Previous Article | Next Article 
Journal of Bacteriology, August 2001, p. 4664-4667, Vol. 183, No. 15
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.15.4664-4667.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
ZitB (YbgR), a Member of the Cation Diffusion
Facilitator Family, Is an Additional Zinc Transporter in
Escherichia coli
Gregor
Grass,1
Bin
Fan,2
Barry P.
Rosen,2
Sylvia
Franke,3
Dietrich H.
Nies,3 and
Christopher
Rensing1,*
Department of Soil, Water, and Environmental
Science, University of Arizona, Tucson, Arizona
857211; Department of Biochemistry and
Molecular Biology, Wayne State University, Detroit, Michigan
482012; and Institut für
Mikrobiologie, Martin-Luther-Universität Halle-Wittenberg, 06120 Halle, Germany3
Received 7 March 2001/Accepted 14 May 2001
 |
ABSTRACT |
The Escherichia coli zitB gene encodes a Zn(II)
transporter belonging to the cation diffusion facilitator family. ZitB
is specifically induced by zinc. ZitB expression on a plasmid rendered zntA-disrupted E. coli cells more resistant to
zinc, and the cells exhibited reduced accumulation of 65Zn,
suggesting ZitB-mediated efflux of zinc.
| |
TEXT |
Zinc is an essential component of
many proteins and is required for life in all organisms. However,
excess zinc is toxic, and as a result, cells require homeostatic
mechanisms to control intracellular zinc levels. In Escherichia
coli, zinc deficiency induces expression of a specific zinc uptake
system, ZnuABC, which is an ABC transporter for zinc uptake
(22). Under conditions of zinc sufficiency, expression of
the pump is repressed by the Fur homologue Zur, which presumably binds
to the bidirectional promoter region of znuA and
znuBC. However, under toxic conditions Zn(II) enters the
cells by an unknown pathway. The phosphate uptake system has been
implicated in uptake of Zn(II), possibly as a metal phosphate
(3). Growth of E. coli in high concentrations of Zn(II), Cd(II), or Pb(II) resulted in induction of ZntA, a Zn(II)-Cd(II)-Pb(II)-translocating P-type ATPase. ZntR, a MerR homologue, is a transcriptional activator of zntA (4,
18). Disruption of zntA resulted in sensitivity to
Zn(II), Cd(II), and Pb(II) (2, 24, 25). However, in
addition to zntA, there are two uncharacterized genes,
ybgR and yiiP, encoding gene products belonging
to the cation diffusion facilitator (CDF) family of proteins (17,
23). The CDF family has common structural characteristics, with
six transmembrane domains and containing histidine-rich motifs predicted to extend into the cytosol (1, 6). In addition, overproduction of eukaryotic members of this family confers resistance to zinc in Saccharomyces cerevisiae (6, 15).
In this report we show that zitB (formerly ybgR)
encodes an additional zinc transporter belonging to the CDF family of
proteins. Double disruption of zitB and zntA
rendered E. coli cells more zinc sensitive than a single
disruption in zntA alone. Furthermore, overexpression of
ZitB resulted in a significant increase in zinc resistance and reduced
uptake of zinc. Expression of both zitB and yiiP
was inducible by zinc in a concentration-dependent manner. However, in
contrast to zitB, the overexpression of yiiP did
not confer additional zinc resistance, and disruption of
yiiP in different strains did not alter zinc resistance, so
the function of its gene product remains unknown.
ZitB is an additional zinc transporter.
zitB
deletions were introduced into E. coli W3110 and E. coli RW3110 (zntA::Km), producing E. coli strains GG51 (
zitB::Cm) and GG48
(zitB::Cm zntA::Km).
Chromosomal deletions were performed as described by Datsenko and
Wanner (5), and the gene of interest was replaced by a
chloramphenicol cassette (Cm). The zitB::Cm cassette was transduced into E. coli W3110 and RW3110
(zntA::Km) by P1 transduction. Mutants with a
single zitB deletion did not exhibit significant
differences in metal sensitivity compared to E. coli W3110
(data not shown). However, E. coli strain GG48 (zitB::Cm zntA::Km) was
more zinc sensitive than E. coli RW3110 (zntA::Km), indicating that zitB
(formerly ybgR) might encode a zinc transporter (Fig.
1). There was no effect on the MICs of cobalt and cadmium when E. coli strains GG48 and RW3110 were
compared (data not shown). Since zitB appears to be
selective for zinc, ybgR was renamed zitB (for
"zinc transporter").
View larger version (19K):
[in this window]
[in a new window]
|
FIG. 1.
Effect of zinc on growth E. coli W3110 ( ),
RW3110 (zntA::Km) ( ), GG48
(zitB::Cm zntA::Km) ( ),
and GG48 (zitB::Cm
zntA::Km)/pZITB ( ). Growth curves with
different ZnCl2 concentrations are shown. Overnight
cultures were diluted 1:500 into fresh Luria-Bertani medium with the
indicated concentrations of ZnCl2. Cell growth was
monitored as the optical density at 600 nm after 15 h of
incubation at 37°C with shaking and converted to dry weight.
Experiments were performed in triplicate, values are averages.
|
|
Zinc resistance and transport by ZitB.
To determine whether
ZitB transports zinc, the zitB gene was cloned into plasmid
pASK-IBA3 (IBA Göttingen), leading to plasmid pZITB. Primer
sequences are available on request. This plasmid was transferred into
E. coli strain GG48 (zitB::Cm
zntA::Km). Induction of zitB on plasmid
pZITB by addition of anhydrotetracycline (AHT) led to a significant
increase in zinc resistance (Fig. 1). Induction by AHT was required to
confer maximal zinc resistance. Expression of ZitB did not confer
resistance to cobalt and cadmium (data not shown).
ZitB is homologous to members of the CDF family that have been
implicated in transport of metal ions (
6). Resistance
mediated
by a zinc transporter may be based on efflux, which decreases
the intracellular concentration of metal ions. Uptake experiments
were
performed by filtration as described previously (
16). When
levels of cell-associated zinc ions in
E. coli strain GG48
(
zitB::Cm
zntA::Km) with
and without expressed ZitB were compared, resistant
cells accumulated
significantly less zinc than the respective
control cells (Fig.
2). Since it is a member of the CDF
family,
it is reasonable to propose that ZitB is located in the
cytoplasmic
membrane. Thus, reduced accumulation probably results from
active
transport of Zn(II) across the cytoplasmic membrane catalyzed
by
ZitB.
View larger version (19K):
[in this window]
[in a new window]
|
FIG. 2.
65Zn(II) uptake by cells of E. coli GG48 (zitB::Cm
zntA::Km)/pZITB expressing zitB. Cells
were grown overnight in Luria-Bertani medium and diluted 100-fold into
fresh prewarmed Luria-Bertani medium. The cells were grown to an
optical density at 600 nm of 0.8 and induced with 200 µg of AHT per
liter. After growth for 2.5 h, the cells were washed with buffer A
(10 mM Tris-HCl [pH 7.0], 2 g of glucose per liter, 10 mM
Na2HPO4) and concentrated fourfold in the same
buffer. 65ZnSO4 was added to a final
concentration of 5 µM. The cells were incubated at 37°C, and 0.1-ml
aliquots were filtered through nitrocellulose membranes (0.45 µm) at
various times and immediately washed with 10 ml of buffer B (10 mM
Tris-HCl [pH 7.0], 10 mM MgCl2). The membranes were
dried, and radioactivity was measured using a liquid scintillation
counter. The protein concentration was determined using the
bicinchoninic acid kit (Sigma), and the amount of Zn(II) per milligram
of protein was calculated.
|
|
The yiiP gene product may also be involved in zinc
homeostasis.
The yiiP gene encodes a putative gene
product also belonging to the CDF family. Mutants with a
yiiP deletion were constructed from E. coli
W3110, RW3110 (zntA::Km), and GG48 (zitB
zntA::Km), leading to strains GG180
(yiiP::Cm), GG253
(yiiP::Cm zntA::Km), and
GG252 (yiiP::Cm zitB
zntA::Km). Mutants with a yiiP deletion did not show a decrease in zinc, cadmium, or cobalt resistance compared
to the parental E. coli strains (data not shown). In contrast, strain GG253 (yiiP::Cm
zntA::Km) was slightly but significantly more zinc
resistant than strain RW3110 (zntA::Km). However,
overexpression of yiiP in plasmid pYIIP did not lead to an
increase or decrease in zinc, cadmium, or cobalt tolerance (data not shown).
The zitB and yiiP genes are induced by
zinc.
To analyze metal-dependent expression of zitB and
yiiP, transcriptional fusions using lacZ as a
reporter gene were constructed. To construct the chromosomal
(zitB-lacZ) transcriptional fusion in strain
E. coli GG161 (W3110 lacZYA::Km),
the 400 bp upstream and downstream of the zitB stop codon
were separately amplified by PCR from chromosomal DNA of E. coli W3110. These fragments were digested with BamHI,
and both fragments were cloned into vector plasmid pGEM T-Easy
(Promega, Madison, Wis.) in one step. As confirmed by control
sequencing, this led to a plasmid harboring an 800-bp zitB
fragment with a BamHI and an XbaI site located directly downstream of the stop codon of zitB, mutating the
sequence CATTAATGGGACAGC (the TAA stop codon of
zitB is in boldface) to
CATTAAGGATCCGGGTCTAGAGGCCATTCACATCATCACCATTAA
(underlining indicates restriction sites for BamHI and
XbaI). A promoterless lacZ gene was inserted into
the BamHI/XbaI site of this plasmid introduced by
PCR, and the fragment containing zitB-lacZ was cloned as a
NotI fragment into plasmid pKO3 (12). Finally,
the pKO3 hybrid plasmid with (zitB-lacZ) was
used in a double-recombination event to insert the lacZ gene
downstream of zitB on the chromosome of E. coli
GG161 (W3110 lacZYA::Km) as described
previously (7). The correct insertion and orientation of
lacZ in strain E. coli GG260 [W3110
lacZYA::Km
(zitB-lacZ)] were verified by PCR. E. coli GG161 (W3110 lacZYA::Km) was
constructed by transfer of the lacZYA::Km
replacement by generalized P1 transduction from strain E. coli BW25434 (5) into E. coli W3110. The
-galactosidase activity in permeabilized cells was determined as
published previously (14). Likewise, a
(yiiP-lacZ) operon fusion was constructed, resulting in strain GG193 [W3110 lacZYA::km
(yiip-lacZ)].
Expression of
zitB was strongly induced by zinc and slightly
induced by cadmium, while other metals did not significantly
induce
(
zitB-
lacZ) (Table
1). The zinc concentration dependency
of
zitB expression was examined. Induction of
zitB
was observed
with 50 µM ZnCl
2 and reached a maximum at
100 µM in mineral salts
medium. Higher concentrations of Zn(II) led
to a decrease of
zitB expression (Fig.
3). Northern blot analysis (
8,
9) also
showed an increase in
zitB-specific
transcript after addition
of zinc (data not shown). Expression of
yiiP was also maximally
induced by zinc and also to a lesser
degree by cadmium (Table
1).
View larger version (33K):
[in this window]
[in a new window]
|
FIG. 3.
Induction of zitB. Induction of
-galactosidase activity in a zitB-lacZ
transcriptional fusion strain. Overnight cultures of E. coli
GG260 containing a (zitB-lacZ) operon fusion
on the bacterial chromosome were diluted 1:100 into fresh minimal
medium with 0.2% glycerol and 0.1% yeast extract containing no added
metal or were induced after 3 h of growth by increasing
concentrations of ZnCl2. Incubation was continued with
shaking for 3 h at 30°C, and the -galactosidase activity was
determined (14). Each experiment was performed in
triplicate, and values are averages.
|
|
Conclusions.
In this report we describe the identification of
two genes, ybgR (zitB) and yiiP, on
the E. coli chromosome that encode putative CDF proteins.
Most CDF transporters analyzed thus far are responsible for zinc
transport from the cytosol across different membranes. Four mammalian
CDF transporters have been characterized: ZnT-1, ZnT-2, ZnT-3, and
ZnT-4. ZnT-1 is responsible for zinc transport across the plasma
membrane (19). ZnT-2 is responsible for zinc transport
into lysosomes, and ZnT-3 is responsible for zinc transport into
synaptic vesicles (20, 21). ZnT-4 is also thought to function in zinc efflux (10). Prokaryotic members of the
CDF family include CzcD from Ralstonia metallidurans CH34
and CzrB (also named ZntA) from Staphylococcus aureus
(1, 11, 26). In addition to zinc, these transporters were
also shown to transport cobalt and cadmium (1). CzcD
appears to have an additional regulatory function in repressing the CzC
system by exporting inducing cations (1). However, in all
CDF transporters characterized so far, neither the transport mechanism
nor the actual substrate of the pump is known. It might therefore be
premature to speculate about their physiological function.
In this study we examined the physiological role of the
yiiP
and
zitB gene products in
E. coli. No clear
phenotype of a
yiiP-disrupted
strain was observed, so the
physiological role of YiiP remains
obscure. On the other hand, there
was a clear relationship between
expression of the
zitB gene
product and zinc tolerance in
E. coli.
Disruption of both
zitB and
zntA, which encodes a
Zn(II)-translocating
P-type ATPase (
24), resulted in
hypersensitivity to zinc. A
strain disrupted only in
zitB
did not exhibit a decreased zinc
tolerance, perhaps because ZntA could
pump out zinc efficiently
at high zinc concentrations. However,
expression of
zitB on a
plasmid led to a significant
increase in zinc resistance. It is
possible that ZitB contributes to
zinc homeostasis at low concentrations
of zinc, while ZntA is required
for growth at higher and more
toxic concentrations. Additionally, zinc
induction of a
(
zitB-
lacZ)
transcriptional
fusion showed a steady increase of transcription
up to approximately
0.1 mM. Higher medium concentrations of zinc
did not lead to a further
increase in
zitB transcription. This
may reflect the fact
that ZntA maintains the intracellular zinc
concentration lower than the
medium concentration. These studies
indicate that zinc resistance is
not due to a single transport
system or any one factor but rather is
due to many systems interacting
in an as-yet-undefined way. The
residual zinc resistance in a
strain disrupted in both
zntA
and
zitB suggests that there are
additional factors or
systems involved in zinc
resistance.
| |
ACKNOWLEDGMENTS |
This work was supported by hatch project 136713 to C.R., U. S. Public Health Service grant GM 55425 to B.P.R., and Ni262/3-3 of the
Deutsche Forschungsgemeinschaft and Fonds der Chemischen Industrie to
D.H.N.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Soil, Water, and Environmental Science, University of Arizona, Shantz Bldg. #38 Rm. 429, Tucson, AZ 85721. Phone: (520) 626-8482. Fax: (520)
621-1647. E-mail: rensingc{at}ag.arizona.edu.
| |
REFERENCES |
| 1.
|
Anton, A.,
C. Große,
J. Reissmann,
T. Pribyl, and D. H. Nies.
1999.
CzcD is a heavy metal ion transporter involved in regulation of heavy metal resistance in Ralstonia sp. strain CH34.
J. Bacteriol.
181:6876-6881[Abstract/Free Full Text].
|
| 2.
|
Beard, S. J.,
R. Hashim,
J. Membrillo-Hernandez,
M. N. Hughes, and R. K. Poole.
1997.
Zinc(II) tolerance in Escherichia coli K12; evidence that the zntA gene (o732) encodes a cation transport ATPase.
Mol. Microbiol.
25:883-891[CrossRef][Medline].
|
| 3.
|
Beard, S. J.,
R. Hashim,
G. Wu,
M. R. B. Binet,
M. N. Hughes, and R. K. Poole.
2000.
Evidence for the transport of zinc(II) ions via the Pit inorganic phosphate transport system in Escherichia coli.
FEMS Microbiol. Lett.
184:231-235[CrossRef][Medline].
|
| 4.
|
Brocklehurst, K. R.,
J. L. Hobman,
B. Lawley,
L. Blank,
S. J. Marshall,
N. L. Brown, and A. P. Morby.
1999.
ZntR is a Zn(II)-responsive MerR-like transcriptional regulator of zntA in Escherichia coli.
Mol. Microbiol.
31:893-902[CrossRef][Medline].
|
| 5.
|
Datsenko, K. A., and B. L. Wanner.
2000.
One-step inactivation of chromosomal genes in Escherichia coli K12 using PCR products.
Proc. Natl. Acad. Sci. USA
97:6640-6645[Abstract/Free Full Text].
|
| 6.
|
Eide, D. J.
1998.
The molecular biology of metal ion transport in Saccharomyces cerevisiae.
Annu. Rev. Nutr.
18:441-469[CrossRef][Medline].
|
| 7.
|
Franke, S.,
G. Grass, and D. H. Nies.
2000.
The product of the ybdE gene of the Escherichia coli chromosome is involved in detoxification of silver ions.
Microbiology
147:965-972[Abstract/Free Full Text].
|
| 8.
|
Grass, G.,
C. Große, and D. H. Nies.
2001.
Regulation of the cnr cobalt and nickel resistance determinant from Ralstonia sp. strain CH34.
J. Bacteriol.
182:1390-1398[Abstract/Free Full Text].
|
| 9.
|
Große, C.,
G. Grass,
A. Anton,
S. Franke,
A. Navarrete Santos,
B. Lawley,
N. L. Brown, and D. H. Nies.
1999.
Transcriptional organization of the czc heavy metal homeostasis determinant from Alcaligenes eutrophus.
J. Bacteriol.
181:2385-2393[Abstract/Free Full Text].
|
| 10.
|
Huang, L., and J. Gitschier.
1997.
A novel gene involved in zinc transport is deficient in the lethal milk mouse.
Nat. Genet.
17:292-297[CrossRef][Medline].
|
| 11.
|
Kuroda, M.,
H. Hayashi, and T. Ohta.
1999.
Chromosome-determined zinc-responsible operon czr in Staphylococcus aureus strain 912.
Microbiol. Immunol.
43:115-125[Medline].
|
| 12.
|
Link, A. J.,
D. Phillips, and G. M. Church.
1997.
Methods for generating precise deletions and insertions in the genome of wild-type Escherichia coli: application to open reading frame characterization.
J. Bacteriol.
179:6228-6237[Abstract/Free Full Text].
|
| 13.
|
Mergeay, M.,
D. Nies,
H. G. Schlegel,
J. Gerits,
P. Charles, and F. van Gijsegem.
1985.
Alcaligenes eutrophus is a facultative chemolithotroph with plasmid-bound resistance to heavy metals.
J. Bacteriol.
162:328-334[Abstract/Free Full Text].
|
| 14.
|
Miller, J. H.
1992.
A short course in bacterial genetics: a laboratory manual and handbook for Escherichia coli and related bacteria.
Cold Spring Laboratory Press, Cold Spring Harbor, N.Y.
|
| 15.
|
Miyabe, S.,
S. Izawa, and Y. Inoue.
2000.
Expression of ZRC1 coding for suppressor of zinc toxicity is induced by zinc-starvation stress in Zap1-dependent fashion in Saccharomyces cerevisiae.
Biochem. Biophys. Res. Comm.
276:879-884[CrossRef][Medline].
|
| 16.
|
Mobley, H. L. T., and B. P. Rosen.
1982.
Energetics of plasmid-mediated arsenate resistance in Escherichia coli.
Proc. Natl. Acad. Sci. USA
79:6119-6122[Abstract/Free Full Text].
|
| 17.
|
Nies, D. H., and S. Silver.
1995.
Ion efflux systems involved in bacterial metal resistances.
J. Ind. Microbiol.
14:186-199[CrossRef][Medline].
|
| 18.
|
Outten, C. E.,
F. W. Outten, and T. V. O'Halloran.
1999.
DNA distortion mechanism for transcriptional activation by ZntR, a Zn(II)-responsive MerR homologue in Escherichia coli.
J. Biol. Chem.
274:37517-37524[Abstract/Free Full Text].
|
| 19.
|
Palmiter, R. D., and S. D. Findley.
1995.
Cloning and functional characterization of a mammalian zinc transporter that confers resistance to zinc.
EMBO J.
14:639-649[Medline].
|
| 20.
|
Palmiter, R. D.,
T. B. Cole, and S. D. Findley.
1996.
ZnT-2, a mammalian protein that confers resistance to zinc by facilitating vesicular sequestration.
EMBO J.
15:1784-1791[Medline].
|
| 21.
|
Palmiter, R. D.,
T. B. Cole,
C. J. Quaife, and S. D. Findley.
1996.
ZnT-3, a putative transporter of zinc into synaptic vesicles.
Proc. Natl. Acad. Sci. USA
93:14934-14939[Abstract/Free Full Text].
|
| 22.
|
Patzer, S. I., and K. Hantke.
1998.
The ZnuABC high-affinity zinc uptake system and its regulator Zur in Escherichia coli.
Mol. Microbiol.
28:1199-1210[CrossRef][Medline].
|
| 23.
|
Paulsen, I. T., and M. J. Saier.
1997.
A novel family of ubiquitous heavy metal ion transport proteins.
J. Membr. Biol.
156:99-103[CrossRef][Medline].
|
| 24.
|
Rensing, C.,
B. Mitra, and B. P. Rosen.
1997.
The zntA gene of Escherichia coli encodes a Zn(II)-translocating P-type ATPase.
Proc. Natl. Acad. Sci. USA
94:14326-14331[Abstract/Free Full Text].
|
| 25.
|
Rensing, C.,
Y. Sun,
B. Mitra, and B. P. Rosen.
1998.
Pb(II)-translocating P-type ATPases.
J. Biol. Chem.
273:32614-32617[Abstract/Free Full Text].
|
| 26.
|
Xiong, A., and R. K. Jayaswal.
1998.
Molecular characterization of a chromosomal determinant conferring resistance to zinc and cobalt ions in Staphylococcus aureus.
J. Bacteriol.
180:4024-4029[Abstract/Free Full Text].
|
Journal of Bacteriology, August 2001, p. 4664-4667, Vol. 183, No. 15
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.15.4664-4667.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lewinson, O., Lee, A. T., Rees, D. C.
(2009). A P-type ATPase importer that discriminates between essential and toxic transition metals. Proc. Natl. Acad. Sci. USA
106: 4677-4682
[Abstract]
[Full Text]
-
Helbig, K., Bleuel, C., Krauss, G. J., Nies, D. H.
(2008). Glutathione and Transition-Metal Homeostasis in Escherichia coli. J. Bacteriol.
190: 5431-5438
[Abstract]
[Full Text]
-
Leedjarv, A., Ivask, A., Virta, M.
(2008). Interplay of Different Transporters in the Mediation of Divalent Heavy Metal Resistance in Pseudomonas putida KT2440. J. Bacteriol.
190: 2680-2689
[Abstract]
[Full Text]
-
Lu, M., Fu, D.
(2007). Structure of the Zinc Transporter YiiP. Science
317: 1746-1748
[Abstract]
[Full Text]
-
Grover, A., Sharma, R.
(2006). Identification and Characterization of a Major Zn(II) Resistance Determinant of Mycobacterium smegmatis.. J. Bacteriol.
188: 7026-7032
[Abstract]
[Full Text]
-
Wei, Y., Fu, D.
(2006). Binding and Transport of Metal Ions at the Dimer Interface of the Escherichia coli Metal Transporter YiiP. J. Biol. Chem.
281: 23492-23502
[Abstract]
[Full Text]
-
Yamamoto, K., Ishihama, A.
(2005). Transcriptional Response of Escherichia coli to External Zinc. J. Bacteriol.
187: 6333-6340
[Abstract]
[Full Text]
-
Egler, M., Grosse, C., Grass, G., Nies, D. H.
(2005). Role of the Extracytoplasmic Function Protein Family Sigma Factor RpoE in Metal Resistance of Escherichia coli. J. Bacteriol.
187: 2297-2307
[Abstract]
[Full Text]
-
Grass, G., Franke, S., Taudte, N., Nies, D. H., Kucharski, L. M., Maguire, M. E., Rensing, C.
(2005). The Metal Permease ZupT from Escherichia coli Is a Transporter with a Broad Substrate Spectrum. J. Bacteriol.
187: 1604-1611
[Abstract]
[Full Text]
-
Lee, L. J., Barrett, J. A., Poole, R. K.
(2005). Genome-Wide Transcriptional Response of Chemostat-Cultured Escherichia coli to Zinc. J. Bacteriol.
187: 1124-1134
[Abstract]
[Full Text]
-
Munkelt, D., Grass, G., Nies, D. H.
(2004). The Chromosomally Encoded Cation Diffusion Facilitator Proteins DmeF and FieF from Wautersia metallidurans CH34 Are Transporters of Broad Metal Specificity. J. Bacteriol.
186: 8036-8043
[Abstract]
[Full Text]
-
Anton, A., Weltrowski, A., Haney, C. J., Franke, S., Grass, G., Rensing, C., Nies, D. H.
(2004). Characteristics of Zinc Transport by Two Bacterial Cation Diffusion Facilitators from Ralstonia metallidurans CH34 and Escherichia coli. J. Bacteriol.
186: 7499-7507
[Abstract]
[Full Text]
-
Wei, Y., Li, H., Fu, D.
(2004). Oligomeric State of the Escherichia coli Metal Transporter YiiP. J. Biol. Chem.
279: 39251-39259
[Abstract]
[Full Text]
-
Ellis, C. D., Wang, F., MacDiarmid, C. W., Clark, S., Lyons, T., Eide, D. J.
(2004). Zinc and the Msc2 zinc transporter protein are required for endoplasmic reticulum function. JCB
166: 325-335
[Abstract]
[Full Text]
-
Chao, Y., Fu, D.
(2004). Thermodynamic Studies of the Mechanism of Metal Binding to the Escherichia coli Zinc Transporter YiiP. J. Biol. Chem.
279: 17173-17180
[Abstract]
[Full Text]
-
Chao, Y., Fu, D.
(2004). Kinetic Study of the Antiport Mechanism of an Escherichia coli Zinc Transporter, ZitB. J. Biol. Chem.
279: 12043-12050
[Abstract]
[Full Text]
-
Broker, D., Arenskotter, M., Legatzki, A., Nies, D. H., Steinbuchel, A.
(2004). Characterization of the 101-Kilobase-Pair Megaplasmid pKB1, Isolated from the Rubber-Degrading Bacterium Gordonia westfalica Kb1. J. Bacteriol.
186: 212-225
[Abstract]
[Full Text]
-
Legatzki, A., Grass, G., Anton, A., Rensing, C., Nies, D. H.
(2003). Interplay of the Czc System and Two P-Type ATPases in Conferring Metal Resistance to Ralstonia metallidurans. J. Bacteriol.
185: 4354-4361
[Abstract]
[Full Text]
-
Worlock, A. J., Smith, R. L.
(2002). ZntB Is a Novel Zn2+ Transporter in Salmonella enterica Serovar Typhimurium. J. Bacteriol.
184: 4369-4373
[Abstract]
[Full Text]
-
Grass, G., Wong, M. D., Rosen, B. P., Smith, R. L., Rensing, C.
(2002). ZupT Is a Zn(II) Uptake System in Escherichia coli. J. Bacteriol.
184: 864-866
[Abstract]
[Full Text]
Top
Abstract
Text
