![[Feedback]](/icons/banner/feedbackACT.gif)
![[For Subscribers]](/icons/banner/subscriberACT.gif)
![[Archive]](/icons/banner/archiveACT.gif)
![[Search]](/icons/banner/searchACT.gif)
![[Contents]](/icons/banner/tocACT.gif)
Previous Article
Journal of Bacteriology, August 2001, p. 4674-4679, Vol. 183, No. 15
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.15.4674-4679.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Loss of Pseudomonas aeruginosa PhpA
Aminopeptidase Activity Results in Increased algD
Transcription
Samuel C.
Woolwine,
April
B.
Sprinkle, and
Daniel J.
Wozniak*
Department of Microbiology and Immunology,
Wake Forest University School of Medicine, Winston-Salem, North
Carolina 27157-1064
Received 20 October 2000/Accepted 11 May 2001
 |
ABSTRACT |
Inactivation of Pseudomonas aeruginosa phpA, encoding a
putative leucine aminopeptidase, results in increased transcription of
algD. The homologous protein in Escherichia
coli, PepA, is multifunctional, possessing independent
aminopeptidase and DNA-binding activities. Here we provide in vitro
evidence that PhpA is an aminopeptidase and show that this activity is
the relevant property with regard to algD expression. This
regulation occurred at the previously mapped algD
transcription initiation site and was not due to activation of an
alternative promoter.
| |
TEXT |
Once established in the cystic
fibrosis (CF) lung, Pseudomonas aeruginosa persists until
relentless inflammatory processes and ensuing tissue damage result in
respiratory failure. During this period of chronic infection, dramatic
changes take place in the nature of P. aeruginosa. The most
striking alteration is the assumption of a highly mucoid phenotype that
results from the synthesis of a polysaccharide called alginate
(8). The genetic control of alginate expression has been
extensively investigated (8). Many regulatory proteins are
required for maximal expression of the alginate biosynthetic operon,
including AlgB, AlgR, AlgZ, and AlgT (also referred to as AlgU or
22 [2, 8, 19]). The response regulator
AlgB shows no direct interaction with the promoter region of
algD, the first gene of the alginate biosynthetic operon.
However, algB mutants of mucoid cystic fibrosis isolates are
nonmucoid and demonstrate a significant reduction in algD
transcription. This led us to postulate the existence of an
AlgB-regulated gene encoding a product that directly affects
transcription of algD. As algR, algZ, and
algT expression is unaffected in an algB mutant
(2, 19; S. Woolwine and D. J. Wozniak, unpublished
data); these regulatory genes do not likely represent the proposed
intermediate in the algB-algD pathway. In a prior study,
transposon mutagenesis was employed to identify extragenic suppressors
of the algB nonmucoid phenotype (18). The
mucoid phenotype of one of the transposon mutants was accompanied by a
significant increase in algD transcription
(18). The transposon insertion in this strain disrupted a
previously uncharacterized gene homologous to pepA, encoding
the leucine aminopeptidase of Escherichia coli
(18). PepA also is required for the Xer-mediated site-specific recombination at the cer site of plasmid ColE1
(14). We referred to this new gene as phpA
(P. aeruginosa homologue of pepA). Our studies
with P. aeruginosa PhpA as well as the recent observation
that pepA is required for mediating pH regulation of
virulence genes in Vibrio cholerae (3) suggest
that the PepA family of proteins may also function in controlling
pathogenesis. In the present study we extend our investigation by
demonstrating a bestatin-sensitive aminopeptidase activity for PhpA and
show that it is the loss of this activity which increases
algD expression. This regulation was not due to activation
of an alternative algD promoter.
The phpA mutant exhibits increased transcription from
the previously mapped algD promoter.
Prior studies
revealed that disruption of phpA results in an increase in
algD transcription and the conversion of an algB mutant from a nonmucoid to a mucoid phenotype (18). It was
unclear if this was due to activation of a novel algD
promoter or if the phpA-mediated control was exerted at the
previously studied algD promoter (7, 19). To
distinguish this, the algD transcription initiation site was
examined by RNase protection assay. A digoxigenin-labeled riboprobe
spanning nucleotides 
174 to +110 relative to the previously described
algD transcription start site was synthesized (7, 19) and used to detect algD transcripts in total RNA
isolated from the phpA mutant and other relevant strains. In
addition, a labeled antisense probe to the omlA transcript
was included in the assay. This gene encodes an outer membrane
lipoprotein, and its expression has been found to be invariant with
regard to growth conditions and serves as an internal standard to
verify consistency in technique and integrity of the RNA sample
(12). RNase protection assays were performed with 50 µg
of total RNA and digoxigenin-labeled riboprobes to mRNA for
algD and omlA (internal standard). Riboprobes
were synthesized using the Maxiscript T7 in vitro transcription system
(Ambion, Austin, Tex.) with pSW218 (omlA) or pSW221
(algD) as the template. For labeled riboprobes, the 0.5 mM
UTP present in the transcription reaction was replaced with a mixture
of 0.3 mM UTP and 0.2 mM digoxigenin-11 UTP (Roche). RNase protection
assays were performed using an RPA III kit (Ambion). Protected
fragments were resolved by denaturing polyacrylamide gel
electrophoresis and electroblotted to nylon membranes. The protected
fragments were then visualized by immunodetection with antidigoxigenin
Fab fragments conjugated to alkaline phosphatase and the chromogenic
substrate nitroblue tetrazolium-5-bromo-4-chloro-3-indolylphosphate (Roche Molecular Biochemicals).
Figure 1A demonstrates that all detectable
algD transcription in the phpA mutant FRD920
(lane 7) originates from the same promoter as in the parental
algB strain FRD879 (lane 5). This also corresponds to the
transcription start site utilized in the algB+
strain FRD875 (lane 4). The size of the protected probe fragment is
consistent with the predicted size (110 nucleotides) based on the
previously mapped algD promoter (7, 19).
Consistent with other reports (8, 19), the algD
transcript is not detectable in an algT mutant background
such as FRD923 (lane 6). In addition to mapping the 5' end of the
algD transcript in the phpA mutant, these data
also demonstrate an increase in the amount of algD transcription in this strain compared to the parental algB
strain (compare lanes 5 and 7). Figure 1B depicts the increase in the integrated density values for each algD signal during the
course of the immunodetection. It is readily apparent that the
phpA mutant has significantly more algD
transcription than the parental algB strain and that this
control is exerted at the prior characterized algD promoter.
View larger version (33K):
[in this window]
[in a new window]
|
FIG. 1.
The phpA mutant utilizes the same
algD transcription start site as the parental strain. (A)
RNase protection assay for algD transcription. Nucleotide
values for RNA markers are indicated to the left. Identities of RNA
species are indicated to the right. Use of the algD and/or
omlA probes in each lane is indicated at the top. Lanes
contain the following RNA samples: M, Century RNA markers (Ambion);
lanes 1 to 4, FRD875 (mucA22 algD::xylE
[18]); 5, FRD879 (mucA22
algD::xylE algB::Tn501
[18]); 6, FRD923 (mucA22
algD::xylE algT::Tn501,
generated by gene replacement of algD in FRD440
[19] with algD::xylE
from pDJW530 [18]); 7, FRD920 (mucA22
algD::xylE algB::Tn501
phpA::Tn5-B50 [18]); 8, yeast
RNA, no RNase; 9, yeast RNA, no RNase. Total RNA was isolated from
P. aeruginosa strains grown in LBNS (18) as
described elsewhere (16). (B) The individual bands
corresponding to the algD transcripts from each lane in
panel A were scanned every 5 min (Hewlett Packard ScanJet Hp scanner)
during the color development phase of the immunodetection. The image
files were analyzed using AlphaEase version 4.0 (Alpha Innotech
Corporation, San Leandro, Calif.), and the integrated density value
(IDV) of the algD band from each strain was plotted versus
time.
|
|
P. aeruginosa PhpA has aminopeptidase activity.
In
our previous study, we suggested that PhpA was a functional homologue
of E. coli PepA (18). This suggestion was based on (i) the extensive sequence homology (56% identity at the amino acid
level), (ii) the presence of seven residues in particular which are
believed to be part of the active site and are absolutely conserved
among the members of this family of aminopeptidases, and (iii) the fact
that the E. coli genomic organization of pepA, holC, and valS, in that order, is reflected in the
P. aeruginosa chromosome (15). To confirm that
PhpA is an aminopeptidase, we sought to demonstrate such activity in
vitro in extracts of E. coli DS957 (pepA)
expressing PhpA in response to arabinose induction. For this purpose,
we constructed a series of plasmids based on pEX100T (13)
which would serve as both arabinose-inducible expression vectors in
E. coli as well as gene replacement vehicles allowing cloned
genes under control of PBAD to be integrated into the
algB locus of P. aeruginosa. All plasmids used in
this experiment were derived from pSW161, which was constructed by
cloning a 2,185-bp ScaI-ClaI fragment
(araC, PBAD, multiple cloning site, and
rrnB T1T2 transcription terminators)
derived from PBAD30 (9) into pUS68
(10). Plasmids pSW164 and pSW165 were constructed by
cloning a 1.9-kb HindIII fragment from pCS126 (PepA
[14]) or pRM40 (PepA E354A [11]) into
pSW161. Plasmids pSW212 (PhpA) and pSW213 (PhpA E350A) were constructed
by cloning 1.7-kb HinfI-HindIII fragments from
pSW176 and pSW177, respectively, into pSW161. To generate the
phpAI allele encoding PhpA E350A (pSW177),
oligonucleotide-directed mutagenesis was performed on phpA,
using pSW176 (wild-type phpA in pALTER-1
[18]) and the mutagenic oligonucleotide SW20 (5' CAACACCGACGCTGCAGGGCGCCTGGTG 3';
underscored bases are altered from wild type) with the Altered
Sites II in vitro mutagenesis system (Promega). pSW177 was sequenced to
verify the phpA1 mutation. These base changes result in a
Glu
Ala change at amino acid residue 350 (18), which
corresponds to the PepA E354A mutation designed by McCulloch et al.
(11).
E. coli DS957 harboring various constructs or vector
controls was cultured in Luria-Bertani medium (10 g of tryptone, 5 g of yeast extract, and 10 g of NaCl per liter) containing
ampicillin (100 µg/ml) to an optical density at 600 nm of 0.5, and
cultures were left untreated or induced with arabinose (0.5%
[wt/vol]). Incubation was continued for 2 h, after which 25 ml
of culture was pelleted, resuspended in 5 ml of TK buffer (20 mM Tris
[pH 8.2], 100 mM KCl, 1 mM magnesium acetate, 0.5 mM
MnCl2). Cell extracts were prepared by passing the
suspension through a French pressure cell (15,000 lb/in2)
and removing cell debris by centrifugation. PepA and PepA E354A were
partially purified by techniques described elsewhere (5, 11) with the exception of the KCl precipitation step. PhpA and PhpA E350A were prepared from supernatants following a 50%
(NH4)2SO4 precipitation of proteins
in the clarified extracts to remove residual aminopeptidases and an
additional (NH4)2SO4 precipitation of the supernatant [70% final
(NH4)2SO4] to precipitate PhpA and PhpA E350A. Protein concentrations were determined by the bicinchoninic acid BCA protein assay (Pierce); 25 µg of protein in 990 µl of TK
buffer was equilibrated for 15 min in a 1-cm2 cuvette at
37°C, at which time 10 µl of 100 mM L-leucine
p-nitroanilide (prepared in dimethyl sulfoxide) was added.
Reaction mixtures were incubated at 37°C, and the release of
p-nitroaniline was monitored at 400 nm. Activity was
calculated from the molar extinction coefficient of
p-nitroaniline (
400 = 1.55 × 104 M
1 cm1). The
results of three independent experiments are shown in Fig. 2A. The
results clearly indicate that expression of either E. coli
PepA (pSW164) or P. aeruginosa PhpA (pSW212) resulted in a
significant increase in the aminopeptidase activity compared to the
identically prepared vector control samples (pSW161).
View larger version (27K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Leucine aminopeptidase activities of PepA and PhpA.
Cultures of E. coli DS957 (recF
laclqZ M15,
pepA::Tn5 [11]) harboring the
indicated plasmids were grown and harvested, cytoplasmic extracts were
prepared, and PepA or PhpA was partially purified (see text).
Twenty-five micrograms of protein was used in each assay.
Aminopeptidase activity on the chromogenic substrate
L-leucine p-nitroanilide was determined by
observing the increase in absorbance at 400 nm. The averages from three
independent experiments are represented. Error bars indicate the
standard deviation of the mean. (B) Immunoblot analysis of DS957 cells
harboring a pepA or phpA plasmid. Lanes 2 to 11 contain extracts prepared as described in the text from DS597 cells
with the following plasmids: lanes 2 and 3, pSW161 (vector); lanes 4 and 5, pSW164 (PepA); lanes 6 and 7, pSW165 (PepA E354A); lanes 8 and
9, pSW212 (PhpA); lanes 10 and 11, pSW213 (PhpA E350A). Even-numbered
lanes contain extracts from noninduced cells, whereas the odd-numbered
lanes are derived from cells induced with arabinose. Lane 1 contains
purified PepA (1 µg). The positions of PepA and PhpA (or the
corresponding mutants) are indicated on the right. Numbers at the left
indicate positions of molecular size standards in kilodaltons. For
detection, 100 µg of protein was separated on a 0.1% sodium dodecyl
sulfate-12% polyacrylamide gel. Proteins were transferred to
nitrocellulose membrane using a Trans-Blot SD semidry transfer cell
(Bio-Rad). After blocking for 1 h with 10% skim milk in 20 mM
Tris-Cl (pH 7.6)-137 mM NaCl-0.1% Tween, immunoblot detection was
performed with the ECL Western blotting analysis system (Amersham
Pharmacia Biotech). Primary antibody (rabbit polyclonal anti-PepA, the
generous gift from S. Colloms) was used at a 1:5,000 dilution; the
secondary antibody was used at 1:8,000. (C) Bestatin inhibition of PhpA
aminopeptidase activity. Twenty-five-microgram aliquots of PhpA
prepared as for panel A were preincubated in the indicated
concentrations of bestatin (Sigma) for 30 min, and residual
aminopeptidase activity was determined as for panel A. Data are
depicted as a percentage of the untreated sample of PhpA [()],
which was set at 100%. The means and error bars represent standard
deviations of three independent experiments.
|
|
E. coli PepA is a multifunctional protein, possessing both
aminopeptidase and DNA-binding activities. The DNA-binding activity of
PepA is required for its role in the Xer-mediated site-specific recombination system used by plasmid ColE1 for resolving plasmid multimers. A GluAla change at residue 354 in the active site of PepA
abolishes aminopeptidase activity without affecting its function in the
Xer system (11). Consequently, there is no detectable aminopeptidase activity over baseline in preparations of DS957/pSW165 expressing PepA E354A (Fig. 2A). A corresponding amino acid
substitution in PhpA, E350A, also abolishes aminopeptidase activity.
Ammonium sulfate-enriched preparations from DS957/pSW213, expressing
PhpA E350A, show no significant aminopeptidase activity (Fig. 2A). The
absence of aminopeptidase activity in preparations of DS957/pSW165 and
DS957/pSW213 is not due to lack of expression, as immunoblot analysis
with polyclonal antiserum raised against PepA demonstrated similar
levels of expression of wild-type PepA and PepA E354A as well as
wild-type PhpA and PhpA E350A (Fig. 2B).
Loss of PhpA aminopeptidase activity results in an increase in
algD transcription.
We sought to determine if PhpA
aminopeptidase activity was required for the effect on algD
transcription. Bestatin
[(2S,3R)-(3-amino-2-hydroxy-4-phenylbutanoyl)-L-leucine] is a transition-state analog of the dipeptide substrate PheLeu and is a
competitive inhibitor of many aminopeptidases (17). We
tested whether bestatin could produce the same increase in algD transcription in the algB strain FRD879 as
the inactivation of phpA in the isogenic strain FRD920.
Bestatin has been observed to have an in vivo effect in E. coli when present in the culture at concentrations as low as 10 µM (1). We cultured FRD879
(algB::Tn501 algD::xylE) in LBNS medium (10 g of tryptone
and 5 g of yeast extract per liter) in the presence of up to 1 mM
bestatin with no demonstrable effect on algD expression
(data not shown). This raised the possibility that PhpA was insensitive
to bestatin. To test this, ammonium sulfate-enriched preparations of
PhpA (see above) were preincubated with various concentrations of
bestatin and tested for residual aminopeptidase activity. The in vitro results shown in Fig. 2C demonstrate that PhpA is clearly sensitive to
bestatin, as 60 nM bestatin was capable of inhibiting 50% of the PhpA
aminopeptidase activity.
The absence of an in vivo effect of bestatin on algD
transcription could be explained by failure of the inhibitor to
penetrate the cell, or the inhibitor could be rapidly inactivated or
effluxed out of the cell. Alternatively, the effect of PhpA on
algD may be independent of the aminopeptidase activity. This
possibility must be considered in light of what is known about E. coli PepA. As mentioned previously, PepA is required as an
accessory DNA-binding factor in the Xer-mediated site-specific
recombination at the cer site of plasmid ColE1
(14). In addition, PepA binds upstream and represses
transcription of its own gene, pepA, and of the carAB operon (4, 5). Neither of these PepA
functions requires the aminopeptidase activity (5, 11).
Therefore, it is possible that PhpA also possesses
aminopeptidase-independent functions that may include regulation of
algD transcription. To address this, we used allelic
exchange with pSW212 and pSW213 to place either wild-type
phpA or phpA1 at the algB locus in the
algB::Tn501 phpA::Tn5-B50
algD::xylE strain FRD920. The resulting
strains, FRD982 and FRD984, express wild-type PhpA and PhpA E350A,
respectively, in response to arabinose. XylE activity was used to
determine the level of algD transcription in these strains
as well as the reference strains FRD875 (algB+),
FRD879 (algB::Tn501), and FRD920
(algB::Tn501
phpA::Tn5-B50); the results are shown in Fig.
3. Inactivation of algB (FRD879) results in
an eightfold decrease in algD expression compared to the
parental algB+ strain FRD875. However,
inactivation of phpA (FRD920) partially restores
algD transcription, resulting in a significant increase in
algD-xylE activity (compare samples 1 to 4). This
increase in algD transcription is sufficient to confer a
mucoid phenotype in the corresponding algD+
strain (18). Significantly, expression of algD
was reversed when wild-type PhpA but not PhpA E350A was expressed
(samples 5 to 8). Therefore, phpA1 is unable to complement
the effect of phpA::Tn5-B50 on
algD transcription. This provides strong genetic evidence
that the aminopeptidase activity of PhpA is responsible for the
inhibitory effect on algD expression.
View larger version (26K):
[in this window]
[in a new window]
|
FIG. 3.
Loss of PhpA aminopeptidase activity results in
increased algD transcription. Allelic exchange (13,
18) was used to replace the
algB::Tn501 allele of FRD879 with the
phpA, phpA1, or wild-type or mutant pepA allele,
all under control of the PBAD promoter, using
plasmids pSW212, pSW213, pSW164, and pSW165, respectively. Strains and
ectopic proteins expressed at the algB locus are indicated.
The strains tested were FRD875, FRD879, and FRD920 (see legends to Fig.
1 and 2), FRD982 (mucA22 algB::pBAD-phpA
phpA::Tn5-B50
algD::xylE aacCl), FRD984 (mucA22
algB::pBAD-phpA1
phpA::Tn5-B50
algD::xylE aacCl), FRD945 (mucA22
algB::pBAD-pepA
phpA::Tn5-B50
algD::xylE aacCl), and FRD946
(mucA22 algB::pBAD-pepA [E354A]
phpA::Tn5-B50
algD::xylE aacCl). The level of
algD transcription in these strains was measured as
previously described (18) by the XylE activity produced
from the algD::xylE transcription
fusion. The averages from three independent experiments are
represented. Error bars represent the standard deviation of the mean.
Activity was calculated from the molar extinction coefficient of the
reaction product,  -hydroxymuconic -semialdehyde
(375 = 4.4 × 104 M1
cm1).
|
|
One caveat to the interpretation of these results is the assumption
that the PhpA E350A mutation only abolishes the aminopeptidase activity
and does not disrupt the overall structure of the protein or interfere
with any other function. The E350A substitution was chosen because it
corresponds to the substitution in PepA E354A. To validate the
interpretation of the phpA results, we used the pepA alleles to perform complementation of
phpA::Tn5-B50. Allelic exchange was used to place
pepA alleles encoding either wild-type PepA or PepA E354A at
the algB locus of FRD920. Induction of PepA in strain FRD945
produced a pronounced decrease in algD expression (Fig. 3,
samples 9 and 10), whereas expression of PepA E354A in strain FRD946
failed to decrease algD expression (samples 11 and 12). As
was the case for expression in E. coli DS957, PhpA, PhpA E350A, PepA, and PepA E354A were expressed in P. aeruginosa
to the same degree, as demonstrated by immunoblot analysis (data not
shown). These data support the hypothesis that the loss of PhpA
aminopeptidase activity is responsible for increased algD transcription.
In this study, we demonstrate the aminopeptidase activity of PhpA in
vitro and show that the loss of this activity in an algB mutant correlates with an increase in algD transcription.
The tightly controlled PBAD promoter (9) was
used to demonstrate that expression of either wild-type phpA
or E. coli pepA complemented the phpA mutant,
while alleles encoding an aminopeptidase-deficient protein (PepA E354A
or PhpA E350A) failed to complement. PepA E354A serves as an important
control in this experiment. It has been shown that PepA E354A is still
functional in Xer-mediated site-specific recombination
(11), and so it is unlikely that failure of PepA E354A to
complement the phpA mutation results from protein misfolding
due to the amino acid substitution. Thus, aminopeptidase activity is
the relevant function of PhpA as far as alginate expression is concerned.
The work presented here raises some interesting questions. For example,
how does the physiological defect in the phpA strain result
in transcriptional activation of algD? As the bulk nutrient of the culture medium used in our investigations consists of peptides, one might assume that phpA mutants are less efficient at
utilizing the medium and this might be relayed to algD
expression. Indeed, the phpA strain does exhibit a growth
defect, with a doubling time in LBNS of 90 min, compared to 60 min for
the parental algB strain (data not shown). This suggested
that a deficiency of one or more amino acids might be a stimulus for
increased alginate expression. However, supplementing the medium with
free amino acids (2 mM) did not have a significant effect on
algD expression (data not shown). Another plausible
explanation for the effect of the loss of PhpA aminopeptidase activity
on alginate expression deals with turnover of endogenous protein.
Misfolded or aggregated proteins have been shown to induce the
extracytoplasmic stress response (6). This response is
mediated, in part, by the ECF family of sigma factors, of which
P. aeruginosa AlgT is a member (8). If the
phpA strain is defective in hydrolyzing peptides that have
arisen due to degradation of misfolded, senescent, or aggregated
proteins, this may lead to an increase in AlgT activity and subsequent
increases in algD expression. These possibilities are under investigation.
| |
ACKNOWLEDGMENTS |
Public Health Service grants AI-35177 and HL-58334 (D.J.W.)
supported this work.
We thank H. Schweizer for pEX100T, pX1918G, and pX1918GT, which served
as the basis for our allelic exchange and transcriptional fusion
technology. We are grateful to S. Colloms for providing pCS126, pRM40,
purified PepA, and polyclonal anti-PepA antibody. Much gratitude is
extended to S. Ma for PBAD30, which was used in the
construction of the arabinose-inducible expression vectors.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, Wake Forest University School of Medicine, Winston-Salem, NC 27157-1064. Phone: (336) 716-2016. Fax: (336) 716-9928. E-mail: dwozniak{at}wfubmc.edu.
Present address: Departments of Medicine, Johns Hopkins University
School of Medicine, Baltimore, MD 21205.
| |
REFERENCES |
| 1.
|
Atherton, F. R.,
M. J. Hall,
C. H. Hassall,
S. W. Holmes,
R. W. Lambert,
W. J. Lloyd,
L. J. Nisbet,
P. S. Ringrose, and D. Westmacott.
1981.
Antibacterial properties of alafosfalin combined with cephalexin.
Antimicrob. Agents Chemother.
20:470-476[Abstract/Free Full Text].
|
| 2.
|
Baynham, P. J., and D. J. Wozniak.
1996.
Identification and characterization of AlgZ, and AlgT-dependent DNA binding protein required for Pseudomonas aeruginosa algD transcription.
Mol. Microbiol.
22:97-108[CrossRef][Medline].
|
| 3.
|
Behari, J.,
L. Stagon, and S. B. Calderwood.
2001.
pepA, a gene mediating pH regulation of virulence genes in Vibrio cholerae.
J. Bacteriol.
183:178-188[Abstract/Free Full Text].
|
| 4.
|
Charlier, D.,
D. Gigot,
N. Huysveld,
M. Roovers,
A. Piérard, and N. Glansdorff.
1995.
Pyrimidine regulation of the Escherichia coli and Salmonella typhimurium carAB operons: CarP and integration host factor (IHF) modulate the methylation status of a GATC site present in the control region.
J. Mol. Biol.
250:383-391[CrossRef][Medline].
|
| 5.
|
Charlier, D.,
G. Hassanzadeh,
A. Kholti,
D. Gigot,
A. Piérard, and N. Glansdorff.
1995.
carP, involved in pyrimidine regulation of the Escherichia coli carbamoylphosphate synthetase operon encodes a sequence-specific DNA-binding protein identical to XerB and PepA, also required for resolution of ColE1 multimers.
J. Mol. Biol.
250:392-406[CrossRef][Medline].
|
| 6.
|
Connolly, L.,
A. De Las Penas,
B. M. Alba, and C. A. Gross.
1997.
The response to extracytoplasmic stress in Escherichia coli is controlled by partially overlapping pathways.
Genes Dev.
11:2012-2021[Abstract/Free Full Text].
|
| 7.
|
Deretic, V.,
J. F. Gill, and A. M. Chakrabarty.
1987.
Pseudomonas aeruginosa infection in cystic fibrosis: nucleotide sequence and transcriptional regulation of the algD gene.
Nucleic Acids Res.
11:4567-4581.
|
| 8.
|
Govan, J. R. W., and V. Deretic.
1996.
Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia.
Microbiol. Rev.
60:539-574[Abstract/Free Full Text].
|
| 9.
|
Guzman, L. M.,
D. Belin,
M. J. Carson, and J. Beckwith.
1995.
Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter.
J. Bacteriol.
177:4121-4130[Abstract/Free Full Text].
|
| 10.
|
Ma, S.,
U. Selvaraj,
D. E. Ohman,
R. Quarless,
D. J. Hassett, and D. J. Wozniak.
1998.
Phosphorylation-independent activity of the response regulators AlgB and AlgR in promoting alginate biosynthesis in mucoid Pseudomonas aeruginosa.
J. Bacteriol.
180:956-968[Abstract/Free Full Text].
|
| 11.
|
McCulloch, R.,
M. E. Burke, and D. J. Sherratt.
1994.
Peptidase activity of Escherichia coli aminopeptidase A is not required for its role in Xer site-specific recombination.
Mol. Microbiol.
12:241-251[CrossRef][Medline].
|
| 12.
|
Ochsner, U. A.,
A. I. Vasil,
Z. Johnson, and M. L. Vasil.
1999.
Pseudomonas aeruginosa fur overlaps with a gene encoding a novel outer membrane lipoprotein, OmlA.
J. Bacteriol.
181:1099-1109[Abstract/Free Full Text].
|
| 13.
|
Schweizer, H. P., and T. T. Hoang.
1995.
An improved system for gene replacement and xylE fusion analysis in Pseudomonas aeruginosa.
Gene
158:15-22[CrossRef][Medline].
|
| 14.
|
Stirling, C. J.,
S. D. Colloms,
J. F. Collins,
G. Szatmari, and D. J. Sherratt.
1989.
xerB, an Escherichia coli gene required for plasmid ColE1 site-specific recombination, is identical to pepA, encoding aminopeptidase A, a protein with substantial similarity to bovine lens leucine aminopeptidase.
EMBO. J.
8:1623-1627[Medline].
|
| 15.
|
Stover, C. K.,
X. Q. Pham,
A. L. Erwin,
S. D. Mizoguchi,
P. Warrener,
M. J. Hickey,
F. S. L. Brinkman,
W. O. Hufnagle,
D. J. Kowalik,
M. Lagrou,
R. L. Garber,
L. Goltry,
E. Tolentino,
S. Westbrock-Wadman,
Y. Yuan,
L. L. Brody,
S. N. Coulter,
K. R. Folger,
A. Kas,
K. Larbig,
R. Lim,
K. Smith,
D. Spencer,
G. K.-S. Wong,
Z. Wu,
I. T. Paulsenk,
J. Reizer,
M. H. Saier,
R. E. W. Hancock,
S. Lory, and M. V. Olson.
2000.
Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen.
Nature
406:959-964[CrossRef][Medline].
|
| 16.
|
Summers, W. C.
1970.
A simple method for extraction of RNA from E. coli utilizing diethylpyrocarbonate.
Anal. Biochem.
33:459-463[CrossRef][Medline].
|
| 17.
|
Taylor, A.
1993.
Aminopeptidases: structure and function.
FASEB J.
7:290-298[Abstract].
|
| 18.
|
Woolwine, S., and D. J. Wozniak.
1999.
Identification of an Escherichia coli pepA homolog and its involvement in suppression of the algB phenotype in mucoid Pseudomonas aeruginosa.
J. Bacteriol.
181:107-116[Abstract/Free Full Text].
|
| 19.
|
Wozniak, D. J., and D. E. Ohman.
1994.
Transcriptional analysis of the Pseudomonas aeruginosa genes algR, algB, and algD reveals a hierarchy of alginate gene expression which is modulated by algT.
J. Bacteriol.
176:6007-6014[Abstract/Free Full Text].
|
Journal of Bacteriology, August 2001, p. 4674-4679, Vol. 183, No. 15
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.15.4674-4679.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Baynham, P. J., Ramsey, D. M., Gvozdyev, B. V., Cordonnier, E. M., Wozniak, D. J.
(2006). The Pseudomonas aeruginosa Ribbon-Helix-Helix DNA-Binding Protein AlgZ (AmrZ) Controls Twitching Motility and Biogenesis of Type IV Pili. J. Bacteriol.
188: 132-140
[Abstract]
[Full Text]
-
Sarkisova, S., Patrauchan, M. A., Berglund, D., Nivens, D. E., Franklin, M. J.
(2005). Calcium-Induced Virulence Factors Associated with the Extracellular Matrix of Mucoid Pseudomonas aeruginosa Biofilms. J. Bacteriol.
187: 4327-4337
[Abstract]
[Full Text]
-
Wyckoff, T. J. O., Thomas, B., Hassett, D. J., Wozniak, D. J.
(2002). Static growth of mucoid Pseudomonas aeruginosa selects for non-mucoid variants that have acquired flagellum-dependent motility. Microbiology
148: 3423-3430
[Abstract]
[Full Text]
Top
Abstract
Text
