Previous Article | Next Article 
Journal of Bacteriology, August 2001, p. 4659-4663, Vol. 183, No. 15
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.15.4659-4663.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Activation by Gene Amplification of
pitB, Encoding a Third Phosphate Transporter of
Escherichia coli K-12
Sally M.
Hoffer,1
Paul
Schoondermark,1
Hendrik W.
van Veen,2,
and
Jan
Tommassen1,*
Department of Molecular Microbiology and
Institute of Biomembranes, Utrecht University, 3584 CH
Utrecht,1 and Department of
Microbiology, Groningen Biomolecular Sciences and Biotechnology
Institute, University of Groningen, 9751 NN
Haren,2 The Netherlands
Received 22 December 2000/Accepted 8 May 2001
 |
ABSTRACT |
Two systems for the uptake of inorganic phosphate (Pi)
in Escherichia coli, PitA and Pst, have been described. A
revertant of a pitA pstS double mutant that could grow on
Pi was isolated. We demonstrate that the expression of a
new Pi transporter, PitB, is activated in this strain by a
gene amplification event.
| |
TEXT |
Transport of inorganic phosphate
(Pi) across the cytoplasmic membrane of Escherichia
coli is mediated by the PitA protein and Pst system. PitA, which
transports metal phosphates (28) and is constitutively
expressed (17), is driven by the proton motive force (PMF)
(18, 28). The Pst system, which transports Pi
at the expense of ATP (6, 9), is composed of a periplasmic Pi-binding protein (PstS), two integral membrane proteins
(PstC and PstA), and an ATP-binding protein (PstB) (24).
The genes encoding these four proteins constitute an operon
(24), together with phoU, which encodes a
protein not required for Pi transport (23).
Under Pi limitation, the expression of the Pst system, which is produced at a basal level under Pi-replete
conditions, is further induced. Like, for example, phoA,
which encodes the periplasmic enzyme alkaline phosphatase
(26), the pst-phoU operon is part of the
pho regulon, which is under the control of a two-component regulatory system consisting of the proteins PhoB and PhoR
(29). Furthermore, the Pst system appears to be involved
in regulation, since mutations in the genes of the pst-phoU
operon generally result in constitutive expression of the
pho regulon (29-31). The exact mechanism by
which the Pst system controls the expression of the pho
regulon is not known. To study the role of PstS in regulation, we
attempted to isolate mutants with mutations in the membrane components
of the Pst system that can transport Pi in the absence of
the PstS protein. In one of the mutants obtained, a new Pi
transporter, PitB, appeared to be expressed.
Construction of a pstS pitA double mutant.
A
pstS pitA double-mutant strain is expected to behave as an
organic phosphate auxotroph (22), but previously described pstS pitA double mutants, such as strain C86, appear to take
up Pi and to grow on Pi as the sole source of
phosphate (reference 30 and data not shown). Western
blotting revealed that the PstS protein was produced in this strain,
although at much lower levels than in its parental strain, K10, grown
under Pi limitation (data not shown). To characterize the
pstS mutation in strain C86, a DNA fragment was amplified by
PCR. The amplified fragment was considerably larger than the expected
1.4 kb, which was found when strains MC4100 and K10 were analyzed (Fig.
1A). An enlarged PCR fragment was also
found in another pitA pstS strain, C78 (Fig. 1A). Sequencing
of the PCR fragment from strain C86 revealed the presence of an
IS2 element in the promoter region of pstS (Fig. 1B), whereas no other mutation was found in the pstS gene or
the other genes of the pst-phoU operon. Hence, strain C86
and probably also strain C78 contain a Pst system, which is expressed
at a lower level due to the insertion of an IS2 element in
its promoter.
View larger version (50K):
[in this window]
[in a new window]
|
FIG. 1.
Characterization of the pstS mutation in C86.
(A) Amplification of the pstS gene and its promoter region
by PCR using chromosomal DNA of strains K10, C86, C78, and MC4100
(5) and the primers pst4 (5'-GAGTAATAAATGGATGCCC-3')
and pst5 (5'-CGGTGGGTTAAAAGCAGGC-3'). Strains K10
(pitA10), C86 (pstS21 derivative of K10), and C78
(pstS28 derivative of K10) were kindly provided by the
E. coli Genetic Stock Center (Department of Biology, Yale
University, New Haven, Conn.). The positions of the molecular size
markers are indicated at the left. (B) Position of the IS2
element in the promoter region of the pstS gene in strain
C86. The two pho boxes, the  10 region and the
Shine-Dalgarno sequence (SD), are indicated. The start of the coding
region of pstS is indicated by an arrow.
|
|
We decided to construct a new
pitA pstS double mutant.
Strain K10 carries an uncharacterized
pitA mutation
(
30). Sequencing
of a PCR fragment containing this
pitA allele revealed a single
point mutation with respect to
the wild type (
4), resulting
in a Gly220Asp substitution
in a putative membrane-spanning segment
of PitA. A
pstS::
kan mutation was constructed by
ligating a kanamycin
resistance cassette from pUC18K (
13)
into the
PvuI site of pSN5182
(
15). The
resulting plasmid, pSL15, was digested with
NruI and
BamHI, and the 5.8-kb DNA fragment carrying the
pstS::
kan allele
was used to transform
recBC sbcB strain AM1095 (
8), to disrupt
the
chromosomal
pstS gene. A
pstS::
kan derivative of strain K10,
designated CE1485, was subsequently constructed by P1 transduction
(
14). Western blotting (Fig.
2A, lane 2) confirmed the absence
of the
PstS protein in this strain, which failed to grow on P
i as
the sole source of phosphate (Fig.
3A),
whereas growth on glycerol
3-phosphate (G3P) was not affected (results
not shown). Furthermore,
the efficiency of the cells in taking up
33P
i was drastically reduced (Fig.
3B). Whereas
PhoU expression
was induced in strain K10 under low-P
i
(LP
i) conditions, it was
detected in strain CE1485 after
growth in high-P
i (HP
i) medium
(Fig.
2),
indicating that the
pho regulon is constitutively expressed.
Furthermore, this result shows that the kanamycin resistance cassette
in
pstS has no polar effect on the expression of the
downstream
genes in the
pst operon. Alkaline phosphatase
assays (
25) confirmed
the constitutive expression of the
pho regulon in CE1485 (data
not shown).
View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2.
Expression of the PstS and the PhoU proteins in
pitA mutant strain K10 (lane 1), pitA pstS mutant
strain CE1485 (lane 2), and the pseudorevertant strain CE1487 (lane 3).
Cells were grown in a peptone-based, phosphate-poor medium
(11) supplemented with 0.5% glucose, 660 µM
K2HPO4, and 1 mM G3P (HPi medium)
(A) or with no K2HPO4 or G3P added
(LPi medium) (B). The alternative phosphate source G3P was
omitted from the LPi medium, since it may be degraded by
alkaline phosphatase, thereby generating Pi. Although
growth of CE1485 in the LPi medium was very poor, enough
cells could be collected for this analysis. Proteins were separated by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(12) and, for Western blotting (1),
transferred to a nitrocellulose membrane (Schleicher & Schuell).
Immunodetection was performed with polyclonal antisera directed against
the Pi-binding protein (PstS) and PhoU. The positions of
molecular size standard proteins are indicated on the left in
kilodaltons.
|
|
View larger version (14K):
[in this window]
[in a new window]
|
FIG. 3.
Growth and 33Pi uptake. (A)
Growth curve of pitA mutant strain K10 ( ), pitA
pstS double-mutant CE1485 ( ), and the pseudorevertant CE1487
( ). Cells were grown overnight in Luria broth supplemented with G3P,
pelleted, and resuspended in HEPES-buffered synthetic medium
(25) supplemented with 0.5% glucose and 660 µM
K2HPO4. Growth was monitored for 7 h. (B)
Uptake of 33Pi by cells of strains K10 (),
CE1485 (), and CE1487 (). Cells were grown in Luria broth
supplemented with 20 mM glucose and 1 mM G3P to an optical density at
660 nm (OD660) of approximately 0.9, washed, and
resuspended in a solution of 20 mM potassium
piperazine-N,N'-bis(2-ethanesulfonate) (PIPES) (pH 7.0)-10
mM MgSO4. These cells were stored on ice, and, within
2 h, transport assays were performed at 30°C with 50 µM
33P-labeled potassium phosphate as described previously
(27). The experiments were repeated three times with
essentially the same results, and data from a representative experiment
are shown.
|
|
Isolation of a pseudorevertant of pitA pstS strain
CE1485.
When CE1485 was plated on synthetic medium plates
(25) with Pi as the sole source of phosphate,
revertants appeared after overnight incubation. One of these
revertants, designated CE1487, grew as efficiently as strain K10 in
HPi medium (Fig. 3A), and 33Pi
uptake was restored (Fig. 3B). Strain CE1487 was resistant to
kanamycin, and the PstS protein could not be detected on Western blots
(Fig. 2, lanes 3). Furthermore, sequencing of a PCR-amplified fragment
revealed no other differences in the pitA gene besides the
characterized single point mutation. Therefore, CE1487 is not a true
revertant of strain CE1485 but classifies as a pseudorevertant.
The suppressor mutation in strain CE1487 was mapped by conjugation
using a series of Hfr strains carrying Tn
10 selection
markers
and by P1 transduction with an ordered set of transposon
insertion
mutants as donors (
21). The wild-type allele was
37% cotransducible
with the
metC162::Tn
10 marker and 32%
cotransducible with the
nupG511::Tn
10
marker, which are located at min 67.9 and 66.9,
respectively, on the
chromosomal map (
16). Inspection of the
genome database
(
4) revealed a
pitA homolog, designated
pitB,
in this region. PitA and PitB are 81% identical in
their amino
acid sequences. Thus, a mutation in
pitB might
be responsible
for the restoration of growth of CE1485 on
P
i.
To determine whether the
pitB gene of the pseudorevertant
CE1487 indeed encodes a functional P
i transporter, a 2.2-kb
DNA
fragment containing
pitB and 360 bp of upstream DNA was
amplified
by PCR using primers pitB8 (5'-CGACCATAAACGGGAATCG)
and pitB10
(5'-GCGGTGATGAATCACTGG-3'). The PCR product
was ligated into
HincII-digested
pUC18 (
33).
Introduction of the resulting plasmid, pSL39, into
the
pitA
pstS strain CE1485 restored growth on synthetic HP
i
plates.
To inactivate
pitB on the chromosome, a gentamicin
resistance
cassette from pBSL142 (
2) was inserted into the
MluI site in
pitB on pSL39, yielding pSL37.
AM1095 was transformed with
EcoRI-
and
HindIII-digested pSL37, resulting in
pitB::Gm mutant CE1490,
and the mutation was
transferred to pseudorevertant strain CE1487
by P1 transduction. The
resulting strain, CE1491, failed to grow
on synthetic HP
i
plates. Thus, the PitB protein is responsible
for the growth of strain
CE1487 on P
i as the sole source of
phosphate.
Characterization of the pitB mutation in strain
CE1487.
Sequencing the 2.2-kb DNA fragment containing
pitB did not reveal any mutation. Therefore, a major
chromosomal DNA rearrangement, possibly caused by the presence of an
IS5 element near pitB (4) (Fig.
4A), could have affected gene expression.
In Southern hybridizations with a pitB probe (probe 2, Fig.
4A), the expected 8.6-kb BamHI and 8.1-kb ClaI
fragments were detected in the chromosomal DNA of strain CE1485 (Fig.
5A). In contrast, a much larger BamHI fragment and, besides
the expected 8.1-kb fragment, an additional ClaI fragment of
approximately 6.5 kb reacted with the probe in the DNA of CE1487 (Fig.
5A). These new hybridizing fragments gave much stronger signals than those obtained with the DNA of strain CE1485
(Fig. 5A), although equal amounts of DNA were used, suggesting that a
DNA rearrangement took place in CE1487, resulting in the amplification
of a DNA segment.
View larger version (39K):
[in this window]
[in a new window]
|
FIG. 4.
(A and B) Maps of the pitB chromosomal region
of strains CE1485 (A) and CE1487 (B). Only the relevant
BamHI, ClaI, and EcoRI sites are
depicted. At the top of panel A, the probes used for Southern
hybridization are indicated. At the top of panel B, the arrowheads
indicate PCR primers with the following sequences: pr1,
5'-GGAAGATCGATGCGCTGG-3'; pr2,
5'-CCATTACCAGCCTTGGGG-3'; pr3,
5'-GGGGAAATTCTTCTCGGC-3'; pr4,
5'-GGATATCGTCAGCGGCGC-3'; pr5,
5'-CCTGTGTATATATCAAGGCC-3'; pr6, 5'-CAGGTAACGATGGTGCGG-3';
and pr7, 5'-CCTGCTCGGCACTCTCGG-3'. The numbers
between the restriction sites indicate the lengths of the fragments in
kilobases. (C) Nucleotide sequence of the pitB-gsp
intercistronic region. Coding sequences for the glutathionylspermidine
synthetase (Gsp), including the stop codon, and PitB proteins are
indicated in bold italics and boxed. Dashed arrows indicate inverted
repeats, which may function as the transcriptional terminator of the
gsp gene. Putative 35 and 10 sequences of the
pitB promoter are indicated. The insertion in strain CE1487
of the amplified DNA fragment containing IS5-pitB is
indicated.
|
|
View larger version (28K):
[in this window]
[in a new window]
|
FIG. 5.
Southern blot analysis of chromosomal DNA of CE1485 and
CE1487. Blots were hybridized with the pitB probe (A) and
probe 3 (B) (see Fig. 4). DNA was digested with BamHI or
ClaI, and fragments were separated by electrophoresis on a
0.8% agarose gel. The DNA was transferred from the gel to
Hybond-N+ membranes (Amersham) with a vacuum blotter
(Bio-Rad model 785). After transfer, the filter was washed in 2× SSC
(1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate [pH 7.0]) for 5 min, and DNA was cross-linked by UV irradiation for 2 min. Labeling of
the probes, hybridization, and detection were done with digoxigenin
labeling and detection kits (Boehringer Mannheim). Hybridization and
stringency washes were carried out at 68°C. The positions of
molecular size standard DNA fragments are indicated in kilobases.
|
|
To determine the extent of the DNA rearrangement in strain CE1487,
additional hybridizations were performed with probes 1
and 3 (Fig.
4A),
which were obtained after PCR amplification of
the chromosomal
segments. With probe 3, the expected 15.8-kb
BamHI
and
8.1-kb
ClaI fragments were detected in the genomic DNA of
both strains with equal intensities (Fig.
5B), indicating that
gene
O304 was not implicated in the DNA rearrangement. With probe
1, the large
BamHI fragment and the 6.5-kb
ClaI
fragment, which
were also detected with the
pitB probe, gave
strong hybridization
signals with DNA from strain CE1487 but were not
detected in CE1485
DNA (data not shown). Therefore, like
pitB, the
O230 gene appears
to be amplified in
strain
CE1487.
To resolve the exact extent of the amplified DNA fragment, PCRs were
performed with the primers shown in Fig.
4B. Only the
primer
combinations pr5-pr2, pr5-pr3, and pr5-pr4 yielded fragments
when
chromosomal DNA of strain CE1487 was used as the DNA template
but not
with DNA from strain CE1485. Sequencing of the PCR fragments
revealed
the fusion point to be located within the
pitB-gsp
intercistronic
region (Fig.
4C). The amplified fragment begins with the
sequence
GGAAGGTCCGAACAAGTCCT from the IS
5
element and ends again in the
promoter region of
pitB,
making it 6.4 kb long (Fig.
4B). Both
the increased copy number of
pitB (
19) and the presence of the
IS
5 element in the
pitB promoter region after the
DNA rearrangement
could be responsible for the increased expression of
pitB in the
pseudorevertant strain. Such an
IS
5-mediated activation of gene
expression has been
described previously, for example in the cryptic
bgl operon
of
E. coli K-12 (
20).
Transport characteristics of PitB.
To compare the
characteristics of PitA- and PitB-mediated Pi transport,
pitB and pitA were PCR amplified with primer
couples pitB17 (5'-CGGAATTCATGCTAAATTTATTTGTTG-3') plus
pitB18 (5'-CGCGGATCCTTAAATCAACTGCAATGC-3') and pit1
(5'-CGGAATTCATGCTACATTTGTTTGC-3') plus pit2
(5'-CGCGGATCCTTACAGGAACTGCAAGG-3'), respectively, and cloned
in pJF118EH (7) under tac promoter control.
Introduction of the resulting plasmids, pSL41 and pSL42, respectively,
but not of vector pJF118EH enabled pitA pitB pstS strain
CE1491, even without isopropyl-
-D-thiogalactopyranoside, to grow on Pi as the sole source of phosphate and to take
up 33Pi (data not shown). To determine the PMF
dependency of PitB-mediated Pi transport, Pi
transport was studied in right-side-out membrane vesicles prepared from
strain CE1491 carrying pSL41 or pSL42 as described previously
(10). Like PitAmediated 33Pi
uptake (data not shown), PitB-mediated 33Pi
uptake was inhibited by valinomycin and nigericin, which selectively dissipate the transmembrane potential (
) and transmembrane pH gradient (pH), respectively (Fig. 6).
Apparently, PitB activity is dependent on both components of the PMF.
In addition, the initial velocities of 33Pi
uptake were determined over the first 30 s of linear uptake at
Pi concentrations between 4 and 320 µM and the
Km value of PitB was determined by direct
fitting of the data to the Michaelis-Menten equation (data not shown).
The apparent Km for Pi found, 39 µM, is close to the reported value for PitA, 24 to 38 µM
Pi (17, 32).
View larger version (13K):
[in this window]
[in a new window]
|
FIG. 6.
Uptake of 33Pi in right-side-out
membrane vesicles of strain CE1491 expressing pitB from
plasmid pSL41. Membrane vesicles were diluted to a final protein
concentration of 0.1 to 0.5 mg of protein/ml in air-saturated 50 mM
potassium PIPES (pH 7.0)-10 mM MgSO4. The membrane
vesicles were preincubated for 3 min at 30°C with 2 µM
pyrroloquinoline quinone in the absence () or presence ( ) of 20 mM glucose to generate the PMF and in the presence of glucose in
combination with 2.5 µM valinomycin () or 2.5 µM nigericin
( ). Transport was initiated on addition of 50 µM
33P-labeled potassium phosphate and analyzed by rapid
filtration (27). The experiments were repeated twice with
essentially the same results, and data from a representative experiment
are shown.
|
|
Besides P
i, arsenate is transported by PitA
(
3). Consequently,
pitA mutants are resistant
to arsenate. To investigate whether
PitB can transport arsenate,
various strains were streaked on
plates containing synthetic medium
(
25) supplemented with 660
µM
K
2HPO
4, 1 mM G3P, and 10 mM arsenate. Whereas
the
pitA mutant
strains K10 and CE1485 were able to grow on
this medium, growth
of the PitB-expressing pseudorevertant strain
CE1487 was greatly
impaired (data not shown), indicating that PitB is
able to transport
arsenate.
In conclusion, we demonstrated that expression of a cryptic homolog of
pitA, pitB, can be activated in vivo by a DNA rearrangement
involving DNA amplification and insertion of IS
5 in the
promoter
region and that this gene encodes a P
i transporter
with similar
characteristics to PitA. Interestingly, a screening of 34 completely
sequenced genomes
(
http://www.ncbi.nlm.nih.gov/COG) revealed that
several
other bacteria, including, for example,
Pseudomonas
aeruginosa,
contain more than one PitA
homolog.
| |
ACKNOWLEDGMENTS |
We thank A. Torriani for providing anti-PhoU serum and the
Netherlands Culture Collection of Bacteria (NCCB) for providing several
plasmids and strains.
This research was supported by the Life Sciences Foundation (A.L.W.),
which is subsidized by the Netherlands Organization for Scientific
Research (NWO). H.W.V.V. is a fellow of the Royal Netherlands Academy
of Arts and Sciences (KNAW).
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Microbiology, Utrecht University, Padualaan 8, 3584 CH
Utrecht, The Netherlands. Phone: (31) 30 2532999. Fax: (31) 30 2513655. E-mail: J.P.M.Tommassen{at}bio.uu.nl.
Present address: Department of Pharmacology, University of
Cambridge, Cambridge CB2 1QJ, United Kingdom.
| |
REFERENCES |
| 1.
|
Agterberg, M.,
R. Fransen, and J. Tommassen.
1988.
Expression of Escherichia coli PhoE protein in avirulent Salmonella typhimurium aroA and galE strains.
FEMS Microbiol. Lett.
50:295-299[CrossRef].
|
| 2.
|
Alexeyev, M. F.,
I. N. Shokolenko, and T. P. Croughan.
1995.
Improved antibiotic-resistance gene cassettes and omega elements for Escherichia coli vector construction and in vitro deletion/insertion mutagenesis.
Gene
160:63-67[CrossRef][Medline].
|
| 3.
|
Bennett, R. L., and M. H. Malamy.
1970.
Arsenate resistant mutants of Escherichia coli and phosphate transport.
Biochem. Biophys. Res. Commun.
40:496-503[CrossRef][Medline].
|
| 4.
|
Blattner, F. R.,
G. Plunkett III,
C. A. Block,
N. T. Perna,
V. Burland,
M. Riley, et al.
1997.
The complete genome sequence of Escherichia coli K-12.
Science
277:1453-1474[Abstract/Free Full Text].
|
| 5.
|
Casadaban, M. J.
1976.
Transposition and fusion of the lac genes to selected promoters in Escherichia coli using bacteriophage lambda and Mu.
J. Mol. Biol.
104:541-544[CrossRef][Medline].
|
| 6.
|
Chan, F. Y., and A. Torriani.
1996.
PstB protein of the phosphate-specific transport system of Escherichia coli is an ATPase.
J. Bacteriol.
178:3974-3977[Abstract/Free Full Text].
|
| 7.
|
Fürste, J. P.,
W. Pansegrau,
R. Frank,
H. Blöcker,
P. Scholz,
M. Bagdasarian, and E. Lanka.
1986.
Molecular cloning of the plasmid RP4 primase region in a multi-host-range tacP expression vector.
Gene
48:119-131[CrossRef][Medline].
|
| 8.
|
Hoekstra, W. P. M.,
P. G. de Haan,
J. E. N. Bergmans, and E. M. Zuidweg.
1976.
Transformation in E. coli K12: relation of linkage to distance between markers.
Mol. Gen. Genet.
145:109-110[CrossRef][Medline].
|
| 9.
|
Higgins, C. F.
1992.
ABC transporters: from microorganisms to man.
Annu. Rev. Cell Biol.
8:67-113[CrossRef].
|
| 10.
|
Kaback, H. R.
1971.
Bacterial membranes.
Methods Enzymol.
22:99-120.
|
| 11.
|
Levinthal, A.,
E. R. Signer, and K. Fetherolf.
1962.
Reactivation and hybridisation of reduced alkaline phosphatase.
Proc. Natl. Acad. Sci. USA
48:1230-1237[Free Full Text].
|
| 12.
|
Lugtenberg, B.,
J. Meyers,
R. Peters,
P. van der Hoek, and L. van Alphen.
1975.
Electrophoretic resolution of the "major outer membrane protein" of Escherichia coli into four bands.
FEBS Lett.
58:254-258[CrossRef][Medline].
|
| 13.
|
Ménard, R.,
P. J. Sansonetti, and C. Parsot.
1993.
Nonpolar mutagenesis of the ipa genes defines IpaB, IpaC, and IpaD as effectors of Shigella flexneri entry into epithelial cells.
J. Bacteriol.
175:5899-5906[Abstract/Free Full Text].
|
| 14.
|
Miller, J. H.
1972.
Experiments in molecular genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 15.
|
Morita, T.,
M. Amemura,
K. Makino,
H. Shinagawa,
K. Magota,
N. Otsuji, and A. Nakata.
1983.
Hyperproduction of phosphate-binding protein, PhoS, and pre-PhoS proteins in Escherichia coli carrying a cloned phoS gene.
Eur. J. Biochem.
130:427-435[Medline].
|
| 16.
|
Nichols, B. P.,
O. Shafiq, and V. Meiners.
1998.
Sequence analysis of Tn10 insertion sites in a collection of Escherichia coli strains used for genetic mapping and strain constructing.
J. Bacteriol.
180:6408-6411[Abstract/Free Full Text].
|
| 17.
|
Rosenberg, H.,
R. G. Gerdes, and K. Chegwidden.
1977.
Two systems for the uptake of phosphate in Escherichia coli.
J. Bacteriol
131:505-511[Abstract/Free Full Text].
|
| 18.
|
Rosenberg, H.,
R. G. Gerdes, and F. M. Harold.
1979.
Energy coupling to the transport of inorganic phosphate in Escherichia coli K12.
Biochem. J.
178:133-137[Medline].
|
| 19.
|
Roth, J. R.,
N. Benson,
T. Galitski,
K. Kaack,
J. G. Lawrence, and L. Miesel.
1996.
Rearrangements of the bacterial chromosome: formation and applications, p. 2256-2276.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology ASM Press, Washington, D.C.
|
| 20.
|
Schnetz, K., and B. Rak.
1992.
IS5: a mobile enhancer of transcription in Escherichia coli.
Proc. Natl. Acad. Sci. USA
89:1244-1248[Abstract/Free Full Text].
|
| 21.
|
Singer, M.,
T. A. Baker,
S. M. Schnitzler,
M. Deischel,
W. Goel,
K. J. Dove, et al.
1989.
Collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of Escherichia coli.
Microbiol. Rev.
53:1-24[Abstract/Free Full Text].
|
| 22.
|
Sprague, G. F.,
R. M. Bell, and J. E. Cronan.
1975.
A mutant of Escherichia coli auxotrophic for organic phosphates: evidence for two defects in inorganic phosphate transport.
Mol. Gen. Genet.
143:71-77[CrossRef][Medline].
|
| 23.
|
Steed, P. M., and B. L. Wanner.
1993.
Use of the rep technique for allele replacement to construct mutants with deletions of the pstSCAB-phoU operon: evidence of a new role for the PhoU protein in the phosphate regulon.
J. Bacteriol.
175:6797-6809[Abstract/Free Full Text].
|
| 24.
|
Surin, B. P.,
H. Rosenberg, and G. B. Cox.
1985.
Phosphate-specific transport system of Escherichia coli: nucleotide sequence and gene-polypeptide relationships.
J. Bacteriol
161:189-198[Abstract/Free Full Text].
|
| 25.
|
Tommassen, J., and B. Lugtenberg.
1980.
Outer membrane protein e of Escherichia coli is coregulated with alkaline phosphatase.
J. Bacteriol.
143:151-157[Abstract/Free Full Text].
|
| 26.
|
Torriani, A.
1960.
Influence of inorganic phosphate in the formation of phosphatases by Escherichia coli.
Biochim. Biophys. Acta
38:460-470[Medline].
|
| 27.
|
Van Veen, H. W.,
T. Abee,
G. J. J. Kortstee,
W. N. Konings, and A. J. B. Zehnder.
1993.
Characterization of two phosphate transport systems in Acinetobacter johnsonii 210A.
J. Bacteriol.
175:200-206[Abstract/Free Full Text].
|
| 28.
|
Van Veen, H. W.,
T. Abee,
G. J. J. Kortstee,
W. N. Konings, and A. J. B. Zehnder.
1994.
Translocation of metal phosphates via the phosphate inorganic transport system of Escherichia coli.
Biochemistry
33:1766-1770[CrossRef][Medline].
|
| 29.
|
Wanner, B. L.
1996.
Phosphorus assimilation and control of the phosphate regulon, p. 1357-1381.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. ASM Press, Washington, D.C.
|
| 30.
|
Willsky, G. R.,
R. L. Bennett, and M. H. Malamy.
1973.
Inorganic phosphate transport in Escherichia coli: involvement of two genes which play a role in alkaline phosphatase regulation.
J. Bacteriol.
113:529-539[Abstract/Free Full Text].
|
| 31.
|
Willsky, G. R., and M. H. Malamy.
1976.
Control of the synthesis of alkaline phosphatase and the phosphate-binding protein in Escherichia coli.
J. Bacteriol.
127:595-609[Abstract/Free Full Text].
|
| 32.
|
Willsky, G. R., and M. H. Malamy.
1980.
Characterization of two genetically separable inorganic phosphate transport systems in Escherichia coli.
J. Bacteriol.
144:356-365[Abstract/Free Full Text].
|
| 33.
|
Yanisch-Perron, C.,
J. Vieira, and J. Messing.
1985.
Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors.
Gene
33:103-119[CrossRef][Medline].
|
Journal of Bacteriology, August 2001, p. 4659-4663, Vol. 183, No. 15
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.15.4659-4663.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Santos-Beneit, F., Rodriguez-Garcia, A., Franco-Dominguez, E., Martin, J. F.
(2008). Phosphate-dependent regulation of the low- and high-affinity transport systems in the model actinomycete Streptomyces coelicolor. Microbiology
154: 2356-2370
[Abstract]
[Full Text]
-
Gebhard, S., Tran, S. L., Cook, G. M.
(2006). The Phn system of Mycobacterium smegmatis: a second high-affinity ABC-transporter for phosphate.. Microbiology
152: 3453-3465
[Abstract]
[Full Text]
-
Diaz, M., Esteban, A., Fernandez-Abalos, J. M., Santamaria, R. I.
(2005). The high-affinity phosphate-binding protein PstS is accumulated under high fructose concentrations and mutation of the corresponding gene affects differentiation in Streptomyces lividans. Microbiology
151: 2583-2592
[Abstract]
[Full Text]
-
Ruiz, N., Silhavy, T. J.
(2003). Constitutive Activation of the Escherichia coli Pho Regulon Upregulates rpoS Translation in an Hfq-Dependent Fashion. J. Bacteriol.
185: 5984-5992
[Abstract]
[Full Text]
-
Ishige, T., Krause, M., Bott, M., Wendisch, V. F., Sahm, H.
(2003). The Phosphate Starvation Stimulon of Corynebacterium glutamicum Determined by DNA Microarray Analyses. J. Bacteriol.
185: 4519-4529
[Abstract]
[Full Text]
-
Matsuzaki, M., Abe, M., Hara, S., Iwasaki, Y., Yamamoto, I., Satoh, T.
(2003). An Abundant Periplasmic Protein of the Denitrifying Phototroph Rhodobacter sphaeroides f. sp. denitrificans is PstS, a Component of an ABC Phosphate Transport System. Plant Cell Physiol
44: 212-216
[Abstract]
[Full Text]
-
Hoffer, S. M., Tommassen, J.
(2001). The Phosphate-Binding Protein of Escherichia coli Is Not Essential for Pi-Regulated Expression of the pho Regulon. J. Bacteriol.
183: 5768-5771
[Abstract]
[Full Text]
-
Hoffer, S. M., Westerhoff, H. V., Hellingwerf, K. J., Postma, P. W., Tommassen, J.
(2001). Autoamplification of a Two-Component Regulatory System Results in ""Learning"" Behavior. J. Bacteriol.
183: 4914-4917
[Abstract]
[Full Text]
Top
Abstract
Text
