![[Feedback]](/icons/banner/feedbackACT.gif)
![[For Subscribers]](/icons/banner/subscriberACT.gif)
![[Archive]](/icons/banner/archiveACT.gif)
![[Search]](/icons/banner/searchACT.gif)
![[Contents]](/icons/banner/tocACT.gif)
Previous Article | Next Article 
Journal of Bacteriology, August 2001, p. 4652-4658, Vol. 183, No. 15
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.15.4652-4658.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Virulence Plasmid-Borne spvB and spvC Genes
Can Replace the 90-Kilobase Plasmid in Conferring Virulence to
Salmonella enterica Serovar Typhimurium in
Subcutaneously Inoculated Mice
Hidenori
Matsui,1,2
Christopher M.
Bacot,2,
Wendy A.
Garlington,2,
Thomas J.
Doyle,2
Steve
Roberts,2 and
Paul A.
Gulig2,*
Laboratory of Infectious Diseases and
Immunology, Center for Basic Research, The Kitasato Institute, Tokyo,
Japan,1 and Department of Molecular
Genetics and Microbiology, University of Florida College of
Medicine, Gainesville, Florida2
Received 27 April 2001/Accepted 9 May 2001
 |
ABSTRACT |
In a mouse model of systemic infection, the spv genes
carried on the Salmonella enterica serovar Typhimurium
virulence plasmid increase the replication rate of salmonellae in host
cells of the reticuloendothelial system, most likely within
macrophages. A nonpolar deletion in the spvB gene greatly
decreased virulence but could not be complemented by spvB
alone. However, a low-copy-number plasmid expressing spvBC
from a constitutive lacUV5 promoter did complement the
spvB deletion. By examining a series of spv
mutations and cloned spv sequences, we deduced that
spvB and spvC could be sufficient to confer
plasmid-mediated virulence to S. enterica serovar
Typhimurium. The spvBC-bearing plasmid was capable of replacing all of the spv genes, as well as the entire
virulence plasmid, of serovar Typhimurium for causing systemic
infection in BALB/c mice after subcutaneous, but not oral, inoculation. A point mutation in the spvBC plasmid preventing
translation but not transcription of spvC eliminated the
ability of the plasmid to confer virulence. Therefore, it appears that
both spvB and spvC encode the principal
effector factors for Spv- and plasmid-mediated virulence of serovar Typhimurium.
| |
TEXT |
Salmonella enterica is
best known as the cause of diarrhea produced by numerous serovars,
including Salmonella enterica serovar Typhimurium. In fact,
serovar Typhimurium is one of the leading causes of diarrhea in
the United States, with more than 1 million cases estimated to occur
each year (30). However, in compromised individuals, most
notably those with immune deficiencies, the infection can spread beyond
the intestines to cause enteric fever, resembling typhoid fever caused
by S. enterica serovar Typhi (45). Of the
thousands of diarrheagenic serovars of S. enterica, only a
subset can cause systemic infection, and this subset has in common the
presence of genetically related, high-molecular-weight virulence
plasmids (14). Serovar Typhi does not possess a virulence plasmid (34).
The exact mechanism by which the virulence plasmid enables systemic
infection is not known; however, the serovar Typhimurium virulence
plasmid contributes to systemic disease in a mouse model of enteric
fever by increasing the replication rate of the bacteria within host
cells beyond the intestines (15). The primary
plasmid-borne virulence attributes, including intracellular
replication, are encoded by five spv genes
(14). It is believed that the most relevant host cells for
Spv-mediated intracellular replication are macrophages, based on
cellular depletion experiments with mice infected with wild-type or
Spv
serovar Typhimurium (17) and
immunofluorescence analysis of tissues from mice infected with
wild-type serovar Typhimurium (37; P. A. Gulig,
S. A. Roberts, and T. J. Doyle, Abstr. 98th Gen. Meet. Am.
Soc. Microbiol. abstr. B-212, 1998). Libby et al. (24)
reproduced the Spv phenotype of increased growth rate within macrophages in cell culture. They subsequently determined that the
spv genes were associated with the release of macrophages from cell culture substrates and rapid replication of salmonellae within these released macrophages (25). Most recently,
SpvB was shown to be an ADP-ribosylating enzyme of actin, inhibiting its polymerization in host cells (23, 33, 42), and
therefore could be involved with inhibition of phagosome-lysosome
fusion. Others have shown that plasmid-cured S. enterica
serovar Dublin was also less effective at lysing macrophages in culture
than was the wild-type parent (9).
The relationship between the spv genes and virulence has
been confirmed by both mutation of spv genes and placing the
recombinant spvABCD genes into virulence plasmid-cured
serovar Typhimurium or serovar Dublin (14). Virulence
plasmid-cured salmonellae containing the cloned spv genes
have virulence indistinguishable from that of the wild-type parent
(10, 20, 47). The five spv genes,
spvRABCD, have been sequenced; however, the only significant homology based on primary sequence offering a clue to their function was the identification of the spvR gene product as a
positive regulatory protein in the LysR family (2, 4, 7, 27, 41). SpvR is essential for expression of the other
spv genes, which form an operon (7, 19, 28).
The ADP-ribosylating activity of SpvB, initially examined because of
secondary amino acid structure (33), is discussed above.
There are reports that genes carried on the virulence plasmid other
than the spv genes are involved in virulence. The virulence plasmid has been associated with resistance of salmonellae to complement, adherence to or invasion of host cells, and suppression of
elicitation of 
T cells; however, these results have not been
repeated or have been contradicted (reviewed in reference 14). The virulence plasmid can affect growth of
salmonellae in vitro under certain conditions (18, 21,
35). In addition to the spv genes, insertion
mutations in other genetic loci have been shown to decrease virulence
in animal models (5, 26, 31, 32, 36, 40, 46).
We wanted to determine the minimum complement of spv genes
necessary to confer the plasmid-mediated virulence phenotype to serovar
Typhimurium to enable a more focused genetic and functional analysis.
It should be noted that the demonstration that genes are necessary for
virulence by analysis of specific mutations and the demonstration that
genes are sufficient to confer virulence by using cloned genes are
different matters. It had been shown that the spvA gene was
dispensable for virulence in orally inoculated mice (38,
49), and we reasoned that the spvR gene could be replaced by a suitable promoter for spvABCD provided on a
recombinant plasmid. Through a combination of mutagenesis and cloning,
we determined that the spvB and spvC genes could
replace all of the spv genes and the entire virulence
plasmid of serovar Typhimurium after subcutaneous (s.c.) inoculation of
mice, in which spv genes are essential for full virulence.
Bacterial strains and plasmids.
Bacterial strains and plasmids
are listed and described in Table 1, and plasmid maps
are depicted in Fig. 1. Unless noted otherwise,
bacterial culture was at 37°C in L broth (LB) (22) or on
LB containing 1.5% (wt/vol) agar. Cultures were stored frozen at
80°F in LB containing 35% (vol/vol) glycerol. For most
applications, cultures were grown overnight as static cultures in LB.
On the day of use, the cultures were diluted 1:20 into fresh, prewarmed LB and incubated with shaking at 37°C until the optical density at
600 nm reached approximately 0.4.
View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1.
Physical and genetic maps of virulence plasmid sequences
and recombinant plasmids used in this study. The top line depicts the
insert of pGTR061, which carries spvRABCD, whose open
reading frames are indicated by arrows with the direction of
transcription shown. Restriction sites indicated below pGTR061 are as
follows: B, BamHI; C, ClaI; E, EcoRI;
M, MscI; P, PstI; and S, StuI. Note
that pGTR061 extends to the XhoI site on the right. The
rightmost BamHI site is indicated for reference to plasmids
depicted below. The extent of the  spvB30 deletion and the
location of the spvC22::Tn5 insertion
are shown. The ClaI insert of pGTR040 corresponds to the
spv::tet deletion of UF110. The
arrows next to the insertion sequences of each clone indicate the
direction of transcription of the promoters of the respective vectors.
For pGTR333, pGTR337, and pGTR338, the broken line indicates that the
EcoRI-PstI fragment carrying the spvA
promoter has been juxtaposed to the spvB open reading frame
by the PstI deletion. Details of plasmid construction are
presented in Table 1.
|
|
Construction of an spvC start codon mutation in
pGTR356.
To address the possibility that spvC is
required for virulence conferred by pGTR356, we constructed a
site-directed mutation in the start codon of spvC using the
Transformer system (Clontech, Palo Alto, Calif.). The sequence of the
start codon and the preceding three nucleotides, CCCATG, was changed to
CCCGGG, which not only destroyed the start codon but also created a new
and unique SmaI site as a simple screen for the
mutation. The mutagenic oligonucleotide sequence was
CGCAAAGGAGATTTCCCGGGCCCATAAATAGGC
(SmaI site underlined), and the presence of the
mutation was confirmed by SmaI digestion coupled with the
lack of BsaI digestion (as part of the mutagenesis procedure, a BsaI site within the bla gene of the
vector pMW119 was destroyed while conserving the amino acid sequence of
Bla). The SpvC derivative plasmid was named pGTR357.
Infection of mice.
All mouse studies used BALB/c mice (Charles
River, Wilmington, Mass.; University of Florida Department of
Pathology, Immunology, and Laboratory Medicine Mouse Facility), which
are sensitive to infection by serovar Typhimurium because of the
Itys mutation (39). Mice were
orally inoculated as described previously with approximately
108 CFU of serovar Typhimurium (11).
Inoculation with 105 CFU of salmonellae was done s.c.
either into both hind footpads, as described previously
(15), or into the upper back near the shoulder blades. All
experiments were repeated at least once, with results similar to those
of the experiment shown.
Lack of the spvD gene can be complemented by increased
expression of spvC.
It has been shown through
mutational and complementation analysis that the spvD gene
is essential for full virulence of serovar Typhimurium
(10). However, the effects of mutating spvD
were small compared with the effects of mutations in spvR or
spvC. As part of our attempts to construct a recombinant
plasmid which contained the minimal spv sequence needed to
confer full virulence in plasmid-cured serovar Typhimurium, we
constructed plasmid pGTR040, which contains the 6.3-kb ClaI
fragment bearing spvRABCD' subcloned into the
low-copy-number vector pYA2204 (similarly to pGTR061; see Fig. 1)
(10). Unlike pGTR061, pGTR040 could not restore virulence
to plasmid-cured 
3337 (10). The lack of spvD
in pGTR040 was complemented by placing into 3337 (pGTR040) the
plasmid pGTR153, which carries only the spvD gene
(10) (Table 2). We also examined plasmid
pYA426, which carries spvCD expressed from the
tet promoter of pACYC184 (11, 13), for its
ability to complement the lack of spvD in pGTR040. As
expected, 3337 (pGTR040, pYA426) was fully virulent in terms of
splenic infection (data not shown). We then examined deletion
derivatives of pYA426 produced from the 3' end of spvD
moving toward spvC. We expected that as soon as
spvD experienced deletions, the resulting plasmids would not
work with pGTR040 to confer full virulence. However, deletions of
pYA426 extending completely through spvD still produced
virulence in combination with pGTR040 (data not shown). The smallest
deletion derivative conferring virulence was plasmid pGTR127, which
carries only spvC (Table 2). Therefore, by providing
spvC expressed from a recombinant plasmid, the necessity of
providing spvD to spvRABC-carrying pGTR040 was
abolished. It appeared that overexpressed spvC compensated for the lack of spvD.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Expression of recombinant spvC can complement
lack of spvD to confer virulence to serovar Typhimurium in
mice
|
|
If the mechanism of this spvC-mediated complementation of a
lack of spvD was due to an effect of the spvD
deletion on the cis-encoded spvC, then the
spvD deletion of pGTR040 should not have been complemented
by spvD alone. The data are consistent with SpvD either
affecting expression of spvC in a trans-active manner or physically or functionally interacting with SpvC to facilitate its virulence function in a manner that is mimicked by
overexpressing spvC in the absence of spvD.
A nonpolar deletion mutation of spvB attenuates
virulence but is noncomplementable.
It has been reported that an
aph insertion in spvB greatly attenuates splenic
infection for serovar Typhimurium after oral inoculation
(10). However, we were unable to complement the mutation
with cloned sequences expressing spvB. In fact, no one has
been able to complement an spvB mutation with only
spvB to date. We considered the possibility that the
aph insertion was polar on downstream genes or otherwise
exerted pleiotropic effects. We therefore constructed strain UF051, in
which amino acids 21 to 555 of the spvB gene present on the
virulence plasmid were deleted using inverse PCR mutagenesis, resulting
in the spvB30 mutation (49). As expected,
UF051 was greatly attenuated for splenic infection after oral
inoculation of mice compared with wild-type 3456 (paired difference
in log splenic CFU, 3.8 ± 0.7 [mean ± standard
deviation]; P < 0.002), similar to
spvB5::aph strain UF012 compared with
wild-type 3456 (paired difference in log splenic CFU, 3.8 ± 1.2; P < 0.01).
To complete the molecular version of Koch's postulates and confirm
that the spvB30 mutation was responsible for the observed attenuation, we attempted to complement the mutation with a variety of
recombinant plasmids expressing spvB. We constructed a
series of plasmids, each carrying only spvB transcribed by
either a vector-borne promoter and/or the spvABCD promoter
(Table 1; Fig. 1). None of the plasmids were capable of complementing
the spvB30 mutation after oral inoculation of mice (data
not shown). Whenever spvB was expressed from a vector-borne
promoter, either cat or lacUV5, salmonellae
containing these plasmids (pGTR333, pGTR338, and pGTR339) were poorly
recovered in complementation experiments and were even attenuated for
virulence when the plasmids were placed in wild-type serovar
Typhimurium 3181 (data not shown). pGTR337, which had
spvB expressed from the spvABCD promoter alone,
was not detrimental but did not complement. We verified that the
spvB-containing plasmids expressed SpvB using in vitro
transcription-translation and Western blot analyses (data not shown).
This lack of complementation was not due to the spvB30
mutation being trans dominant (e.g., by producing an SpvB
product that interfered with other Spv or cellular virulence
functions), because UF051 containing pGTR061 (bearing the entire
spv region) was fully virulent for splenic infection after
oral inoculation of mice (paired difference for log CFU per spleen in a
mixed infection with wild-type 3456 was 0.06 ± 1.3;
P = 0.5). Similarly, the spvB30 mutation
was not polar on expression of spvC or spvD,
because pGTR147, which is pGTR061 with an
spvC22::Tn5 insertion
(10), was able to complement the spvB30
mutation (paired difference for log CFU per spleen in a mixed infection
with wild-type 3456 was 0.02 ± 1.3; P = 0.5).
A recombinant plasmid carrying spvBC complements
spvB30 and confers virulence to Spv
serovar Typhimurium by the s.c. route of inoculation.
Since
previous results (38, 49) indicated that spvA
was not essential for virulence and we demonstrated above that lack of
spvD could be compensated for by providing excess
spvC, we considered the possibility that the
spvB30 mutation could be complemented by a plasmid
carrying spvB and spvC together. If the
spvBC genes were expressed from an exogenous promoter, then spvR would be obviated. We therefore constructed plasmid
pGTR356, which contains the spvBC expressed from the
lacUV5 promoter genes in the low-copy-number vector pMW119
(Table 1; Fig. 1). In Lac serovar Typhimurium, this
promoter would be constitutive. UF051(pGTR356) was fully virulent when
administered to mice by the oral route compared with wild-type 3306
(mean log splenic CFU were 5.6 ± 0.76 and 6.0 ± 1.5, respectively; P > 0.6). UF051 containing the vector
pMW119 yielded a log splenic CFU of 2.2 ± 1.0 [P < 0.005 compared with 3306 or UF051(pGTR356)]. Therefore, the
combined spvBC genes were able to complement the
spvB30 mutation. We still do not know why the
spvB gene alone could not complement the
spvB30 mutation. However, with the breadth of
spv clones attempted by us and others, it is unlikely that
the reason was inadequate or insufficient expression.
Since pGTR356 complemented the spvB30 mutation, and in
light of the ancillary roles of spvA and spvD and
the ability to compensate for SpvR by an exogenous promoter, we asked
if pGTR356 could restore virulence to either
spv::tet serovar Typhimurium UF110
(16, 17) or plasmid-cured 3337 (12). In
oral inoculations with mixed strains, UF110(pGTR356) sometimes
approached wild-type UF009 for levels of splenic infection but most
often failed to achieve wild-type levels (data not shown).
UF110(pGTR356) was sometimes significantly higher than virulence
plasmid-cured 3337 for splenic infection but at other times was
not significantly higher. Interestingly, UF110(pGTR356) was often
recovered from Peyer's patches or feces in lower numbers, compared
with UF009 or 3337. Similarly, 3337(pGTR356) failed to achieve
wild-type levels of splenic infection after oral inoculation of mice
(data not shown).
Since it appeared that pGTR356 could be detrimental to salmonellae in
the gut, we injected pGTR356-containing strains s.c. into the hind
footpads or backs of mice and examined splenic infection (Fig.
2 and 3). We had previously shown that
the virulence plasmid and specifically the spv genes were
essential for systemic infection of serovar Typhimurium inoculated s.c.
into BALB/c mice (15, 17). pGTR356 was able to fully
complement the spv::tet mutation of
UF110 when examined in mixed infection with wild-type 3306 (paired
difference in log splenic CFU of 0.62 was not significantly different
from 0; P > 0.6) (Fig. 2). Similarly, in the virulence plasmid-cured background of 3337, pGTR356 fully restored splenic infection after s.c. inoculation, compared with wild-type 3306 and
3337 (pGTR061) (P > 0.2) (Fig. 3). Therefore, when
the intestines, which are not involved with Spv-mediated pathogenesis
in mice, are bypassed via s.c. inoculation, the spvBC genes
are sufficient to replace the entire virulence plasmid for enabling
splenic infection.
View larger version (38K):
[in this window]
[in a new window]
|
FIG. 2.
Recombinant spvBC complements
spv::tet after s.c. inoculation of
mice. Mice were inoculated s.c. with wild-type strain 3306 and
spv::tet strain UF110 containing
either spvBC-bearing pGTR356 or the vector pMW119. Four days
later, spleens were removed, homogenized, and plated to enumerate CFU.
P values are for the mean paired difference (MPD) being
greater than 0. Error bars represent standard deviations. n = 5 (for all groups).
|
|
View larger version (54K):
[in this window]
[in a new window]
|
FIG. 3.
Recombinant spvBC complements virulence
plasmid-cured serovar Typhimurium after s.c. inoculation of mice. Mice
were inoculated s.c. with wild-type strain 3306 or virulence
plasmid-cured strain 3337 containing spvBC-bearing
pGTR356, spvRABCD-bearing pGTR061, or no plasmid. Four days
later, spleens were removed, homogenized, and plated to enumerate CFU.
P values are for 3337(pGTR356) being different from the
other strains. Additionally, 3456 and 3337(pGTR061) were each
significantly greater than 3337 (P < 0.0001), and
3337(pGTR061) was significantly greater than 3456 (P < 0.02). Error bars represent standard deviations. n = 5 (for all groups).
|
|
We considered the possibility that the presence of spvC on
pGTR356 enabled virulence by affecting the stability of spvB
mRNA in a cis-active manner by the presence of the
spvC mRNA immediately downstream. Alternatively, the SpvC
protein could interact with the SpvB protein to either aid in its
function or prevent toxic effects to the salmonella cells. To confirm
that the SpvC protein was essential for the virulence conferred by
pGTR356 to plasmid-cured 3337, we constructed a site-directed
mutation in the start codon of spvC in pGTR356, yielding
pGTR357 (Table 1). The mRNA structure of pGTR357 should have been
intact, while translation of spvC should have been
inhibited. When inoculated s.c. into the backs of BALB/c mice, pGTR357
was unable to confer virulence to 3337 in terms of splenic CFU (Fig.
4), and splenic CFU were significantly lower than those
attained by 3306. Therefore, translation of SpvC protein is required
for the virulence function encoded by pGTR356, and both spvB
and spvC are necessary and sufficient to confer
plasmid-mediated virulence to serovar Typhimurium after s.c.
inoculation of mice.
View larger version (48K):
[in this window]
[in a new window]
|
FIG. 4.
spvC is required for virulence conferred by
spvBC-bearing pGTR356. Mice were inoculated s.c. with
105 CFU of either wild-type 3306, virulence
plasmid-cured 3337, 3337(pGTR356), or 3337(pGTR357). Six days
later, spleens were removed, homogenized, and plated to enumerate CFU.
The spvC mutation of pGTR357(*) significantly decreased
infection, compared with spvBC-bearing pGTR356 (P < 0.01). N.S., 3306 was not significantly different from
3337(pGTR356) (P > 0.3). Error bars represent
standard deviations. n = 5 (for all groups).
|
|
Why are constitutively expressed spvBC genes unable to
confer plasmid-mediated virulence after oral inoculation of mice? The answer could lie in the detrimental nature of inappropriate expression of these genes. For example, it appears that salmonella genes that are
involved with infection of macrophages (spv and salmonella pathogenicity island 2 [SPI2]) are regulated in a manner opposite that of those involved with infection of the intestines (salmonella pathogenicity island 1 [SPI1]), especially with regard to regulation by PhoP and PhoQ (spv and SPI2 are PhoP activated
[6]; SPI1 is PhoP repressed [1]). In
fact, we recently showed that the attenuating effects of constitutively
expressed phoP in serovar Typhimurium are only apparent in
an Spv+ background (29). Most recently it was
shown that SpvB is an ADP-ribosylating toxin of actin in macrophages
and inhibits polymerization of actin (23, 33, 42). If this
activity contributes to inhibition of phagosome-lysosome fusion
mediated by SPI2 (43), then it is possible that expression
of these macrophage-specific genes might inhibit SPI1-mediated invasion
of or transcytosis through the intestinal epithelium after oral
inoculation. However, after s.c. inoculation, in which spv
genes are essential for efficient systemic infection but SPI1 is
dispensable (17), constitutive expression could be
beneficial. We did not perform intraperitoneal infections because we
have found that the spv genes are not nearly as important
for virulence by this route as by oral and s.c. inoculation (12). This could be due to the fact that after
intraperitoneal inoculation the salmonellae replicate extensively in
extracellular fluid, where the spv genes are not required
for virulence (12) and are not even induced for expression
(48).
The mechanism by which the SpvB protein is secreted out of the
salmonella cells and into the cytoplasm of macrophages to interact with
actin is not known. A type III secretion-mediated process would be
plausible, but there are no published data to support this hypothesis.
It is possible that the SpvC and perhaps SpvD proteins participate in
this process. The detrimental nature of spvB expressed by
itself, either when cloned alone or when spvC is mutated in
pGTR357, suggests that SpvB requires SpvC for appropriate, functional
activity. This phenomenon is not restricted to virulence in mice, since
some spvB-bearing recombinant plasmids are detrimental to
serovar Typhimurium growing in vitro. Furthermore, our data suggest
that SpvD interacts with SpvC for its function, since lack of SpvD
could be complemented with overexpressed SpvC. In any case, it is clear
that spvBC are sufficient to replace the entire virulence
plasmid to enable systemic infection of mice under some circumstances.
Coupled with the recent discovery of the molecular function of SpvB,
our data should focus future investigations of Spv function on these
two genes and their products.
(These results were presented in preliminary form at the 1994, 1995, and 1997 General Meetings of the American Society for Microbiology
[C. M. Bacot, and P. A. Gulig, Abstr. 94th Gen. Meet. Am.
Soc. Microbiol. 1994, abstr. B-322, 1994; J. A. Rogers, H. Matsui,
and P. A. Gulig, Abstr. 95th Gen. Meet. Am. Soc. Microbiol. 1995, abstr. B-304, 1995; H. Matsui, K. Kawahara, A. Suzuki, K. Sekiya, H. Danbara, C. M. Bacot, and P. A. Gulig, Abstr. 97th Gen. Meet.
Am. Soc. Microbiol., abstr. B-281, 1997].)
| |
ACKNOWLEDGMENTS |
We thank Donna H. Duckworth for reviewing the manuscript.
This work was supported by NIH grant AI24821 and by American Heart
Association
Florida Affiliate grants 89GIA81 and 92GIA868 to P.A.G.,
who was an American Heart Association Established Investigator with
funds contributed in part by the American Heart AssociationFlorida Affiliate.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Genetics and Microbiology, University of Florida College of Medicine, Box 100266, Gainesville, FL 32610-0266. Phone: (352) 392-0050. Fax: (352) 392-3133. E-mail: gulig{at}ufl.edu.
Present address: Florida Department of Law Enforcement,
Tallahassee, FL 32308.
Present address: 139 Main Rd., Glenalta, South Australia 5052, Australia.
| |
REFERENCES |
| 1.
|
Behlau, I., and S. I. Miller.
1993.
A PhoP-repressed gene promotes Salmonella typhimurium invasion of epithelial cells.
J. Bacteriol.
175:4475-4484[Abstract/Free Full Text].
|
| 2.
|
Caldwell, A. L., and P. A. Gulig.
1991.
The Salmonella typhimurium virulence plasmid encodes a positive regulator of a plasmid-encoded virulence gene.
J. Bacteriol.
173:7176-7185[Abstract/Free Full Text].
|
| 3.
|
Chang, A. C. Y., and S. N. Cohen.
1978.
Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid.
J. Bacteriol.
134:1141-1156[Abstract/Free Full Text].
|
| 4.
|
Coynault, C.,
V. Robbe-Saule,
M. Y. Popoff, and F. Norel.
1992.
Growth phase and SpvR regulation of transcription of Salmonella typhimurium spvABC virulence genes.
Microb. Pathog.
13:133-143[CrossRef][Medline].
|
| 5.
|
Daifuku, R., and G. K. Chikami.
1991.
Tn1725 transposon mutagenesis of 9-187, an EcoRI deletion derivative of Salmonella dublin Lane plasmid pSDL2.
Infect. Immun.
59:4720-4723[Abstract/Free Full Text].
|
| 6.
|
Deiwick, J.,
T. Nikolaus,
S. Erdogan, and M. Hensel.
1999.
Environmental regulation of Salmonella pathogenicity island 2 gene expression.
Mol. Microbiol.
31:1759-1773[CrossRef][Medline].
|
| 7.
|
Fang, F. C.,
M. Krause,
C. Roudier,
J. Fierer, and D. G. Guiney.
1991.
Growth regulation of a Salmonella plasmid gene essential for virulence.
J. Bacteriol.
173:6783-6789[Abstract/Free Full Text].
|
| 8.
|
Galan, J. E.,
J. F. Timoney, and R. Curtiss, III.
1988.
Expression and localization of the Streptococcus equi M protein in Escherichia coli and Salmonella typhimurium, p. 34-40.
In
D. G. Powell (ed.), Proceedings of the Fifth International Conference on Equine Infectious Diseases. University Press of Kentucky, Lexington.
|
| 9.
|
Guilloteau, L. A.,
T. S. Wallis,
A. V. Gautier,
S. Maclntyre,
D. J. Platt, and A. J. Lax.
1996.
The Salmonella virulence plasmid enhances Salmonella-induced lysis of macrophages and influences inflammatory responses.
Infect. Immun.
64:3385-3393[Abstract].
|
| 10.
|
Gulig, P. A.,
A. L. Caldwell, and V. A. Chiodo.
1992.
Identification, genetic analysis, and DNA sequence of a 7.8-kilobase virulence region of the Salmonella typhimurium virulence plasmid.
Mol. Microbiol.
6:1395-1411[Medline].
|
| 11.
|
Gulig, P. A., and V. A. Chiodo.
1990.
Genetic and DNA sequence analysis of the Salmonella typhimurium virulence plasmid gene encoding the 28,000-molecular-weight protein.
Infect. Immun.
58:2651-2658[Abstract/Free Full Text].
|
| 12.
|
Gulig, P. A., and R. Curtiss, III.
1987.
Plasmid-associated virulence of Salmonella typhimurium.
Infect. Immun.
55:2891-2901[Abstract/Free Full Text].
|
| 13.
|
Gulig, P. A., and R. Curtiss, III.
1988.
Cloning and transposon insertion mutagenesis of virulence genes of the 100-kilobase plasmid of Salmonella typhimurium.
Infect. Immun.
56:3262-3271[Abstract/Free Full Text].
|
| 14.
|
Gulig, P. A.,
H. Danbara,
D. G. Guiney,
A. J. Lax,
F. Norel, and M. Rhen.
1993.
Molecular analysis of virulence genes of the salmonella virulence plasmids.
Mol. Microbiol.
7:825-830[Medline].
|
| 15.
|
Gulig, P. A., and T. J. Doyle.
1993.
The Salmonella typhimurium virulence plasmid increases the growth rate of salmonellae in mice.
Infect. Immun.
61:504-511[Abstract/Free Full Text].
|
| 16.
|
Gulig, P. A.,
T. J. Doyle,
M. J. Clare-Salzler,
R. L. Maiese, and H. Matsui.
1997.
Systemic infection of mice by wild-type but not Spv Salmonella typhimurium is enhanced by neutralization of gamma interferon and tumor necrosis factor alpha.
Infect. Immun.
65:5191-5197[Abstract].
|
| 17.
|
Gulig, P. A.,
T. J. Doyle,
J. A. Hughes, and H. Matsui.
1998.
Analysis of host cells associated with the Spv-mediated increased intracellular growth rate of Salmonella typhimurium in mice.
Infect. Immun.
66:2471-2485[Abstract/Free Full Text].
|
| 18.
|
Jones, G. W.,
D. K. Rabert,
D. M. Svinarich, and H. J. Whitfield.
1982.
Association of adhesive, invasive, and virulent phenotypes of Salmonella typhimurium with autonomous 60-megadalton plasmids.
Infect. Immun.
38:476-486[Abstract/Free Full Text].
|
| 19.
|
Krause, M.,
F. C. Fang, and D. G. Guiney.
1992.
Regulation of plasmid virulence gene expression in Salmonella dublin involves an unusual operon structure.
J. Bacteriol.
174:4482-4489[Abstract/Free Full Text].
|
| 20.
|
Krause, M.,
C. Roudier,
J. Fierer,
J. Harwood, and D. Guiney.
1991.
Molecular analysis of the virulence locus of the Salmonella dublin plasmid pSDL2.
Mol. Microbiol.
5:307-316[CrossRef][Medline].
|
| 21.
|
Lax, A. J.,
G. D. Pullinger,
G. D. Baird, and C. M. Williamson.
1990.
The virulence plasmid of Salmonella dublin: detailed restriction map and analysis by transposon mutagenesis.
J. Gen. Microbiol.
136:1117-1123[Medline].
|
| 22.
|
Lennox, E. S.
1955.
Transduction of linked genetic characters of the host by bacteriophage P1.
Virology
1:190-206[CrossRef][Medline].
|
| 23.
|
Lesnick, M. L.,
N. E. Reiner,
J. Fierer, and D. G. Guiney.
2001.
The Salmonella spvB virulence gene encodes an enzyme that ADP-ribosylates actin and destabilizes the cytoskeleton of eukaryotic cells.
Mol. Microbiol.
39:1464-1470[CrossRef][Medline].
|
| 24.
|
Libby, S. J.,
L. G. Adams,
T. A. Ficht,
C. Allen,
H. A. Whitford,
N. A. Buchmeier,
S. Bossie, and D. G. Guiney.
1997.
The spv genes on the Salmonella dublin virulence plasmid are required for severe enteritis and systemic infection in the natural host.
Infect. Immun.
65:1786-1792[Abstract].
|
| 25.
|
Libby, S. J.,
M. Lesnick,
P. Hasegawa,
E. Weidenhammer, and D. G. Guiney.
2000.
The Salmonella virulence plasmid spv genes are required for cytopathology in human monocyte-derived macrophages.
Cell. Microbiol.
2:49-58[CrossRef][Medline].
|
| 26.
|
Manning, E. J.,
G. D. Baird, and P. W. Jones.
1986.
The role of plasmid genes in the pathogenicity of Salmonella dublin.
J. Med. Microbiol.
21:239-243[Abstract].
|
| 27.
|
Matsui, H.,
A. Abe,
K. Kawahara,
N. Terakado, and H. Danbara.
1991.
Positive regulator for the expression of Mba protein of the virulence plasmid, pKDSC50, of Salmonella choleraesuis.
Microb. Pathog.
10:459-464[CrossRef][Medline].
|
| 28.
|
Matsui, H.,
A. Abe,
S. Suzuki,
M. Kijima,
Y. Tamura,
M. Nakamura,
K. Kawahara, and H. Danbara.
1993.
Molecular mechanism of the regulation of expression of plasmid-encoded mouse bacteremia (mba) genes in Salmonella serovar choleraesuis.
Mol. Gen. Genet.
236:219-226[CrossRef][Medline].
|
| 29.
|
Matsui, H.,
T. Kawakami,
S. Ishikawa,
H. Danbara, and P. A. Gulig.
2000.
Constitutively expressed phoP inhibits mouse-virulence of Salmonella typhimurium in an Spv-dependent manner.
Microbiol. Immunol.
44:447-454[Medline].
|
| 30.
|
Mead, P. S.,
L. Slutsker,
V. Dietz,
L. F. McCaig,
J. S. Bresee,
C. Shapiro,
P. M. Griffin, and R. V. Tauxe.
1999.
Food-related illness and death in the United States.
Emerg. Infect. Dis.
5:607-625[Medline].
|
| 31.
|
Michiels, T.,
M. Y. Popoff,
S. Durviaux,
C. Coynault, and G. Cornelis.
1987.
A new method for the physical and genetic mapping of large plasmids: application to the localisation of the virulence determinants on the 90 kb plasmid of Salmonella typhimurium.
Microb. Pathog.
3:109-116[CrossRef][Medline].
|
| 32.
|
Norel, F.,
C. Coynault,
I. Miras,
D. Hermant, and M. Y. Popoff.
1989.
Cloning and expression of plasmid DNA sequences involved in Salmonella serotype typhimurium virulence.
Mol. Microbiol.
3:733-743[CrossRef][Medline].
|
| 33.
|
Otto, H.,
D. Tezcan-Merdol,
R. Girisch,
F. Haag,
M. Rhen, and F. Koch-Nolte.
2000.
The spvB gene-product of the Salmonella enterica virulence plasmid is a mono(ADP-ribosyl)transferase.
Mol. Microbiol.
37:1106-1115[CrossRef][Medline].
|
| 34.
|
Popoff, M. Y.,
I. Miras,
C. Coynault,
C. Lasselin, and P. Pardon.
1984.
Molecular relationships between virulence plasmids of Salmonella serotypes typhimurium and dublin and large plasmids of other Salmonella serotypes.
Ann. Microbiol. (Paris)
135:389-398.
|
| 35.
|
Pullinger, G. D., and A. J. Lax.
1992.
A Salmonella dublin virulence-associated plasmid locus that affects bacterial growth under nutrient-limited conditions.
Mol. Microbiol.
6:1631-1643[CrossRef][Medline].
|
| 36.
|
Rhen, M.,
M. Virtanen, and P. H. Makela.
1989.
Localization by insertion mutagenesis of a virulence-associated region on the Salmonella typhimurium 96 kilobase pair plasmid.
Microb. Pathog.
6:153-158[CrossRef][Medline].
|
| 37.
|
Richter-Dahlfors, A.,
A. M. J. Buchan, and B. B. Finlay.
1997.
Murine salmonellosis studied by confocal microscopy: Salmonella typhimurium resides intracellularly inside macrophages and exerts a cytotoxic effect on phagocytes in vivo.
J. Exp. Med.
186:569-580[Abstract/Free Full Text].
|
| 38.
|
Roudier, C.,
J. Fierer, and D. G. Guiney.
1992.
Characterization of translation termination mutations in the spv operon of the Salmonella virulence plasmid pSDL2.
J. Bacteriol.
174:6418-6423[Abstract/Free Full Text].
|
| 39.
|
Schultz, L. D., and C. L. Sidman.
1987.
Genetically determined murine models of immunodeficiency.
Annu. Rev. Immunol.
5:367-403[CrossRef][Medline].
|
| 40.
|
Sizemore, D. R.,
P. S. Fink,
J. T. Ou,
L. Baron,
D. J. Kopecko, and R. L. Warren.
1991.
Tn5 mutagenesis of the Salmonella typhimurium 100 kb plasmid: definition of new virulence regions.
Microb. Pathog.
10:493-499[CrossRef][Medline].
|
| 41.
|
Taira, S.,
P. Riikonen,
H. Saarilahti,
S. Sukupolvi, and M. Rhen.
1991.
The mkaC virulence gene of the Salmonella serovar Typhimurium 96 kb plasmid encodes a transcriptional activator.
Mol. Gen. Genet.
228:381-384[Medline].
|
| 42.
|
Tezcan-Merdol, D.,
T. Nyman,
U. Lindberg,
F. Haag,
F. Koch-Nolte, and M. Rhen.
2001.
Actin is ADP-ribosylated by the Salmonella enterica virulence-associated protein SpvB.
Mol. Microbiol.
39:606-619[CrossRef][Medline].
|
| 43.
|
Uchiya, K.,
M. A. Barbieri,
K. Funato,
A. H. Shah,
P. D. Stahl, and E. A. Groisman.
1999.
A Salmonella virulence protein that inhibits cellular trafficking.
EMBO J.
18:3924-3933[CrossRef][Medline].
|
| 44.
|
Vieira, J., and J. Messing.
1987.
Production of single-stranded plasmid DNA.
Methods Enzymol.
153:3-11[Medline].
|
| 45.
|
Wilkins, E. G. L., and C. Roberts.
1988.
Extraintestinal salmonellosis.
Epidemiol. Infect.
100:361-368[Medline].
|
| 46.
|
Williamson, C. M.,
G. D. Baird, and E. J. Manning.
1988.
A common virulence region on plasmids from eleven serotypes of Salmonella.
J. Gen. Microbiol.
134:975-982[Medline].
|
| 47.
|
Williamson, C. M.,
G. D. Pullinger, and A. J. Lax.
1988.
Identification of an essential virulence region on Salmonella plasmids.
Microb. Pathog.
5:469-473[CrossRef][Medline].
|
| 48.
|
Wilson, J. A.,
T. J. Doyle, and P. A. Gulig.
1997.
Exponential phase expression of spvA of the Salmonella typhimurium virulence plasmid: induction in intracellular salts medium and intracellularly in mice and cultured mammalian cells.
Microbiology
143:3827-3839[Abstract].
|
| 49.
|
Wilson, J. A., and P. A. Gulig.
1998.
Regulation of the spvR gene of the Salmonella typhimurium virulence plasmid during exponential phase growth in intracellular salts medium and at stationery phase in L broth.
Microbiology
144:1823-1833[Abstract/Free Full Text].
|
Journal of Bacteriology, August 2001, p. 4652-4658, Vol. 183, No. 15
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.15.4652-4658.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Heithoff, D. M., Shimp, W. R., Lau, P. W., Badie, G., Enioutina, E. Y., Daynes, R. A., Byrne, B. A., House, J. K., Mahan, M. J.
(2008). Human Salmonella Clinical Isolates Distinct from Those of Animal Origin. Appl. Environ. Microbiol.
74: 1757-1766
[Abstract]
[Full Text]
-
Zurawski, D. V., Mitsuhata, C., Mumy, K. L., McCormick, B. A., Maurelli, A. T.
(2006). OspF and OspC1 Are Shigella flexneri Type III Secretion System Effectors That Are Required for Postinvasion Aspects of Virulence.. Infect. Immun.
74: 5964-5976
[Abstract]
[Full Text]
-
Parikh, S. S., Litherland, S. A., Clare-Salzler, M. J., Li, W., Gulig, P. A., Southwick, F. S.
(2003). CapG-/- Mice Have Specific Host Defense Defects That Render Them More Susceptible than CapG+/+ Mice to Listeria monocytogenes Infection but Not to Salmonella enterica Serovar Typhimurium Infection. Infect. Immun.
71: 6582-6590
[Abstract]
[Full Text]
-
Matsui, H., Suzuki, M., Isshiki, Y., Kodama, C., Eguchi, M., Kikuchi, Y., Motokawa, K., Takaya, A., Tomoyasu, T., Yamamoto, T.
(2003). Oral Immunization with ATP-Dependent Protease-Deficient Mutants Protects Mice against Subsequent Oral Challenge with Virulent Salmonella enterica Serovar Typhimurium. Infect. Immun.
71: 30-39
[Abstract]
[Full Text]
Top
Abstract
Text
