Previous Article | Next Article 
Journal of Bacteriology, August 2001, p. 4609-4613, Vol. 183, No. 15
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.15.4609-4613.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Regulation of Staphylococcus aureus Type
5 and Type 8 Capsular Polysaccharides by CO2
Silvia
Herbert,1
Steven W.
Newell,2,
Chia
Lee,2
Karsten-Peter
Wieland,3
Bruno
Dassy,4
Jean-Michel
Fournier,4
Christiane
Wolz,1 and
Gerd
Döring1,*
Department of General and Environmental
Hygiene, Hygiene-Institute,1 and
Institute of Microbial Genetics,3
University of Tübingen, Tübingen, Germany;
Department of Microbiology, Molecular Genetics and
Immunology, University of Kansas Medical Center, Kansas City,
Kansas2; and Unité du
Choléra et des Vibrions, Institut Pasteur, Paris,
France4
Received 12 November 2000/Accepted 18 April 2001
 |
ABSTRACT |
Staphylococcus aureus expression of capsular
polysaccharide type 5 (CP5) has been shown to be downregulated by
CO2. Here we show that CO2 reduces CP5
expression at the transcriptional level and that CO2
regulates CP8 expression depending on the genetic background of the
strains. Growth in the presence of air supplemented with 5%
CO2 caused a significant decrease in CP8 expression in four
S. aureus strains, a marginal effect in four strains, and higher CP8 expression in strain Becker. Absolute CP8 expression in the
nine S. aureus strains differed largely from strain to strain. Four groups of strains were established due to sequence variations in the promoter region of cap5 and
cap8. To test whether these sequence variations are
responsible for the different responses to CO2, promoter
regions from selected strains were fused to the reporter gene
xylE in pLC4, and the plasmids were electrotransformed into
strains Becker and Newman. XylE activity was negatively regulated by
CO2 in all derivatives of strain Newman and was always
positively regulated by CO2 in all derivatives of strain
Becker. Differences in promoter sequences did not influence the pattern
of CP8 expression. Therefore, the genetic background of the strains
rather than differences in the promoter sequence determines the
CO2 response. trans-acting regulatory molecules
may be differentially expressed in strain Becker versus strain Newman.
The strain dependency of the CP8 expression established in vitro was
also seen in lung tissue sections of patients with cystic fibrosis
infected with CP8-positive S. aureus strains.
 |
INTRODUCTION |
Staphylococcus aureus is
a pathogen which causes a number of serious human diseases, such as
endocarditis, osteomyelitis, skin abcesses, and chronic endobronchial
infections in patients with cystic fibrosis (CF) (15, 20).
Several extracellular and cell surface-bound components act as
virulence factors in S. aureus, including capsular
polysaccharides (CPs) (23, 30). Although S. aureus strains can produce 11 serologically distinct CPs
(16, 29), the majority of clinical isolates of this
pathogen have been described as CP5 or CP8 positive (1, 3, 4, 14). Previously, however, we showed that S. aureus
strains producing CP5 (12) or CP8 (22) in
vitro lack these polysaccharides when directly examined by
immunofluorescence microscopy of thin airway sections from CF patients.
CP5 was reexpressed when the isolates were grown under normal air
conditions, whereas the addition of 1% CO2 rendered the
strains CP5 negative. Since the mean value of the inspiratory and
expiratory CO2 in the bronchioli is about 4%
(11), CP5 expression in vivo may be inhibited due to the elevated pCO2 compared to the pCO2 in normal
air (0.03%). In contrast to the negative effect of CO2 on
CP5 expression, it was previously shown that
- and
-hemolysin
expression, as well as expression of S. aureus toxic shock
syndrome toxin 1 (17), is increased in the presence of
elevated CO2 concentrations (6, 7, 24).
CO2 also regulates the expression of surface components in
other bacteria. For example, the expression of the fibrillar surface M
protein of Streptococcus pyogenes (5) and the
capsule of Bacillus anthracis (18, 21) is
increased in the presence of elevated CO2 concentrations.
Additionally, capsule synthesis in Cryptococcus neoformans
is positively regulated by CO2 (10). In
contrast, the production of slime by Staphylococcus
epidermidis is decreased when the bacteria are incubated with 5%
CO2 (8, 25). These observations show that
CO2 is an important environmental signal for many bacteria
and appears to be involved in regulating virulence factors in more than
one manner.
The molecular basis for the regulation of S. aureus CP5 by
CO2 is still unresolved. We wanted to clarify our
observations at a transcriptional level and to extend our previous
observations to CP8-expressing S. aureus strains. The
CP5-producing strains S. aureus Reynolds and Newman, the
CP8-positive strain Becker, and several clinical S. aureus
isolates from CF patients were used.
 |
MATERIALS AND METHODS |
Sequencing of cap promoter.
The cap5
and -8 promoter regions from 11 S. aureus strains
were amplified by PCR (Advantage kit; Clontech) using two primers, GAATTCGGTCAATCAGTCGGAATT (EcoRI site
is underlined) and AAGCTTCAAGTTTTTTTGTAATA (HindIII site is underlined). The amplified
fragments correspond to
512 to +71 of the published cap8
sequence of strain Becker, with +1 being the transcriptional start
(27, 28). The PCR-amplified DNA fragments were cloned into
the pGEM-T vector (Promega) and sequenced. To avoid possible errors
generated by PCR, two independent PCR amplifications from each strain
were performed. No mismatch was found between the two independent PCR
amplifications from each strain. Sequences from all 11 strains are 583 bp in length, except that from strain Becker, which had a 1-bp
deletion. The sequences were then compared by the Clustal method
(13) of the MegAlign program (Dnastar Inc.).
cap promoter fusion.
The lipase-negative
S. aureus strain Reynolds was supplemented with the promoter
test plasmid pPS11cap5 containing a 424-bp fragment of the
cap5 promoter fused to the lipase gene of
Staphylococcus hyicus. A cap5 promoter fragment
(424 bp) was generated by PCR using DNA from S. aureus
strain Reynolds. The cap8 primer pairs (upper primer,
TTTGGATCCAACTAATCCTAAAGAAGCACTAA; lower primer, CTCCATTTATAACCTTTCATGAACCTAGGTTT)
were selected to span nucleotides 32 to 456 of the published
sequence (27), with artificial BamHI cleavage
sites (underlined) at the 5' ends. The cap8 primer pairs
were selected for the cap5 promoter PCR due to the
availability of only the cap8 sequence data at that time and
the expected high homology between the cap5 and
cap8 sequences (27). Additionally, the
cap start codon (in bold) was changed in the lower primer. The PCR fragment was digested with BamHI and ligated into
the BamHI site of pPS11 (31) containing a
promoterless lipase gene (lip) of S. hyicus and a
chloramphenicol resistance gene. The ligation mixture was used for
protoplast transformation into Staphylococcus carnosus
(9). Single, chloramphenicol-resistant colonies were grown
on lipase test plates (Tributyrin agar base supplemented with 1% Tween
20; Merck, Darmstadt, Germany). Insertion of the cap5
promoter region in pPS11cap5 was confirmed by sequencing (LI-COR, model 40002; WG-Biotech, Ebersberg, Germany). The plasmid pPS11cap5 was electrotransformed into S. aureus
strain Reynolds as previously described (2). Thus, strain
Reynolds contains, besides the natural chromosomal cap5
promoter, additional multicopy promoters on the extrachromosomal
plasmid. For the measurement of the CP5 promoter activity, strain
Reynolds containing pPS11cap5 was grown to an optical
density at 600 nm (OD600) of 7.4 in air and in air
supplemented with 5% CO2, and lipase activity in the culture supernatant fluid was determined as previously described (31).
The promoter regions from strains CF1, CF4, CF6, CF12, and Becker were
fused to the promoterless reporter gene xylE in pLC4 (26), which resulted in plasmids pCL8388, -8389, -8390, -8396, and -8420, respectively. The cap promoter fragments
were obtained by PCR (for primers, see above). The resultant plasmids
were electrotransformed into strains Becker (a type 8 capsule strain)
and Newman (a type 5 capsule strain) and were incubated in
Luria-Bertani broth for 18 h at 37°C with air or air
supplemented with 5% CO2. The XylE activities were assayed
to measure the promoter activities (32).
ELISA for detection of CP8.
Bacterial cells were diluted
from an overnight culture to an OD600 of 0.05 in 30 ml of
tryptic soy broth (Oxoid, Hampshire, United Kingdom). The bacteria were
incubated with shaking at 37°C under air or air with 5%
CO2 (Aerotron incubator; Infors, Einsbach, Germany) for
16 h. CP8 expression of clinical isolates of S. aureus was assessed by a two-step inhibition enzyme-linked immunosorbent assay
(ELISA) (3). Microtiter wells were coated with 5% gelatin in phosphate-buffered saline (PBS) at 37°C for 1 h. After
washing with PBS-Tween 20, the wells were incubated with 100-µl
volumes of washed S. aureus cells and 100 µl of an
anti-CP8 monoclonal immunoglobulin G3 (IgG3) antibody diluted in
PBS-Tween supplemented with 0.5% gelatin at a concentration giving an
OD492 of 0.2 to 0.5, which was determined by preliminary
titration. For CP8 antibody production, BALB/c mice were immunized with
5 × 107 cells of S. aureus strain Becker
as previously described (3). After incubation at 37°C
for 1 h and then overnight at 4°C, 100-µl samples from each
well were transferred to another plate which had previously been coated
with purified CP8 and blocked with gelatin. This plate was incubated at
37°C for 1 h, and after washing with PBS-Tween, an anti-mouse
peroxidase-conjugated IgG (Diagnostics Pasteur) was added to the wells
and the plate was incubated at 37°C for 45 min. After washing, enzyme
substrate (o-phenylenediamine dihydrochloride; Dako,
Copenhagen, Denmark) was added, and after 10 min at room temperature,
the reaction was stopped and the OD492 was read. For each
ELISA run, negative controls were used (wells not receiving test
samples but receiving PBS-Tween supplemented with 0.5% gelatin) and
titration of purified CP8 was performed to determine the assay
sensitivity. The amount of CP8 in the samples was determined from
standard titration curves of purified CP8 and expressed in nanograms
per milliliter. The lower limit of the assay is 1 ng of CP8/ml.
Detection of CP8 and teichoic acid by immunofluorescence.
CP8 production was assessed by indirect immunofluorescence using
monoclonal antibodies (IgG3; Institut Pasteur, Paris, France) and
fluorescein isothiocyanate (FITC)-conjugated IgG rabbit antibodies against mouse IgG (Dako). Cryostat thin sections (5 to 10 µm) were
prepared (Kryostat 2800 Frigocut E; Reichert-Jung, Heidelberg, Germany)
from shock-frozen lung tissue material from two CF patients. The thin
sections were fixed on slides with acetone for 10 min, incubated for 20 min with normal rabbit serum (Dako) diluted 1:5, and incubated with
anti-CP8 antibody (final dilution, 33 µg/ml) for 1 h at room
temperature. After washing, slides were incubated with FITC-conjugated
antibodies and diluted 1:40 for 30 min at room temperature. After
washing, slides were mounted with Permafluor (Dako) for 24 h and
visualized using a fluorescence microscope (Axioplan; Zeiss,
Oberkochen, Germany). Teichoic acid expression on S. aureus
strains was determined using a rabbit antiserum. Slides were
preincubated with swine antiserum and diluted 1:5, and a
FITC-conjugated swine antibody against rabbit IgG, diluted 1:40, was
used (Dako). The rabbit serum against teichoic acid (SL-39) was
prepared by immunizing the animals with a killed S. aureus
strain completely lacking CP5 and CP8. The serum did not contain
antibodies against CP5 or CP8 as demonstrated by ELISA.
 |
RESULTS AND DISCUSSION |
Regulation of CP5 by CO2.
Previously, we have
shown that the CP5 expression of strain Reynolds is inhibited by the
growth of S. aureus strains in air supplemented with 5%
CO2. This was further confirmed using two other CP5 strains
(CF1 and Newman) which both showed a significant decrease of capsular
material on the surface after growth with 5% CO2 (Table
1). To analyze whether this is mediated
by downregulation of the promoter activity, we cloned the
cap5 promoter in front of the lipase gene and compared the
lipase activity in strain Reynolds(pPS11cap5). After growth
in the presence of air supplemented with 5% CO2, the
lipase activity was 60% lower compared to that for growth under normal
air conditions (P < 0.001; Mann-Whitney test)
(Fig. 1). Thus, CO2 affects
cap5 gene expression at the transcriptional level. The ratio
obtained from the promoter fusion is lower than those previously
obtained by ELISA, possibly due to the presence of the cap5
promoter in multiple copies in the promoter test assay.

View larger version (7K):
[in this window]
[in a new window]
|
FIG. 1.
Downregulation of the cap5 promoter under air
plus 5% CO2 growth conditions. The lipase-negative
S. aureus strain Reynolds was supplemented with the promoter
test plasmid pPS11cap5 containing a 424-bp fragment of the
cap5 promoter fused to the lipase gene of S. hyicus. For details, see Materials and Methods.
|
|
Regulation of CP8 by CO2.
Next, we wanted to know
whether CP8 is influenced in the same manner by CO2. In
contrast to CP5, quantitative detection of the CP8 antigen by ELISA on
type 8 bacterial cells gave conflicting results with respect to
CO2 regulation when several strains were tested (Table 1).
In only four of nine CP8-positive S. aureus strains examined
(CF4, CF6, CF11, and CF12), a significant decrease in CP8 expression
was found when CP8-positive S. aureus strains were grown in
the presence of air supplemented with 5% CO2 compared to
cells grown under normal air conditions. In other strains, the effect
of CO2 was less pronounced, and in one case, the type 8 prototypic strain Becker, CP8 expression was higher under supplemented CO2 growth conditions. The results also show that absolute
CP8 expression in S. aureus strains as well as the
regulatory CO2 effect may vary considerably from one strain
to another. For example, strain CF7 produces about 1 order of magnitude
more CP8 than strain CF4 does. The reason for these effects may be
related to sequence variations in the promoter region of cap
or in other genes which mediate cap transcription.
cap promoter sequence.
To analyze whether
differences in the promoter region account for differences in the
CO2 effect, the upstream sequences of eight CP8 strains and
two CP5 strains (CF1 and Reynolds) were sequenced. As shown in Fig.
2, most of the mismatches were found between nucleotides
231 and
89. Based on the sequence comparison, the strains can be grouped into the following four groups: group 1, Reynolds, CF1 (type 5 strain), and CF11, with identical sequences; group 2, CF4, CF8, CF9, CF10, and CF12, with identical sequences except
CF12 has one mismatch; group 3, CF6 and CF7, with three mismatches; and
group 4, Becker (Fig. 2). Interestingly, the promoter sequence of one
CP8 strain (CF11) was identical to the sequence derived from the CP5
strains Reynolds and CF1 but different from that of the other CP8
strains.

View larger version (80K):
[in this window]
[in a new window]
|
FIG. 2.
DNA sequence alignment of the cap5 and
-8 promoter regions from various S. aureus
strains. A region of 583 bp from each strain was compared, but only
sequences corresponding to positions 56 to 455 (indicated by
arrowheads) with respect to the transcriptional start site of the
cap8 sequence of strain Becker are shown. Mismatched
sequences are boxed. We found no mismatches between strains in the
sequences that were not shown. Note that CF1 and strain Reynolds are
type 5 strains.
|
|
Activity of different cap promoters in strains Newman
and Becker.
To test whether differences in the cap
upstream sequences are responsible for the different responses to
CO2, we fused each of the promoter regions from strains
CF1, CF4, CF6, CF12, and Becker to the promoterless reporter gene
xylE, which resulted in plasmids pCL8388, -8389, -8390, -8396, and -8420, respectively. These strains were selected as
representatives of the four groups defined by sequencing. Strain Becker
(a type 8 capsule strain) and strain Newman (a type 5 capsule strain)
containing the cap promoter fusion plasmids were incubated
with air or air supplemented with 5% CO2, and the XylE
activities were measured (Table 2). Interestingly, XylE activity was negatively regulated by
CO2 in all derivatives of strain Newman containing the
various promoter sequences in front of xylE. In contrast,
with strain Becker as the genetic background, XylE activity was always
positively correlated with CO2 pressure. The difference in
the promoter sequences used in the different constructs did not
influence the pattern of CO2 regulation. For instance, the
promoter fusions derived from strain Becker resulted in enhanced XylE
activity in strain Becker(pSN8420) but in decreased activity in strain
Newman(pSN8420) after growth of the strains with 5% CO2.
Therefore, the genetic background of the strains rather than
differences in the promoter sequence determines the CO2
response. trans-acting regulatory molecules such as
transcriptional activators or sigma factors may be differentially expressed in strain Becker versus strain Newman.
CP8 expression in lung tissue sections of CF patients.
Previously, we postulated that elevated CO2 during lung
infections in patients with CF may account for the downregulation of
CP5 during infection (12). Since CP8 expression is only
marginally affected (CF7, CF8, CF9, and CF10) or even enhanced (strain
Becker) by CO2, it may be assumed that CP8-producing
S. aureus strains are CP8 positive during infection. Indeed,
CP8-positive S. aureus has been detected in experimental
endocarditis (19) and in our own investigations
(1). Here we demonstrate that the strain dependency of CP8
expression established by in vitro tests is also seen in lung tissue
sections of CF patients infected with CP8-positive S. aureus
strains. As shown in Fig. 3, strain CF7, which was only marginally affected by CO2 in regards to
CP8, also expressed CP8 in vitro in the airway lumen of the patient. In contrast, strain CF12, which had significantly reduced CP8 expression by CO2 in vitro (Table 1) did not express CP8 in vivo. In
summary, the regulation of CP8 seems to be more complex than that of
CP5 in S. aureus.

View larger version (94K):
[in this window]
[in a new window]
|
FIG. 3.
Expression of S. aureus CP8 in lung tissue
sections of two CF patients. Lung tissue sections filled with
inflammatory plaques from CF patients 7 (A and C) and 12 (B and D)
infected with S. aureus strains CF7 and CF12, respectively,
were stained with a monoclonal antibody against CP8 (A and B) and a
polyclonal rabbit antibody against teichoic acid (C and D) followed by
FITC-conjugated anti-mouse (A and B) and anti-rabbit (C and D)
antibodies. Note the absence of CP8 in panel B and the presence of CP8
in panel D. Magnification, ×1,000; bars = 10 µm.
|
|
 |
ACKNOWLEDGMENTS |
We thank S. Crampton for language corrections.
The study was supported in part by a grant to S.H. from the Deutsche
Forschungsgemeinschaft (Graduiertenkolleg Mikrobiologie, University of
Tübingen) and by grant AI37027 to C.L. by NIH.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
General and Environmental Hygiene, Hygiene-Institute, University of
Tübingen, Wilhelmstrasße 31, D-72074 Tübingen, Germany.
Phone: 49-7071-2982069. Fax: 49-7071-2983011. E-mail:
gerd.doering{at}uni-tuebingen.de.
Present address: Naval Medical Center, San Diego, CA 92134.
 |
REFERENCES |
| 1.
|
Albus, A.,
J.-M. Fournier,
C. Wolz,
A. Boutonnier,
M. Ranke,
N. Høiby,
H. Hochkeppel, and G. Döring.
1988.
Staphylococcus aureus capsular types and antibody response to lung infection in patients with cystic fibrosis.
J. Clin. Microbiol.
26:2505-2509[Abstract/Free Full Text].
|
| 2.
|
Augustin, J., and F. Götz.
1990.
Transformation of Staphylococcus epidermidis and other staphylococcal species with plasmid DNA by electroporation.
FEMS Microbiol. Lett.
66:203-208[CrossRef].
|
| 3.
|
Boutonnier, A.,
F. Nato,
A. Bouvet,
L. Lebrun,
A. Audurier,
J. C. Mazié, and J.-M. Fournier.
1989.
Direct testing of blood cultures for detection of the serotype 5 and 8 capsular polysaccharides of Staphylococcus aureus.
J. Clin. Microbiol.
27:989-993[Abstract/Free Full Text].
|
| 4.
|
Branger, C.,
J.-M. Fournier,
J. Loulergue,
A. Bouvet,
P. Goullet,
A. Boutonnier,
C. De Gialluly,
G. Couetdic,
M. Chomarat,
M. C. Jaffar-Banjee, and P. Mariani.
1994.
Epidemiology of Staphylococcus aureus in patients with cystic fibrosis.
Epidemiol. Infect.
112:489-500[Medline].
|
| 5.
|
Caperon, M. G.,
R. T. Geist,
J. Perez-Casal, and J. R. Scott.
1992.
Environmental regulation of virulence in group A streptococci: transcription of the gene encoding M protein is stimulated by carbon dioxide.
J. Bacteriol.
174:5693-5701[Abstract/Free Full Text].
|
| 6.
|
Carlson, E. C.
1986.
A CO2-enhanced hemolytic activity of Staphylococcus aureus associated with toxic shock syndrome: inhibition by agar.
J. Infect. Dis.
154:18618-18628.
|
| 7.
|
Chow, A. W.,
M. J. Gribble, and K. H. Bartlett.
1983.
Characterization of the hemolytic activity of Staphylococcus aureus strains associated with toxic shock syndrome.
J. Clin. Microbiol.
17:524-528[Abstract/Free Full Text].
|
| 8.
|
Denyer, S. P.,
M. C. Davies,
J. A. Evans,
R. G. Finch,
D. G. E. Smith,
M. H. Wilcox, and P. Williams.
1990.
Influence of carbon dioxide on the surface characteristics and adherence potential of coagulase-negative staphylococci.
J. Clin. Microbiol.
28:1813-1817[Abstract/Free Full Text].
|
| 9.
|
Götz, F., and B. Schumacher.
1987.
Improvements of protoplast transformation in Staphylococcus carnosus.
FEMS Microbiol. Lett.
40:285-288[CrossRef].
|
| 10.
|
Granger, D. L.,
J. R. Perfect, and D. T. Durack.
1985.
Virulence of Cryptococcus neoformans. Regulation of capsule synthesis by carbon dioxide.
J. Clin. Investig.
76:508-516.
|
| 11.
|
Guyton, A. C.
1991.
Textbook of medical physiology, eighth ed, p. 433-443.
W. B. Saunders, Philadelphia, Pa.
|
| 12.
|
Herbert, S.,
D. Worlitzsch,
B. Dassy,
A. Boutonnier,
J.-M. Fournier,
G. Bellon,
A. Dalhoff, and G. Döring.
1997.
Regulation of Staphylococcus aureus capsular polysaccharide type 5: CO2 inhibition in vitro and in vivo.
J. Infect. Dis.
176:431-438[Medline].
|
| 13.
|
Higgins, D. G., and P. M. Sharp.
1988.
CLUSTAL: a package for performing multiple sequence alignments on a microcomputer.
Gene
73:237-244[CrossRef][Medline].
|
| 14.
|
Hochkeppel, H. K.,
D. G. Braun,
W. Vischer,
A. Imm,
S. Sutter,
U. Staubli,
R. Guggenheim,
E. L. Kaplan,
A. Boutonnier, and J.-M. Fournier.
1987.
Serotyping and electron microscopy studies of Staphylococcus aureus clinical isolates with monoclonal antibodies to capsular polysaccharide types 5 and 8.
J. Clin. Microbiol.
25:526-530[Abstract/Free Full Text].
|
| 15.
|
Høiby, N.
1994.
Microbiology of cystic fibrosis, p. 75-98.
In
M. E. Hodson, and D. M. Geddes (ed.), Cystic fibrosis. Chapman and Hall, London, United Kingdom.
|
| 16.
|
Karakawa, W. W., and W. F. Vann.
1982.
Capsular polysaccharides of S. aureus.
Semin. Infect. Dis.
4:285-293.
|
| 17.
|
Kass, E. H.,
M. I. Kendrick,
Y.-C. Tsai, and J. Parsonnet.
1987.
Interaction of magnesium ion, oxygen tension, and temperature in the production of toxic-shock-syndrome toxin-1 by Staphylococcus aureus.
J. Infect. Dis.
155:812-814[Medline].
|
| 18.
|
Koehler, T. M.,
Z. Dai, and M. Kaufman-Yarbray.
1984.
Regulation of the Bacillus anthracis protective antigen gene: CO2 and a trans-acting element activate transcription from one of two promoters.
J. Bacteriol.
176:586-595[Abstract/Free Full Text].
|
| 19.
|
Lee, J. C.,
S. Takeda,
P. J. Livolsi, and L. C. Paoletti.
1993.
Effects of in vitro and in vivo growth conditions on expression of type 8 capsular polysaccharide by Staphylococcus aureus.
Infect. Immun.
61:1853-1858[Abstract/Free Full Text].
|
| 20.
|
Lowy, F. D.
1998.
Staphylococcus aureus infections.
N. Engl. J. Med.
339:520-532[Free Full Text].
|
| 21.
|
Makino, S.,
C. Sasakawa,
I. Uchida,
N. Terakado, and M. Yoshikawa.
1988.
Cloning and CO2-dependent expression of the genetic region for encapsulation from Bacillus anthracis.
Mol. Microbiol.
2:371-376[Medline].
|
| 22.
|
McKenney, D.,
K. L. Tibbetts,
Y. Wang,
V. Murthy,
M. Ulrich,
G. Döring,
J. C. Lee,
D. A. Goldmann, and G. B. Pier.
1999.
Broadly-protective vaccine for Staphylococcus aureus based on an in vivo expressed antigen.
Science
284:1523-1527[Abstract/Free Full Text].
|
| 23.
|
Nilsson, I. M.,
J. C. Lee,
T. Bremell,
C. Ryden, and A. Tarkowski.
1997.
The role of staphylococcal polysaccharide microcapsule expression in septicemia and septic arthritis.
Infect. Immun.
65:4216-4221[Abstract].
|
| 24.
|
Ohlson, K.,
K.-P. Koller, and J. Hacker.
1997.
Analysis of expression of the alpha-toxin gene (hla) of Staphylococcus aureus by using a chromosomally encoded hla::lacZ gene fusion.
Infect. Immun.
65:3606-3614[Abstract].
|
| 25.
|
Pérez-Giraldo, C.,
A. Rodríguez-Benito,
F. J. Morán,
C. Hurtado,
M. T. Blanco, and A. C. Gómez-García.
1995.
Influence of the incubation atmosphere on the production of slime by Staphylococcus epidermidis.
Eur. J. Clin. Microbiol. Infect. Dis.
14:359-362[CrossRef][Medline].
|
| 26.
|
Ray, C.,
R. E. Hay,
H. J. Carter, and C. P. Moran, Jr.
1985.
Mutations that affect utilization of a promoter in stationary-phase Bacillus subtilis.
J. Bacteriol.
163:610-612[Abstract/Free Full Text].
|
| 27.
|
Sau, S.,
J. Sun, and C. Y. Lee.
1997.
Molecular characterization and transcriptional analysis of type 8 capsule genes in Staphylococcus aureus.
J. Bacteriol.
179:1614-1621[Abstract/Free Full Text].
|
| 28.
|
Sau, S.,
N. Bhasin,
E. R. Wann,
J. C. Lee,
T. J. Foster, and C. Y. Lee.
1997.
The Staphylococcus aureus allelic genetic loci for serotype 5 and 8 capsule expression contain the type-specific genes flanked by common genes.
Microbiology
143:2395-2405[Abstract/Free Full Text].
|
| 29.
|
Sompolinsky, D.,
Z. Samra,
W. Karakawa,
W. F. Vann,
R. Schneerson, and Z. Malik.
1985.
Encapsulation and capsular types in isolates of Staphylococcus aureus from different sources and relationship to phage types.
J. Clin. Microbiol.
22:828-834[Abstract/Free Full Text].
|
| 30.
|
Thakker, M.,
J. S. Park,
V. Carey, and J. C. Lee.
1998.
Staphylococcus aureus serotype 5 capsular polysaccharide is antiphagocytic and enhances bacterial virulence in a murine bacteremia model.
Infect. Immun.
66:5183-5189[Abstract/Free Full Text].
|
| 31.
|
Wieland, K. P.,
B. Wieland, and F. Götz.
1995.
A promoter-screening plasmid and xylose-inducible, glucose-repressible expression vectors for Staphylococcus carnosus.
Gene
158:91-96[CrossRef][Medline].
|
| 32.
|
Zukowski, M. M.,
D. F. Gaffney,
D. Speck,
M. Kauffmann,
A. Findeli,
A. Wisecup, and J. P. Lecocq.
1983.
Chromogenic identification of genetic regulatory signals in Bacillus subtilis based on expression of a cloned Pseudomonas gene.
Proc. Natl. Acad. Sci. USA
80:1101-1105[Abstract/Free Full Text].
|
Journal of Bacteriology, August 2001, p. 4609-4613, Vol. 183, No. 15
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.15.4609-4613.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Sotto, A., Lina, G., Richard, J.-L., Combescure, C., Bourg, G., Vidal, L., Jourdan, N., Etienne, J., Lavigne, J.-P.
(2008). Virulence Potential of Staphylococcus aureus Strains Isolated From Diabetic Foot Ulcers: A new paradigm. Diabetes Care
31: 2318-2324
[Abstract]
[Full Text]
-
Bringel, F., Hammann, P., Kugler, V., Arsene-Ploetze, F.
(2008). Lactobacillus plantarum response to inorganic carbon concentrations: PyrR2-dependent and -independent transcription regulation of genes involved in arginine and nucleotide metabolism. Microbiology
154: 2629-2640
[Abstract]
[Full Text]
-
Chen, Z., Luong, T. T., Lee, C. Y.
(2007). The sbcDC Locus Mediates Repression of Type 5 Capsule Production as Part of the SOS Response in Staphylococcus aureus. J. Bacteriol.
189: 7343-7350
[Abstract]
[Full Text]
-
Arsene-Ploetze, F., Kugler, V., Martinussen, J., Bringel, F.
(2006). Expression of the pyr Operon of Lactobacillus plantarum Is Regulated by Inorganic Carbon Availability through a Second Regulator, PyrR2, Homologous to the Pyrimidine-Dependent Regulator PyrR1. J. Bacteriol.
188: 8607-8616
[Abstract]
[Full Text]
-
Luong, T. T., Lee, C. Y.
(2006). The arl locus positively regulates Staphylococcus aureus type 5 capsule via an mgrA-dependent pathway.. Microbiology
152: 3123-3131
[Abstract]
[Full Text]
-
Tuchscherr, L. P. N., Buzzola, F. R., Alvarez, L. P., Caccuri, R. L., Lee, J. C., Sordelli, D. O.
(2005). Capsule-Negative Staphylococcus aureus Induces Chronic Experimental Mastitis in Mice. Infect. Immun.
73: 7932-7937
[Abstract]
[Full Text]
-
Krarup, A., Sorensen, U. B. S., Matsushita, M., Jensenius, J. C., Thiel, S.
(2005). Effect of Capsulation of Opportunistic Pathogenic Bacteria on Binding of the Pattern Recognition Molecules Mannan-Binding Lectin, L-Ficolin, and H-Ficolin. Infect. Immun.
73: 1052-1060
[Abstract]
[Full Text]
-
O'Riordan, K., Lee, J. C.
(2004). Staphylococcus aureus Capsular Polysaccharides. Clin. Microbiol. Rev.
17: 218-234
[Abstract]
[Full Text]
-
Steinhuber, A., Goerke, C., Bayer, M. G., Doring, G., Wolz, C.
(2003). Molecular Architecture of the Regulatory Locus sae of Staphylococcus aureus and Its Impact on Expression of Virulence Factors. J. Bacteriol.
185: 6278-6286
[Abstract]
[Full Text]
-
Luong, T. T., Lee, C. Y.
(2002). Overproduction of Type 8 Capsular Polysaccharide Augments Staphylococcus aureus Virulence. Infect. Immun.
70: 3389-3395
[Abstract]
[Full Text]
-
Luong, T., Sau, S., Gomez, M., Lee, J. C., Lee, C. Y.
(2002). Regulation of Staphylococcus aureus Capsular Polysaccharide Expression by agr and sarA. Infect. Immun.
70: 444-450
[Abstract]
[Full Text]