked to its different
transcriptional arrangement in M. tuberculosis. We also
searched the sequences upstream of the genes being studied for the
mycobacterial SOS box (the binding site for LexA) and assessed LexA
binding to potential sites identified. LexA is the repressor protein
responsible for regulating expression of these SOS genes in E. coli. However, two of the genes which were DNA damage inducible
in M. tuberculosis did not have identifiable sites to which
LexA bound. The absence of binding sites for LexA upstream of these
genes was confirmed by analysis of LexA binding to overlapping DNA
fragments covering a region from 500 bp upstream of the coding sequence
to 100 bp within it. Therefore, it appears most likely that an
alternative mechanism of gene regulation in response to DNA damage
exists in M. tuberculosis.
 |
INTRODUCTION |
The repair of DNA damage is likely
to be important to pathogens such as Mycobacterium
tuberculosis which reside within the very host cells intended to
be a defense against infection. Although M. tuberculosis is
able to modify the maturation of the normal phagocytic pathway
(5, 12, 32), initially, on entering the macrophage, the
bacterium is exposed to a variety of reactive oxygen and reactive
nitrogen intermediates which are able to damage DNA (1, 2,
25). In addition, DNA repair systems are probably important for
successful emergence from the dormant state (21), in which
M. tuberculosis persists in the host but does not cause active disease. This possibility is supported by the induction of DNA
repair genes in other bacteria during stationary phase (19,
33).
The genome sequence of M. tuberculosis has been analyzed for
the presence of homologs of genes known to be involved in DNA repair in
Escherichia coli (21). Genes required for
nucleotide excision repair, base excision repair, recombination, and
SOS repair were all identified, but no homologs of mismatch repair genes could be detected. In addition, no homologs of some individual genes, such as the SOS genes polB and umuD, were found.
The primary response of many bacteria to DNA damage is the induction of
a number of genes which are important for DNA repair and the control of
cell division. In E. coli, the majority of these genes are
part of the so-called SOS response which is regulated by the repressor
protein LexA in conjunction with RecA, which acts as an activator
(11, 17). Under normal conditions, LexA binds to a
specific sequence (the SOS box) upstream of the genes it regulates to
repress expression (4, 18). When DNA damage occurs, RecA
binds to regions of single-stranded DNA arising from processing of the
damage or blockage of replication (27), and in this state
it stimulates the autocatalytic cleavage of LexA (16). The
cleaved fragments of LexA no longer bind to the SOS boxes
(3), resulting in increased transcription of the SOS genes. The degree of induction of a gene depends on the affinity of its
SOS box for LexA, the location of the SOS box relative to the promoter,
the promoter strength, and the presence of any additional constitutive
promoters (11, 28).
The key regulatory elements of the SOS system have been identified in
M. tuberculosis (9, 22-24). It has been
demonstrated that the recA gene is DNA damage inducible, and
the LexA protein has been shown to bind to a specific sequence upstream
of each of the recA and lexA genes. We now wished
to examine homologs of other members of the E. coli SOS
regulon to see if their expression is DNA damage inducible in M. tuberculosis and whether they are regulated by LexA.
 |
MATERIALS AND METHODS |
Computer searches.
Searches of the whole M. tuberculosis H37Rv genome were performed using the facilities
provided at the TubercuList web site (http://genolist.pasteur.fr/TubercuList/). Searches of 500-bp sequences preceding individual genes were done using the program Findpatterns of the Genetics Computer Group package (8).
Bacterial growth conditions and DNA damage induction.
M. tuberculosis H37Rv was grown in modified Dubos medium
(Difco) in tissue culture flasks laid flat in a 37°C incubator. Under these conditions of growth, the doubling time was 25 h. To induce DNA damage, mitomycin C (0.2 µg ml
1) was added to
growing cultures (at A600 of 0.4 to 0.6) and
incubated for the time indicated.
RNA extraction and cDNA synthesis.
Commercially available
kits were used for the isolation of total RNA (Hybaid Ribolyser Blue
kit) from bacterial cultures (100 ml), to digest contaminating DNA from
the RNA preparations using RNase-free DNase (Roche), and subsequent
cleanup procedures (RNeasy Mini Kit; Qiagen). First-strand cDNA
synthesis was carried out using Superscript II (Life Technologies)
according to the published protocol (24).
Real-time quantitative Taqman PCR assay.
Real-time
quantitative PCR was carried out on the ABI Prism 7700 sequence
detection system using the Taqman Universal PCR Master Mix (PE Applied
Biosystems). The primers and the Taqman probes (carrying both a
fluorophore and a quencher) were designed using the Primer Express
software and obtained from PE Applied Biosystems. The sequences of the
primers and the probes are listed in Table
1. In each case the test gene and the
normalizing gene (gnd) were assayed simultaneously along
with a set of standard samples for each gene.
Gel shift assay of LexA binding to individual SOS boxes.
M. tuberculosis LexA was purified from E. coli
containing the expression clone pFM18 as described previously
(22) and stored at
80°C in 100 mM Tris-Cl (pH
7.5)-500 mM NaCl-1 mM EDTA-1 mM dithiothreitol. For each putative
SOS box, an oligonucleotide 24 bases long (containing the particular
motif and 6 bases of native sequence on either side [Table
2]) plus its complement were annealed.
These double-stranded oligonucleotides were end labeled with
[
-32P] dATP at their 5' termini, using T4
polynucleotide kinase (New England Biolabs) according to the
manufacturer's instructions. Approximately 0.2 pmol of the labeled
oligonucleotide was incubated with 2 µl of M. tuberculosis
LexA (diluted to 80 nM in 100 mM Tris-Cl [pH 7.5]-100 mM NaCl) and 1 µg of poly(dI-dC) nonspecific competitor DNA in a 20-µl binding
reaction [1× binding buffer contained 20 mM HEPES (pH 7.6), 30 mM
KCl, 10 mM (NH4)2SO4, 1 mM EDTA, 1 mM DTT, and 0.2% (wt/vol) Tween 20] for 15 min at room temperature.
Protein-DNA complexes were resolved from free DNA on an 8%
nondenaturing polyacrylamide gel by electrophoresis in 0.5×
Tris-borate-EDTA buffer (26) at 180 V for 5 h at
4°C. Gels were dried, and the radioactive bands were visualized by
autoradiography.
Gel shift assay of LexA binding to overlapping fragments of
upstream DNA.
PCRs were used to generate overlapping DNA fragments
spanning at least 500 bp upstream of the coding region and extending at
least 100 bp into it for genes ssb and uvrA.
Three and two PCR products were generated for ssb and
uvrA, respectively, along with a control PCR product
containing the SOS box from upstream of the recA gene. The
primers used and sizes of the PCR products are given in Table
3. The PCR mixtures contained 0.5 µM
each relevant forward and reverse primer, 0.2 mM deoxynucleoside
triphosphates, 5% dimethyl sulfoxide (DMSO), 20 ng of total M. tuberculosis DNA (except for recA, for which the
template was 2 ng pEJ135 [7]), and 5 U of Pfu
Turbo in 1× Pfu buffer (Stratagene). The program used was
as follows: 1 cycle of 94°C for 2 min; 25 cycles of 94°C for
30 s, 58 or 55°C (see Table 3) for 30 s, 72°C for 45 s; and 1 cycle of 72°C for 7 min. These PCR products were gel
purified; then 0.4 pmol was end labeled with
[
-32P]dATP, and 0.2 pmol was used in binding reactions
as described above except that the samples were run on a 6% gel.
Reverse transcription (RT)-PCR to test cotranscription of
ruvCAB.
The PCR mixture contained 0.25 µg each of
forward (AGCGAGGTCAAGGCGGCGGTCACT) and reverse
(GCTCGGCGGGCTCGTAGAAATCCA) oligonucleotides, 1 µl of cDNA
(or DNA for control), 5 U of Taq polymerase, 1 mM deoxynucleoside triphosphates, and 10% dimethyl sulfoxide in buffer P
(Invitrogen PCR Optimizer kit) in a total volume of 50 µl. The program used was as follows: 1 cycle of 94°C for 2 min; 10 cycles of
94°C for 1 min, 63°C for 1 min, and 72°C for 2 min; 20 cycles of
94°C for 1 min, 63°C for 1 min, and 72°C for 2 min plus 20 s
per cycle; and 1 cycle of 72°C for 7 min.
 |
RESULTS |
Having established that expression of the recA gene is
induced by DNA damage in M. tuberculosis (23),
we wished to identify other M. tuberculosis DNA
damage-inducible genes. In other bacteria the majority of genes which
are induced by DNA damage are regulated by the repressor protein LexA
(11), and a binding site for mycobacterial LexA has been
identified upstream of the M. tuberculosis recA gene and
overlapping a putative promoter element (23). Therefore, one approach to identifying other DNA-damage inducible genes would be
to search the M. tuberculosis genome sequence
(6) for the presence of a mycobacterial SOS box upstream
of a coding region. When we performed this search using the sequence
GAACN4GTTC and limiting hits to being within 500 bp upstream of a start codon, we identified 35 exact matches which
included recA and in addition ruvA and
ruvC, genes important for recombination, but also many genes
with no known role in DNA repair or recombination. The presence of an
SOS box in this region does not necessarily mean that the corresponding
gene is regulated by LexA, as the binding site must be in a suitable
position relative to the promoter. In addition, it had also been shown
that mycobacterial LexA bound to an SOS box found upstream of the
lexA gene (22) which had a single mismatch from
the consensus. Thus, it may be that our search should allow for hits to
have one mismatch from the search sequence; this relaxation of the
search constraints resulted in the identification of a further 652 potential sites. Clearly, for this approach to be useful we need to
have a better idea of which bases within the SOS box can be altered
while maintaining the ability to bind LexA and which cannot; studies
are in progress to determine this. Meanwhile, we decided to use the
E. coli SOS regulon as a guide to which genes may also be
DNA damage inducible in M. tuberculosis and to concentrate
on homologs of some of the E. coli SOS genes.
We chose to examine 10 genes, 7 of which are homologs of E. coli SOS genes, in addition to recA as a positive
control. These were selected to represent different functions, i.e.,
regulation (lexA), resolution (ruvA),
recombination (recN), excision repair (uvrA), and
single-stranded DNA binding (ssb), and two genes originally identified on the basis of their DNA damage inducibility but for which
functions have subsequently been identified (dinG
[helicase] and dinP/dinB [polymerase IV]). We included
ruvC, although it is not an SOS gene in E. coli,
because of the SOS box identified upstream of the M. tuberculosis gene. In addition, we decided to study
dnaB, which is DNA damage inducible but not part of the SOS
response in E. coli (14), and recC,
which is a recombination gene that is not DNA damage inducible in
E. coli as an expected negative control.
Induction by DNA damage.
To directly determine whether the
selected genes are induced by DNA damage, we examined their expression
levels before and after exposure to mitomycin C (0.2 µg/ml), an agent
previously shown to be effective at low concentrations in inducing the
expression of recA in mycobacteria (23). We
also analyzed the expression of sigA, encoding the major
sigma factor of M. tuberculosis which had been shown
previously to be constitutively expressed (20). We
measured the amount of each specific mRNA relative to that of a gene
whose expression would not be expected to change under these
conditions, gnd (encoding 6-phosphogluconate dehydrogenase), by real-time RT-PCR. This technique is very sensitive and allowed us to
examine the expression of multiple genes using the same cultures. In
addition to samples from uninduced cultures, we took samples 5, 24, and
36 h after the addition of the DNA-damaging agent, since we had
previously discovered that induction of recA in M. tuberculosis requires extended periods of time (23).
The basal expression levels varied among these genes, with those of
ssb, uvrA, and sigA being higher than average and
those of ruvA, recN, and particularly recC being
relatively low. It was clear that a number of these genes were DNA
damage inducible (Fig. 1), although the
extent of induction at 24 h ranged from approximately
3- to 12-fold (Table 4). However, there
were some significant differences in the response of M. tuberculosis to DNA damage compared with that of E. coli. The genes induced by DNA damage in M. tuberculosis included ruvC, which is not induced in
E. coli, while three genes (recN, dinP, and
dinG) which are SOS genes in E. coli were not, or
were barely, induced in M. tuberculosis. As expected, there
was little change in the expression of either recC or
sigA under these conditions.


View larger version (51K):
[in this window]
[in a new window]
|
FIG. 1.
Gene expression following DNA damage. The amount of mRNA
for each gene relative to that of a normalizing gene (gnd)
was determined by real-time quantitative RT-PCR using RNA samples from
cultures harvested at various time points following the addition of
mitomycin C (0.2 µg ml 1). For each gene, at least two
assays using three or four samples were performed on each of two
independent inductions. The values shown are the means; the error bars
indicate the standard deviations. Note that the scales of the
y axes vary according to the expression level of the gene
being analyzed.
|
|
Identification of potential SOS boxes.
For each of the 10 genes of interest, the 500 bp immediately preceding the start codon was
searched for homology to the mycobacterial SOS box
GAACN4GTTC, allowing up to three mismatches from
the eight defined bases. In every case, numerous sequences with three
mismatches were found (data not shown), but only a few sequences with
two or fewer mismatches were identified (Table
5). As expected from the genome search,
the only genes with sites having no mismatches were recA,
ruvA, and ruvC, while single mismatched sites were found upstream of lexA (two sites), dnaB and
recC. Several of the genes had two sites each with two
mismatches, while there were no sequences with fewer than three
mismatches for uvrA and dinG. We decided to label
the sites by gene name followed by the number of mismatches and
finally, in the case of multiple sites with the same number of
mismatches, the letter a or b, depending on its distance from the
coding region, e.g. recN2a (Table 5).
LexA binding.
We wished to assess each of these potential SOS
boxes for its ability to bind M. tuberculosis LexA. However,
we first used a selection of mutated recA SOS boxes with
various effects on induction (details to be published elsewhere) to
determine that the concentration of LexA used for this in vitro
analysis gave binding results which paralleled the deduced effect on
binding in vivo (Fig. 2). The in vivo
analysis used a transcriptional fusion of lacZ to the
LexA-regulated recA promoter containing the various
mutations in the SOS box. An induction ratio of 1 or less in this
system indicated that LexA did not bind in vivo. Significantly, if
concentrations of LexA higher than that shown were used in the gel
shift analysis, binding became evident to those sequences which clearly
did not bind in vivo, suggesting that such weak interactions were not
physiologically relevant. We next assayed each of the identified
potential SOS boxes for its ability to bind LexA by gel shift assays
using labeled double-stranded oligonucleotides spanning the identified
motif and the concentration of LexA determined from the analysis just
described. We could then be confident that the LexA binding, or lack of
it, seen with our test sequences was significant.

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 2.
Comparison of LexA binding to mutated SOS boxes with
their effects on induction in vivo. Double-stranded oligonucleotides
containing each mutated SOS box were end labeled with
[ -32P]dATP; following incubation with 8 nM (final
concentration) purified M. tuberculosis LexA (lanes marked
+) they were assessed for LexA binding by gel shift compared with
no-protein controls (lanes marked ). The induction ratio obtained for
each mutated SOS box when analyzed using a transcriptional fusion of
lacZ to the LexA-regulated recA promoter is
indicated below the gel. The wild-type recA0 SOS box, which had been
shown previously to bind LexA and to regulate gene expression, is shown
in the leftmost pair of tracks. The figure was compiled using Adobe
Photoshop.
|
|
Not surprisingly, LexA bound to all of the sites having no mismatches,
although the binding seen with the ruvA0 site seemed weaker than that
to the recA0 and ruvC0 sites (Fig. 3).
However, while some sites with a single mismatch bound LexA (lexA1a and dnaB1), others did not (lexA1b and recC1). Only one of the sites having
two mismatches was bound by LexA (lexA2b). Intriguingly, one of the two
changes in this site is the same as the single mismatch found in the
recC1 site, which failed to bind. This indicates that bases outside the
currently defined motif are important in determining LexA binding. It
had been shown previously that the recA2 site did not bind LexA even at
a concentration of LexA higher than used here (23), and so
this site was not analyzed again. The sites to which LexA did bind were
also bound by LexA at the lower concentration of 6 nM rather than 8 nM
(data not shown). Thus, the mycobacterial SOS box is not defined well
enough for us to accurately predict whether or not LexA will bind.
Studies are in progress to define the consensus LexA binding site more precisely.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 3.
Analysis of LexA binding to potential SOS boxes.
Double-stranded oligonucleotides containing each identified motif
(indicated below the gel) were end labeled with
[ -32P]dATP; following incubation with 8 nM (final
concentration) purified M. tuberculosis LexA (lanes marked
+) they were assessed for LexA binding by gel shift compared with
no-protein controls (lanes marked ). The recA0 SOS box, which had
been shown previously to bind LexA, was included on each gel as a
positive control. The figure was compiled using Adobe Photoshop.
|
|
It is noteworthy that expression of two of the genes (ssb
and uvrA) which did not appear from the above analysis to
have a LexA binding site was nevertheless induced by DNA damage. To
assess whether there might be a binding site for LexA upstream of these genes which had not been identified by the computer analysis, we
decided to analyze a region spanning at least 500 bp upstream of the
coding region and extending at least 100 bp into it for LexA binding.
This was done by generating PCR products spanning this region which
overlapped by at least 100 bp to ensure that any binding site disrupted
at the end of one fragment would be intact on another. These PCR
products were then analyzed by gel shift assays using the same molar
concentration of fragment and LexA as used before with the
oligonucleotides. A similar-size PCR product containing the recA0 site
was used as a positive control. This analysis (Fig.
4) confirmed that there was no LexA
binding site anywhere within 500 bp upstream of the translation
initiation codon for either ssb or uvrA.

View larger version (74K):
[in this window]
[in a new window]
|
FIG. 4.
Analysis of LexA binding to PCR products spanning at
least 500 bp upstream of the coding region and extending at least 100 bp into it for ssb and uvrA. The top part shows
schematically the locations of the PCR products in relation to the
coding sequence and gives their sizes. Shown below are results of the
assay for LexA binding to these fragments, done as described for Fig.
2. The recA-up fragment was included as a positive control. The figure
was compiled using Adobe Photoshop and Macromedia Freehand.
|
|
The uvrA gene is preceded by an open reading frame which is
transcribed in the opposite direction, and so it clearly is not part of
an operon with expression regulated from a common promoter further
upstream. The ssb gene is separated from the gene
(rpsF) immediately upstream of it by 107 bp, and
rpsF is 222 bp away from the gene preceding it. These
distances suggest that it is unlikely that ssb is a
downstream gene of an operon, although it could possibly be
cotranscribed with rpsF. However, even if ssb was
transcribed from a promoter upstream of rpsF, owing to the
small size of the rpsF gene (287 bp), almost all of the
intergenic region upstream of rpsF (199 of 222 bp) was in
any case included in the analysis of LexA binding just described. It is
to be noted that to confer regulation, LexA must bind in the region of
the promoter and the rpsF promoter is unlikely to be further
than 200 bp upstream of the coding region. Thus, the induction of these genes cannot be explained by transcription from a LexA-regulated promoter preceding an upstream open reading frame; therefore, induction
in these cases must be controlled by a different, non-LexA dependent mechanism.
The ruvCAB genes form an operon in M. tuberculosis.
As stated above, in M. tuberculosis
the ruvC gene as well as ruvA was DNA damage
inducible, in contrast to the situation in E. coli. These
genes are transcribed independently in E. coli, where the
ruvC gene is separated from the ruvAB operon by a
separate open reading frame lying in the opposite direction (29,
30). When we examined the sequences encoding the ruv
genes in M. tuberculosis, we noticed that not only were the
three ruv genes contiguous but also at each junction between
pairs of genes the termination codon of one gene overlapped the
initiation codon of the next (ATGA). This arrangement suggested that
the ruv genes in M. tuberculosis form an operon
and are probably translationally coupled. The flanking genes on either
side of the ruv genes were transcribed in the opposite orientation.
We examined this supposition experimentally by performing RT-PCR using
one primer located within ruvC and one from within ruvB. When RNA isolated from M. tuberculosis was
reverse transcribed, this primer pair did indeed yield a product of the
expected size (Fig. 5), which was the
same size as that formed with chromosomal DNA as template. In contrast,
if the RT step was not included when RNA was the template, no product
was formed, confirming that the PCR product did not arise from
contaminating DNA in the RNA preparation. Thus, in M. tuberculosis the genes ruvCAB are cotranscribed and
form an operon.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 5.
The ruvCAB genes are cotranscribed. The top
part shows schematically the arrangement of the ruv genes in
M. tuberculosis, with the positions of the primers used for
RT-PCR and the size of the expected product indicated. The lower part
shows that the product obtained using RNA which has been reverse
transcribed is the same size as that obtained by PCR using chromosomal
DNA, while no product is formed using RNA if the RT step is omitted.
The figure was compiled using Adobe Photoshop and Macromedia
Freehand.
|
|
 |
DISCUSSION |
In selecting M. tuberculosis genes for this study, we
focused on homologs of well-established members of the SOS regulon in E. coli. These genes perform a range of functions related to
DNA repair and recombination. Thus, the genes that we examined included the regulatory genes recA and lexA, a component
of the Holliday junction resolvase (ruvA), and a component
of the excision repair complex (uvrA). We also investigated
the gene for single-stranded DNA binding protein (ssb), a
recombination gene (recN), and two genes originally
identified solely on the basis of their regulation by LexA
(dinG and dinP). The products of these latter two
genes have subsequently been ascribed functions, with DinG being
identified as a helicase (15) and DinP (also termed DinB)
recently being recognized as a mutagenic DNA polymerase
(34). These eight genes are all part of the SOS regulon in
E. coli. In addition, we chose to analyze another component
of the resolvase (ruvC), although it is not an SOS gene in
E. coli, because we had identified a perfect match to the
M. tuberculosis LexA binding site upstream of this gene.
Finally, we included the replicative helicase gene (dnaB),
which is DNA damage inducible in E. coli but not LexA regulated (14), and a control recombination gene
(recC).
Curiously, there are no sequence homologs in M. tuberculosis
for a number of other E. coli SOS genes with known
functions. These include the UV mutagenesis gene umuD
(although there are homologs of umuC), the gene encoding DNA
polymerase II (polB, formerly dinA), the
integration host factor subunit gene himA, and the
filamentation gene sulA. Nevertheless, while staining cultures of M. tuberculosis treated with DNA-damaging agents
for various periods of time to confirm the purity of the culture, we
noticed that the cells appeared filamentous, particularly following longer periods of exposure. This observation suggests that there may be
an as yet unidentified functional homolog of sulA which is
DNA damage inducible. There may also be genes with little or no
sequence similarity performing the equivalent functions for some of the
other SOS genes. Recently, a number of other LexA-regulated genes have
been identified in E. coli, but their functions remain to be
determined (10).
Of the nine genes which are DNA damage inducible in E. coli,
only six were induced by mitomycin C in M. tuberculosis. In
addition, ruvC was induced by DNA damage in M. tuberculosis although it is not DNA damage inducible in E. coli. This latter observation is linked to the discovery that the
ruvCAB genes are transcribed as an operon in M. tuberculosis, unlike the gene arrangement in E. coli.
The degree of induction seen in M. tuberculosis varied from
approximately 3- to 12-fold. Some of these values can be compared with
induction ratios quoted for the equivalent E. coli genes
although these were determined in a different way: fusions to
-galactosidase were used in a strain lacking functional LexA repressor and related to activity in a strain with wild-type LexA (11). recA was induced 12-fold in M. tuberculosis and 11-fold in E. coli, lexA was induced
9.5- and 6.7-fold, respectively, and uvrA was induced 2.9- and 3.4-fold, respectively. Thus, for the genes which were induced in
M. tuberculosis, the induction ratios were similar to those
found in E. coli. In contrast, dinP was
essentially not induced, with a ratio of 1.3 in M. tuberculosis, compared with 7.3 in E. coli.
The induction ratio for M. tuberculosis recA in this study
is higher than the ratio that we previously reported (23).
This is almost certainly due to the fact that in the previous work the
transcript level was normalized to the amount of rRNA but the induction
conditions caused a significant degree of cell death. It has been shown
that mycobacterial rRNA is very stable and remains present at
relatively high levels even when there is a large reduction in the
number of viable cells (13), and so normalizing to rRNA under conditions where cell death is occurring will lead to an underestimation of the specific transcript level. In the present study
the transcript level of the gene of interest was instead normalized to
an mRNA for a gene whose expression level would not be expected to
change under the conditions being investigated.
It is perhaps noteworthy that M. tuberculosis appears to
lack a homolog of umuD and that the expression of
dinP is not induced by DNA damage. These two genes encode
proteins involved in mutagenesis in E. coli, with UmuD' (the
processed form of UmuD) interacting with UmuC to form the error-prone
DNA polymerase V (31) and dinP encoding another
error-prone polymerase, polymerase IV (34). This relative
lack of mutagenic polymerases suggests that M. tuberculosis must rely exclusively on more accurate repair mechanisms for survival following DNA damage.
A finding of particular interest is the apparent lack of correlation of
LexA binding to the DNA upstream of a gene with induction of its
expression by DNA damage. Excluding ruvA, which is a
downstream gene in an operon, six of the genes examined here were
induced by mitomycin C in M. tuberculosis. Of these six,
four possessed LexA binding sites within 500 bp upstream of the coding
region and two did not. These observations suggest that an alternative, non-LexA-dependent mechanism of gene regulation in response to DNA
damage must exist in M. tuberculosis. While it is possible that LexA could be controlling the expression of an activator which
then acts on genes such as ssb and uvrA, if that
is the case, induction would depend on LexA and RecA. Although the
ssb and uvrA genes have yet to be tested, it has
recently been found using a recA promoter-lacZ
transcriptional fusion that the recA promoter remains
inducible in a recA deletion mutant of M. tuberculosis (E. O. Davis and K. G. Papavinasasundaram,
unpublished data). Thus, even in the case of a gene (recA)
which possesses a LexA binding site, it appears that induction in
response to mitomycin C can occur independently of LexA and RecA. The
data presented here suggest that this alternative mechanism also
operates for other DNA damage-inducible genes. To confirm that this is
indeed the case, it will be necessary to examine the expression of
these genes in the recA deletion mutant of M. tuberculosis following mitomycin C treatment. However, the
methodology presented here for the wild type has the disadvantage that
it permits the analysis of only a limited number of genes in a rather
labor-intensive way. Hence, we plan to use microarrays to examine
global gene expression in response to DNA damage in both the wild-type
and recA deletion strains of M. tuberculosis.
This more universal approach will allow us to determine what proportion
of DNA damage-inducible genes are regulated by RecA and/or LexA and how
generally the alternative mechanism applies.
 |
ACKNOWLEDGMENTS |
We thank M. J. Colston for critical reading of the
manuscript and K. G. Papavinasasundaram for helpful discussions.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Division of
Mycobacterial Research, National Institute for Medical Research, The
Ridgeway, Mill Hill, London NW7 1AA, England. Phone: 44 020 8959 3666. Fax: 44 020 8913 8528. E-mail: edavis{at}nimr.mrc.ac.uk.
Present address: London School of Hygiene and Tropical Medicine,
London WC1E 7HT, England.
 |
REFERENCES |
| 1.
|
Adams, L. B.,
M. C. Dinauer,
D. E. Morgenstern, and J. L. Krahenbuhl.
1997.
Comparison of the roles of reactive oxygen and nitrogen intermediates in the host response to Mycobacterium tuberculosis using transgenic mice.
Tubercle Lung Dis.
78:237-246[CrossRef][Medline].
|
| 2.
|
Akaki, T.,
H. Tomioka,
T. Shimizu,
S. Dekio, and K. Sato.
2000.
Comparative roles of free fatty acids with reactive nitrogen intermediates and reactive oxygen intermediates in expression of the anti-microbial activity of macrophages against Mycobacterium tuberculosis.
Clin. Exp. Immunol.
121:302-310[CrossRef][Medline].
|
| 3.
|
Bertrand-Burggraf, E.,
S. Hurstel,
M. Daune, and M. Schnarr.
1987.
Promoter properties and negative regulation of the uvrA gene by the LexA repressor and its amino-terminal DNA binding domain.
J. Mol. Biol.
193:293-302[CrossRef][Medline].
|
| 4.
|
Brent, R., and M. Ptashne.
1981.
Mechanism of action of the lexA gene product.
Proc. Natl. Acad. Sci. USA
78:4204-4208[Abstract/Free Full Text].
|
| 5.
|
Clemens, D. L., and M. A. Horwitz.
1995.
Characterization of the Mycobacterium tuberculosis phagosome and evidence that phagosomal maturation is inhibited.
J. Exp. Med.
181:257-270[Abstract/Free Full Text].
|
| 6.
|
Cole, S. T.,
R. Brosch,
J. Parkhill,
T. Garnier,
C. Churcher,
D. Harris,
S. V. Gordon,
K. Eiglmeier,
S. Gas,
C. E. Barry III,
F. Tekaia,
K. Badcock,
D. Basham,
D. Brown,
T. Chillingworth,
R. Connor,
R. Davies,
K. Devlin,
T. Feltwell,
S. Gentles,
N. Hamlin,
S. Holroyd,
T. Hornsby,
K. Jagels,
B. G. Barrell, et al.
1998.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
Nature
393:537-544[CrossRef][Medline].
|
| 7.
|
Davis, E. O.,
S. G. Sedgwick, and M. J. Colston.
1991.
Novel structure of the recA locus of Mycobacterium tuberculosis implies processing of the gene product.
J. Bacteriol.
173:5653-5662[Abstract/Free Full Text].
|
| 8.
|
Devereux, J.,
P. Haeberli, and O. Smithies.
1984.
A comprehensive set of sequence analysis programs for the VAX.
Nucleic Acids Res.
12:387-395.
|
| 9.
|
Durbach, S. I.,
S. J. Andersen, and V. Mizrahi.
1997.
SOS induction in mycobacteria: analysis of the DNA-binding activity of a LexA-like repressor and its role in DNA damage induction of the recA gene from Mycobacterium smegmatis.
Mol. Microbiol.
26:643-653[CrossRef][Medline].
|
| 10.
|
Fernandez de Henestrosa, A. R.,
T. Ogi,
S. Aoyagi,
D. Chafin,
J. J. Hayes,
H. Ohmori, and R. Woodgate.
2000.
Identification of additional genes belonging to the LexA regulon in Escherichia coli.
Mol. Microbiol.
35:1560-1572[CrossRef][Medline].
|
| 11.
|
Friedberg, E.,
G. Walker, and W. Siede.
1995.
DNA repair and mutagenesis.
American Society for Microbiology Press, Washington, D.C.
|
| 12.
|
Hasan, Z.,
C. Schlax,
L. Kuhn,
I. Lefkovits,
D. Young,
J. Thole, and J. Pieters.
1997.
Isolation and characterization of the mycobacterial phagosome: segregation from the endosomal/lysosomal pathway.
Mol. Microbiol.
24:545-553[CrossRef][Medline].
|
| 13.
|
Hellyer, T. J.,
L. E. DesJardin,
G. L. Hehman,
M. D. Cave, and K. D. Eisenach.
1999.
Quantitative analysis of mRNA as a marker for viability of Mycobacterium tuberculosis.
J. Clin. Microbiol.
37:290-295[Abstract/Free Full Text].
|
| 14.
|
Kleinsteuber, S., and A. Quinones.
1995.
Expression of the dnaB gene of Escherichia coli is inducible by replication-blocking DNA damage in a recA-independent manner.
Mol. Gen. Genet.
248:695-702[CrossRef][Medline].
|
| 15.
|
Koonin, E. V.
1993.
Escherichia coli dinG gene encodes a putative DNA helicase related to a group of eukaryotic helicases including Rad3 protein.
Nucleic Acids Res.
21:1497[Free Full Text].
|
| 16.
|
Little, J. W.
1991.
Mechanism of specific LexA cleavage: autodigestion and the role of RecA coprotease.
Biochimie
73:411-421[Medline].
|
| 17.
|
Little, J. W., and D. W. Mount.
1982.
The SOS regulatory system of Escherichia coli.
Cell
29:11-22[CrossRef][Medline].
|
| 18.
|
Little, J. W.,
D. W. Mount, and C. R. Yanisch-Perron.
1981.
Purified lexA protein is a repressor of the recA and lexA genes.
Proc. Natl. Acad. Sci. USA
78:4199-4203[Abstract/Free Full Text].
|
| 19.
|
Loewen, P. C., and R. Hengge-Aronis.
1994.
The role of the sigma factor sigma S (KatF) in bacterial global regulation.
Annu. Rev. Microbiol.
48:53-80[Medline].
|
| 20.
|
Manganelli, R.,
E. Dubnau,
S. Tyagi,
F. R. Kramer, and I. Smith.
1999.
Differential expression of 10 sigma factor genes in Mycobacterium tuberculosis.
Mol. Microbiol.
31:715-724[CrossRef][Medline].
|
| 21.
|
Mizrahi, V., and S. J. Andersen.
1998.
DNA repair in Mycobacterium tuberculosis. What have we learnt from the genome sequence?
Mol. Microbiol.
29:1331-1339[CrossRef][Medline].
|
| 22.
|
Movahedzadeh, F.,
M. J. Colston, and E. O. Davis.
1997.
Characterization of Mycobacterium tuberculosis LexA: recognition of a Cheo (Bacillus-type SOS) box.
Microbiology
143:929-936[Abstract].
|
| 23.
|
Movahedzadeh, F.,
M. J. Colston, and E. O. Davis.
1997.
Determination of DNA sequences required for regulated Mycobacterium tuberculosis RecA expression in response to DNA-damaging agents suggests that two modes of regulation exist.
J. Bacteriol.
179:3509-3518[Abstract/Free Full Text].
|
| 24.
|
Papavinasasundaram, K. G.,
F. Movahedzadeh,
J. T. Keer,
N. G. Stoker,
M. J. Colston, and E. O. Davis.
1997.
Mycobacterial recA is cotranscribed with a potential regulatory gene called recX.
Mol. Microbiol.
24:141-153[CrossRef][Medline].
|
| 25.
|
Rich, E. A.,
M. Torres,
E. Sada,
C. K. Finegan,
B. D. Hamilton, and Z. Toossi.
1997.
Mycobacterium tuberculosis (MTB)-stimulated production of nitric oxide by human alveolar macrophages and relationship of nitric oxide production to growth inhibition of MTB.
Tubercle Lung Dis.
78:247-255[CrossRef][Medline].
|
| 26.
|
Sambrook, J.,
E. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 27.
|
Sassanfar, M., and J. W. Roberts.
1990.
Nature of the SOS-inducing signal in Escherichia coli. The involvement of DNA replication.
J. Mol. Biol.
212:79-96[CrossRef][Medline].
|
| 28.
|
Schnarr, M.,
P. Oertel-Buchheit,
M. Kazmaier, and M. Granger-Schnarr.
1991.
DNA binding properties of the LexA repressor.
Biochimie
73:423-431[Medline].
|
| 29.
|
Sharples, G. J., and R. G. Lloyd.
1991.
Resolution of Holliday junctions in Escherichia coli: identification of the ruvC gene product as a 19-kilodalton protein.
J. Bacteriol.
173:7711-7715[Abstract/Free Full Text].
|
| 30.
|
Takahagi, M.,
H. Iwasaki,
A. Nakata, and H. Shinagawa.
1991.
Molecular analysis of the Escherichia coli ruvC gene, which encodes a Holliday junction-specific endonuclease.
J. Bacteriol.
173:5747-5753[Abstract/Free Full Text].
|
| 31.
|
Tang, M.,
X. Shen,
E. G. Frank,
M. O'Donnell,
R. Woodgate, and M. F. Goodman.
1999.
UmuD'2C is an error-prone DNA polymerase, Escherichia coli pol V.
Proc. Natl. Acad. Sci. USA
96:8919-8924[Abstract/Free Full Text].
|
| 32.
|
Via, L. E.,
D. Deretic,
R. J. Ulmer,
N. S. Hibler,
L. A. Huber, and V. Deretic.
1997.
Arrest of mycobacterial phagosome maturation is caused by a block in vesicle fusion between stages controlled by rab5 and rab7.
J. Biol. Chem.
272:13326-13331[Abstract/Free Full Text].
|
| 33.
|
Villarroya, M.,
I. Perez-Roger,
F. Macian, and M. E. Armengod.
1998.
Stationary phase induction of dnaN and recF, two genes of Escherichia coli involved in DNA replication and repair.
EMBO J.
17:1829-1837[CrossRef][Medline].
|
| 34.
|
Wagner, J.,
P. Gruz,
S. R. Kim,
M. Yamada,
K. Matsui,
R. P. Fuchs, and T. Nohmi.
1999.
The dinB gene encodes a novel E. coli DNA polymerase, DNA pol IV, involved in mutagenesis.
Mol. Cell
4:281-286[CrossRef][Medline].
|
Journal of Bacteriology, August 2001, p. 4459-4467, Vol. 183, No. 15
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.15.4459-4467.2001
This article has been cited by other articles:
-
O'Sullivan, D. M., Hinds, J., Butcher, P. D., Gillespie, S. H., McHugh, T. D.
(2008). Mycobacterium tuberculosis DNA repair in response to subinhibitory concentrations of ciprofloxacin. J Antimicrob Chemother
0: dkn387v1-4
[Abstract]
[Full Text]
-
Lee, J.-H., Geiman, D. E., Bishai, W. R.
(2008). Role of Stress Response Sigma Factor SigG in Mycobacterium tuberculosis. J. Bacteriol.
190: 1128-1133
[Abstract]
[Full Text]
-
Roback, P., Beard, J., Baumann, D., Gille, C., Henry, K., Krohn, S., Wiste, H., Voskuil, M.I., Rainville, C., Rutherford, R.
(2007). A predicted operon map for Mycobacterium tuberculosis. Nucleic Acids Res
35: 5085-5095
[Abstract]
[Full Text]
-
Cirz, R. T., O'Neill, B. M., Hammond, J. A., Head, S. R., Romesberg, F. E.
(2006). Defining the Pseudomonas aeruginosa SOS Response and Its Role in the Global Response to the Antibiotic Ciprofloxacin.. J. Bacteriol.
188: 7101-7110
[Abstract]
[Full Text]
-
Brooks, P. C., Dawson, L. F., Rand, L., Davis, E. O.
(2006). The Mycobacterium-Specific Gene Rv2719c Is DNA Damage Inducible Independently of RecA.. J. Bacteriol.
188: 6034-6038
[Abstract]
[Full Text]
-
Hare, J. M., Perkins, S. N., Gregg-Jolly, L. A.
(2006). A Constitutively Expressed, Truncated umuDC Operon Regulates the recA-Dependent DNA Damage Induction of a Gene in Acinetobacter baylyi Strain ADP1.. Appl. Environ. Microbiol.
72: 4036-4043
[Abstract]
[Full Text]
-
Mazon, G., Campoy, S., Erill, I., Barbe, J.
(2006). Identification of the Acidobacterium capsulatum LexA box reveals a lateral acquisition of the Alphaproteobacteria lexA gene.. Microbiology
152: 1109-1118
[Abstract]
[Full Text]
-
Yellaboina, S., Seshadri, J., Kumar, M. S., Ranjan, A.
(2004). PredictRegulon: a web server for the prediction of the regulatory protein binding sites and operons in prokaryote genomes. Nucleic Acids Res
32: W318-W320
[Abstract]
[Full Text]
-
Fernandez de Henestrosa, A. R., Cune, J., Mazon, G., Dubbels, B. L., Bazylinski, D. A., Barbe, J.
(2003). Characterization of a New LexA Binding Motif in the Marine Magnetotactic Bacterium Strain MC-1. J. Bacteriol.
185: 4471-4482
[Abstract]
[Full Text]
-
Fernandez de Henestrosa, A. R., Cune, J., Erill, I., Magnuson, J. K., Barbe, J.
(2002). A Green Nonsulfur Bacterium, Dehalococcoides ethenogenes, with the LexA Binding Sequence Found in Gram-Positive Organisms. J. Bacteriol.
184: 6073-6080
[Abstract]
[Full Text]
-
Campoy, S., Mazon, G., Fernandez de Henestrosa, A. R., Llagostera, M., Monteiro, P. B., Barbe, J.
(2002). A new regulatory DNA motif of the gamma subclass Proteobacteria: identification of the LexA protein binding site of the plant pathogen Xylella fastidiosa. Microbiology
148: 3583-3597
[Abstract]
[Full Text]
-
Dullaghan, E. M., Brooks, P. C., Davis, E. O.
(2002). The role of multiple SOS boxes upstream of the Mycobacterium tuberculosis lexA gene - identification of a novel DNA-damage-inducible gene. Microbiology
148: 3609-3615
[Abstract]
[Full Text]
-
Davis, E. O., Dullaghan, E. M., Rand, L.
(2002). Definition of the Mycobacterial SOS Box and Use To Identify LexA-Regulated Genes in Mycobacterium tuberculosis. J. Bacteriol.
184: 3287-3295
[Abstract]
[Full Text]