Previous Article | Next Article ![]()
Journal of Bacteriology, August 2001, p. 4687-4693, Vol. 183, No. 16
Department of Bacteriology, University of
Wisconsin
Received 9 March 2001/Accepted 14 May 2001
Xenorhabdus nematophilus, a gram-negative bacterium, is
a mutualist of Steinernema carpocapsae nematodes and a
pathogen of larval-stage insects. We use this organism as a model of
host-microbe interactions to identify the functions bacteria require
for mutualism, pathogenesis, or both. In many gram-negative bacteria,
the transcription factor All eukaryotes interact with
microbes in relationships that can be benign, beneficial, or
detrimental to one or both organisms. Research to elucidate the
molecular mechanisms of host-microbe interactions has focused primarily
on pathogenic relationships. Less well studied are the long-term
mutualistic relationships of microbes that are intimately associated
with plant or animal hosts. Recent studies have suggested that
pathogens and mutualists use similar molecular strategies to interact
with their hosts. For example, both pathogenic and mutualistic bacteria
use type III secretion systems to deliver proteins directly into host
cells and initiate specific host cell responses (13, 38).
The mutualistic association between Vibrio fischeri bacteria
and Euprymna scolopes squid also bears a striking
resemblance to the interactions between pathogens and immune systems
(28). The squid produces a halide peroxidase that converts
hydrogen peroxide into hypohalous acid, a microbicidal compound that
may help kill pathogens (46). V. fischeri
requires a periplasmic catalase, which can prevent hypohalous acid
formation, to competitively colonize the squid. This scenario mirrors
the competition typically associated with pathogenic bacterium-host interactions, and yet V. fischeri and E. scolopes
live together in a mutually beneficial relationship (43).
If the molecular cross-talk between host and microbe is fundamentally
similar in mutualistic and pathogenic relationships then one must raise
the following question: what mechanisms distinguish these two relationships?
The gram-negative Investigations of the molecular mechanisms of mutualism and
pathogenicity in a single organism should provide insights into both
beneficial and detrimental interactions of microbes with their plant
and animal hosts. X. nematophilus is particularly well
suited for such experimental studies because: (i) it is genetically and
technically tractable; (ii) it can be cultivated under laboratory conditions in the absence of its eukaryotic hosts; and (iii) its mutualistic and pathogenic interactions with its hosts can be assayed
separately and easily. Thus, each aspect of the host-microbe interaction can be dissected and analyzed individually. In addition, insect hosts such as Galleria mellonella (wax moth) and
Manduca sexta (tobacco hornworm) can be maintained
inexpensively. Nematodes can also be propagated easily; 105
nematodes can be generated from the infection of a single insect host,
and bacterium-free nematode eggs can be isolated and grown on selected
lawns of bacteria in the absence of an insect host.
Like many bacteria that interact with plant or animal hosts, X. nematophilus presumably possesses the capacity to adapt to and
exploit host environments because it can sense and respond to changes
in nutrient availability, pH, osmolarity, temperature, oxygen, carbon
dioxide, and nitrogen (16). In many gram-negative bacteria, the transcription factor We have investigated the possibility that Bacterial strains and plasmids.
X. nematophilus
strains used were ATCC 19061 and its rpoS mutant derivative,
HGB151. Escherichia coli strains used were ZK918 (4) harboring an rpoS::kan
insertion, DH5
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.16.4687-4693.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Xenorhabdus nematophilus as a Model for Host-Bacterium
Interactions: rpoS Is Necessary for Mutualism with
Nematodes
Madison, Madison, Wisconsin 53706
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
S controls regulons that can
mediate stress resistance, survival, or host interactions. Therefore,
we examined the role of
S in the ability of X. nematophilus to interact with its hosts. We cloned, sequenced,
and disrupted the X. nematophilus rpoS gene that encodes
S. The X. nematophilus rpoS mutant
pathogenized insects as well as its wild-type parent. However, the
rpoS mutant could not mutualistically colonize nematode
intestines. To our knowledge, this is the first report of a specific
allele that affects the ability of X. nematophilus to exist
within nematode intestines, an important step in understanding the
molecular mechanisms of this association.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-proteobacterium Xenorhabdus
nematophilus possesses specific relationships with two types of
eukaryotic hosts: a species-specific mutualistic relationship with the
nematode Steinernema carpocapsae and a pathogenic
relationship with a wide range of insect species (11).
X. nematophilus resides as a mutualistic symbiont in a
specialized intestinal vesicle of the free-living stage of the
nematode. Together, the nematode and its X. nematophilus symbionts infect, kill, and reproduce inside the larval stage of many
insects (21). X. nematophilus is primarily
responsible for killing the insect host; it produces exo- and
endotoxins to which the insect succumbs within 48 h of infection
(7, 10). Once inside an insect host, X. nematophilus also expresses proteases and lipases that likely
degrade insect host tissues into smaller products that can be utilized
by the nematode (3, 11). Thus, X. nematophilus represents both bacterial symbionts that form stable
relationships with hosts and bacterial pathogens that invade and kill hosts.
S mediates, in part,
the response to these factors.
S controls a regulon that
can mediate stress resistance, survival, or host interactions. For
example, in Pseudomonas fluorescens Pf-5,
S
is required for survival on plant surfaces and affects biocontrol antibiotic production (40). The
S of the
insect pathogen Serratia entomophila controls expression of an insect toxin (15). Salmonella enterica
serovar Typhimurium
S controls expression of
spv virulence genes necessary for systemic infection
(36) and appears to be important for S. enterica serovar Typhimurium colonization of gut-associated
lymphoid tissue of mice (33).
S might
mediate X. nematophilus mutualistic and/or pathogenic
functions. We isolated, sequenced, and disrupted rpoS, the
gene that encodes
S in X. nematophilus. We
determined that the X. nematophilus rpoS mutant is at least
as virulent as its wild-type parent and reproduces as well as the wild
type in insecta. In contrast, the rpoS mutant fails to
colonize nematode intestines. To our knowledge, this work represents
the first characterization of a gene that affects the ability of
X. nematophilus to exist within nematode intestines and
provides insight into the processes that mediate this interaction.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
(Bethesda Research Laboratories, Gaithersburg, Md.)
for plasmid maintenance, and S17-1
pir (42) for conjugations.
Bacterial media and growth conditions.
Permanent stocks of
all strains were maintained at
80°C in Luria-Bertani medium (LB)
broth (29) supplemented with 15% (vol/vol) glycerol or 10% (vol/vol) dimethyl sulfoxide (Sigma). X. nematophilus was grown at 30°C in LB that either had been stored
in the dark or was supplemented with 0.1% (wt/vol) pyruvate
(48). E. coli strains were grown at 30°C in
LB. rpoS complementation experiments were performed on
MacConkey-lactose agar (Difco). Dye uptake was analyzed on NBTA
(14). The following supplements were added when required:
ampicillin (150 µg/ml), kanamycin (50 µg/ml for E. coli
and 20 µg/ml for X. nematophilus), and
chloramphenicol (30 µg/ml). To monitor CFU, cultures were serially
diluted in M63 salts (29) and plated on LB. To support
nematode growth, X. nematophilus was plated on lipid agar
(LA; 8 g of nutrient broth, 5 g of yeast extract, 2 g of
MgCl2, 7 ml of corn syrup [Karo], 4 ml of corn oil
[Sigma], and 15 g of Bacto Agar [Difco] per liter) and incubated
for 24 h before addition of nematodes (see below).
DNA manipulations.
Chromosomal DNA preparations, ligations,
electrophoresis, E. coli transformation and electroporation,
and Southern blotting were carried out by standard procedures
(39). Plasmid DNA was isolated with Quantum Prep kits
(Bio-Rad). Plasmids were introduced into X. nematophilus by
conjugal transfer (12) or transformation (49). Restriction enzymes and DNA-modifying enzymes were
obtained from Promega. For sequencing the 3' flanking region of
rpoS, arbitrary PCR was performed as described elsewhere
(6), with
20GAP as the first-round primer
(5'GTGTGCCAGCTCTCTTGCA3') and
20END as the second-round
primer (5'AGAGTGCGTCAGATTCAAGT3').
Genomic library construction. X. nematophilus chromosomal DNA was sonicated and size fractionated by gel purification to give a pool of fragments between 2 and 10 kb. These fragments were ligated to SfiI linkers and cloned into pAC215 (provided by Andrew Camilli, Tufts University) digested with SfiI (24).
Isolation of a plasmid encoding rpoS from X. nematophilus.
The library was introduced into strain ZK918,
which lacks functional
S and therefore appears white on
MacConkey-lactose agar. Red transformants were tested for catalase
activity by monitoring bubbling upon exposure to
H2O2 (51). Restriction analysis of
a clone conferring positive
-galactosidase and catalase activities
on ZK918 (indicating a
S coding region present on the
clone) revealed an insert of ~1.5 kb. This plasmid, designated
prpoS15, was selected for sequencing.
Sequence analysis of rpoS.
DNA sequencing was
carried out by the University of Wisconsin
Madison (UW-Madison)
Biotechnology Sequencing Center, sequences were analyzed with MegAlign
(DNASTAR Inc.), and database searches were conducted on the National
Center for Biotechnology Information BLAST server.
Construction of an rpoS insertion mutation. An X. nematophilus mutant with a kan cassette in the rpoS coding region was created as follows. prpoS::kan was conjugated into X. nematophilus. Of 100 Kanr exconjugants tested, 11 were Cms, suggesting they had undergone allelic exchange and lost the wild-type copy of rpoS and the plasmid vehicle. This was confirmed by analyzing the size of PCR amplification products (data not shown) with primers XNBAUP and XnHind (see above). In addition, Southern hybridization was performed (data not shown) with an rpoS-specific probe (obtained by PCR amplification from pBCrpoS using the primers revgap [5'CAAGGGAAAATCCGTAA3'] and rpomia [5'AATAAAAAGGTGGGGTCCATAA3']) or a kan-specific probe (obtained by BamHI digestion of mini-Tn10-kan). One Kanr Cms exconjugant was selected and designated HGB151.
Phenotypic assays. Plate assays were performed for protease (2), lipase (41), and antibiotic (26) activities, with Bacillus subtilis AD623 (courtesy of Adam Driks, Loyola University of Chicago) and Micrococcus luteus (Department of Bacteriology, UW-Madison Strain Collection no. 2001) as antibiotic indicator strains. In addition, protease activity was monitored by single-dimension zymography (34). Motility on 0.25% (wt/vol) LB agar was monitored after 10 µl of 16-h LB cultures was spotted on plates. Crystal proteins in 48-h X. nematophilus cultures were visualized by phase-contrast microscopy. Outer membrane protein profiles (12) of bacteria and the ability of bacteria to attach to plastic (35) were assayed as described elsewhere.
Bacterial survival assays. Starvation survival in LB broth was measured by taking 10-µl samples every 24 h to determine CFU/per milliliter. To monitor survival on solid media, 1 ml of 16-h X. nematophilus culture was poured uniformly over 12 sterile 13-mm MF filter membranes (Millipore) on an agar plate (LB and LA were used with similar results) and incubated at room temperature. Every 3 days, one filter was removed and its lawn was resuspended in 1 ml of M63 salts before dilution and plating. To measure sensitivity to osmotic stress or H2O2, 16-h LB cultures were washed once with M63 and resuspended in M63 with 2 mM NaCl or 10 mM H2O2, respectively. Resuspended cells were incubated at room temperature, and samples were taken at indicated times to determine CFU.
Nematode growth conditions. S. carpocapsae (strain All) was maintained by passage through larval-stage G. mellonella (Vanderhorst Wholesale Inc., St. Marys, Ohio) and harvested on White traps (47). Nematodes were also cultivated on X. nematophilus lawns seeded with either 500 to 800 infective-juvenile-stage nematodes or 1,500 first-instar-juvenile-stage nematodes (isolation described below) and incubated at room temperature. Infective-juvenile-stage nematodes were harvested from bacterial lawns by placing the agar slab in a petri dish lid floating in sterile deionized H2O. Nematode eggs were isolated from adult female nematodes as described elsewhere (44) except that the eggs were washed and resuspended in LB. The nematode eggs were incubated at room temperature for 16 h, and hatching into first-instar juveniles was visually assessed under a dissecting microscope.
Guillotine assay. To visualize bacteria, the heads of individual infective juvenile nematodes were severed with a razor blade, causing the foregut to be extruded. Dissected nematodes were stained with 0.1% (wt/vol) crystal violet and observed by bright-field microscopy. At least 30 foreguts from each of three independent cocultivations on each strain of bacteria were observed for the presence of bacteria. To determine CFU of internal bacteria per milliliter, nematodes were surface sterilized with 2% (vol/vol) NaOCl, resuspended in 5 ml of LB, and ground in a Ten Broeck tissue grinder. The homogenate was then serially diluted and plated.
Pathogenesis assays. M. sexta eggs (Walter Goodman [UW-Madison] or Carolina) were raised on an artificial diet (gypsy moth wheat germ agar; ICN). Third, fourth, or fifth instars were injected with bacteria as follows. Sixteen-hour cultures were washed once in M63 and then resuspended and diluted 10-fold in the same medium; cell counts were estimated by phase-contrast microscopy using a Petroff-Hausser counter. Washed cells were then further diluted in M63, and the number of CFU was determined for each dilution injected. Insects were injected with bacteria using a syringe with a 30-gauge needle (Hamilton) and then incubated at 26°C under 16 h-8 h light-dark periods with a constant supply of food. Insect death was monitored every 12 h. Percent mortality data are given for the 48-h observation since no further death occurred during an additional 7 days of observation. Bacterial growth inside M. sexta was determined by plating hemolymph samples extracted with a 30-gauge needle syringe from insect carcasses every 24 h after death.
Statistical analyses. Arcsin-square-root-transformed mortality data were analyzed by analysis of variance (ANOVA) on grouped injection levels of bacteria (shown in Table 1) as well as regression analyses using the actual plate counts of injected bacteria (data not shown) as the independent variable. Statistical analyses of injection data were performed using SAS version 8 (SAS Institute Inc., Cary, N.C.). Log-transformed in insecta bacterial growth data were analyzed using two-way ANOVA (strain and time as main factors). Statistical analyses of growth data were performed using Minitab 12.1 (Minitab Inc., State College, Pa.).
Nucleotide sequence accession number. The rpoS sequence reported in this study has been submitted to GenBank under accession number AF198628.
| |
RESULTS |
|---|
|
|
|---|
Cloning and characterization of the X. nematophilus
rpoS gene.
We cloned the X. nematophilus rpoS
homolog by complementation in ZK918, an E. coli strain with
a disrupted rpoS gene and a
S-dependent
bolAp1::lacZ fusion (4).
ZK918 was transformed with an X. nematophilus chromosomal
library (see Materials and Methods) and screened for red colonies on
MacConkey-lactose. Red colonies were then tested for catalase activity,
indicating the presence of a plasmid that encodes a functional
S. From ~105 colonies screened, we
identified one transformant that harbored an rpoS candidate
(prpoS15). prpoS15 contains an insert of ~1.5 kb that we
sequenced in its entirety on both strands. Sequence analysis revealed
an open reading frame (ORF), incomplete at its 3' end, with similarity
to E. coli rpoS (31). As in E. coli, immediately upstream and in the same orientation as rpoS
resides a 154-amino-acid ORF, incomplete at its 5' end, whose predicted product shares 78% identity and 88% similarity with the C terminus of
E. coli NlpD, a putative lipoprotein (20). The
expected stop codon of the putative X. nematophilus nlpD
gene sits 52 nucleotides upstream of the rpoS predicted
translational start site.
S. This sequencing also revealed
39 codons of a putative ORF, incomplete at its 5' end, 134 nucleotides downstream of the predicted rpoS stop codon
and convergently transcribed. The predicted product of this ORF
possesses 62% identity and 86% similarity with the C terminus of a
S. enterica serovar Typhimurium hydroxylase involved in the
synthesis of 2-methylthio-cis-ribozeatin in tRNA, encoded by
miaE (37). The presence of a miaE
homolog downstream of rpoS contrasts with the genomic
organization of E. coli in which a convergently transcribed
ORF of unknown function (orf454) resides downstream of rpoS
(5).
Construction and phenotypic characterization of an X. nematophilus rpoS mutant. We constructed the rpoS mutant strain HGB151 by allelic exchange with prpoS::kan, a plasmid that harbors a kan cassette inserted into rpoS (see Materials and Methods for details). The kan insertion in rpoS is unlikely to exert a polar effect on miaE because of its convergent transcription. To identify functions that might be affected by a loss of rpoS, we examined several phenotypic traits of HGB151. In our assays, the rpoS mutant produced protease, antibiotic, lipase, and crystal proteins at levels indistinguishable from those of the wild-type (data not shown). In addition, the lesion in rpoS exerted no effect on production of outer membrane proteins (including the stationary-phase-induced OpnB and OpnS proteins), exponential growth rate, stationary-phase cell morphology, or the ability to attach to an abiotic surface (data not shown). We examined motility on 0.25% (wt/vol) agar and found that the rpoS mutant reproducibly migrated farther from the point of inoculation than did the wild type. rpoS supplied from pBCrpoS restored motility to its normal pattern (data not shown).
Influence of the rpoS insertion mutation on X. nematophilus stress resistance.
In many bacteria, disruption
of rpoS causes increased sensitivity to environmental
stresses such as starvation, high osmolarity, and reactive oxygen
species (8, 9, 17, 18, 25, 50). For example, E. coli
rpoS mutants do not survive starvation in liquid culture as
well as their wild-type parents (23, 27, 32). To examine
starvation survival in X. nematophilus, we monitored persistence of the rpoS mutant and its wild-type parent in
liquid LB (Fig. 1A). Wild-type X. nematophilus exhibited a rapid decline in CFU/per milliliter in
liquid culture; we detected no CFU by day 4 after inoculation.
The rpoS mutant also had a rapid declined in CFU per
milliliter but consistently survived 1 day longer than the wild
type. The latter result is not unprecedented, as an rpoS mutation in Legionella pneumophila confers a reproducible
delay in the decline of CFU (17).
|
Effect of the rpoS mutation on X. nematophilus-nematode interactions.
We investigated
whether X. nematophilus requires rpoS to support
nematode growth and/or to colonize nematode intestines. Sterile nematode eggs can hatch, develop, and reproduce on lawns of X. nematophilus bacteria (Fig.
2A). When nutrients are
exhausted, nematodes develop into the infective juvenile stage (Fig.
2B) and migrate off the agar plate. Infective juvenile nematodes
harbor wild-type X. nematophilus in the anterior
portion of the intestine, which can be visualized by the
guillotine assay (see Materials and Methods). To determine if
nematodes exhibit altered growth and development on X. nematophilus lacking rpoS, we added sterile eggs to
lawns of wild-type or rpoS mutant cells (Fig. 2A). Nematode development on, and the final yield of infective juvenile nematodes from, rpoS mutant lawns was indistinguishable from that
obtained on wild-type lawns (data not shown), suggesting that X. nematophilus does not require
S to support nematode
development. To ascertain if X. nematophilus requires
rpoS to inhabit nematode intestines, we analyzed progeny infective juvenile nematodes from in vitro cultivations for the presence of bacteria (Fig. 2C). We observed no X. nematophilus rpoS bacteria in nematode intestines; 0% of infective juvenile nematodes reared on rpoS mutant lawns carried bacteria (Fig.
2C, image b), compared to 96% of infective juvenile nematodes from wild-type lawns (Fig. 2C, image a). We confirmed this result by surface
sterilizing, crushing, and plating infective juvenile nematodes for
CFU. With this method we detected 55 ± 6 CFU per infective
juvenile (average and standard deviation of three replicates) in
nematodes cultivated on wild-type bacteria with an intact
rpoS gene. In contrast, infective juvenile nematodes
harvested from rpoS mutant lawns (performed in
triplicate) yielded no colonies (detection limit of 0.005 CFU per
infective juvenile). This result further demonstrates that X. nematophilus requires rpoS to exist in the intestines
of infective juvenile nematodes.
|
S regulates the
production of an extracellular factor necessary for colonization. If
so, the rpoS mutant should obtain such a factor by
cocultivation with wild-type X. nematophilus. To test this possibility, we cultivated nematodes on mixed lawns of the rpoS mutant and its wild-type parent (neither the wild type
nor the rpoS mutant was at a competitive survival
disadvantage in mixed lawns for the duration of the experiment [data
not shown]). Ninety-five percent of the infective juvenile nematodes
emerging from these mixed lawns carried bacteria (as visualized by
guillotine assay of 43 nematodes), a number similar to that obtained in
infective juvenile nematodes cultivated on wild-type lawns alone.
This finding indicates that disruption of rpoS does not
cause the synthesis of an extracellular factor that inhibits
colonization. Next, we surface sterilized, crushed, and plated
infective juvenile nematodes to determine the number of CFU (data not
shown). Colonies formed on LB (a medium on which both wild-type and
rpoS mutant cells can grow) but not on LB supplemented with
kanamycin (on which only rpoS mutant cells can grow; limit
of detection was 0.005 rpoS mutant CFU per infective
juvenile). These results suggest that the presence of wild-type cells
cannot extracellularly complement the inability of the rpoS
mutant to exist in infective juvenile nematode intestines.
Effect of the rpoS mutation on virulence toward and
survival within insects.
A powerful aspect of the X. nematophilus model system is that both mutualistic and pathogenic
functions can be assayed separately. Thus, although the mutualism
defect of the rpoS mutant prevents it from infecting insects
via the nematode, the role of rpoS in virulence can still be
monitored by injection. As few as 5 CFU of wild-type X. nematophilus can kill insects when injected directly into their
blood (hemolymph) (11). To determine if the
rpoS mutation affects X. nematophilus
virulence, we injected wild-type or rpoS mutant cells into
M. sexta larvae and monitored insect mortality at 48 h
postinjection (Table 1). The
rpoS mutant cells killed insects at least as well as the
wild-type cells. ANOVA on grouped injection levels shown in Table 1
indicated no significant difference between the strains (P > 0.05), as did linear regression analysis using actual plate
counts of injected bacteria (P > 0.05). However, a
quadratic model best fits the data, and quadratic regression analyses suggested that the rpoS mutant causes a
significantly higher percent insect mortality (for linear and quadratic
components, P < 0.05). Thus, we conclude that X. nematophilus does not require rpoS to kill insects or
to regulate the production of its insecticidal toxin
(10). Furthermore, statistical analyses of our data
suggest that rpoS may negatively affect X. nematophilus virulence toward insects.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
X. nematophilus, an insect pathogen and a nematode
mutualist, functions as a resource for understanding both types of host interactions. In gram-negative bacteria,
S, encoded by
rpoS, controls regulons that can mediate stress resistance, survival, or host interactions. Here we show that a mutation in rpoS abolishes mutualistic existence of X. nematophilus in nematode intestines but not pathogenesis toward or
survival within insects. This first demonstration of a defined mutation
affecting the ability of X. nematophilus to exist within
nematode intestines represents a significant step in elucidating the
factors that mediate this association. Our findings also illustrate the
ease with which the X. nematophilus system can be tested for
both mutualism and pathogenesis.
X. nematophilus requires rpoS for mutualism. The association between X. nematophilus and infective juvenile nematodes requires rpoS. However, it is unclear whether X. nematophilus requires rpoS to colonize or survive; rpoS could be required to regulate the expression of either a specific host interaction factor or genes required for stress resistance. X. nematophilus rpoS mutants survived as well as wild-type cells within insect carcasses and during starvation in LB. Therefore, while the inability of X. nematophilus rpoS mutants to colonize nematodes could be due to a decrease in stress resistance, the stress is likely to be specific to the nematode intestine. A stress survival defect could prevent initial colonization of the intestine or, alternatively, persistence within the infective juvenile nematode. Consistent with the former possibility is the fact that no X. nematophilus rpoS mutants were detected in nematodes newly emerged from the bacterial lawn, as would be expected for a persistence defect. Based on our current data, however, we cannot rule out the possibility that the X. nematophilus rpoS mutant colonizes the intestine but is eliminated prior to infective juvenile nematode emergence from the lawn. To address this question, we are monitoring the localization of green fluorescent protein-labeled X. nematophilus within nematodes.
If rpoS regulates the expression of a specific factor required or inhibitory for nematode colonization, this putative factor cannot be extracellular since the presence of wild-type bacteria could not complement the rpoS mutant, and the presence of the rpoS mutant did not affect wild-type colonization. However, the factor could be a cell surface structure that either promotes or inhibits attachment to nematode host cells.The X. nematophilus
S-dependent
regulon.
We are currently characterizing the X. nematophilus
S regulon to identify the
S-dependent function(s) required for colonization. The
rpoS mutation did not affect protease, lipase, and
antibiotic activities or the production of crystal proteins and outer
membrane proteins. Thus, genes that encode these activities or proteins
are not likely members of the
S-dependent regulon. Since
the rpoS mutant exhibited four- to sevenfold-increased sensitivity to peroxide challenge (Fig. 1B), the
S-dependent regulon may include genes whose products
confer some resistance to this stress. The rpoS mutation is
also associated with enhanced motility, and genes required for this
function are likely regulated by
S. Although we have not
determined the underlying mechanism, enhanced motility could be due to
inappropriate expression of flagella that could, in turn, inhibit
colonization. For example, ectopic expression of flagella in
Bordetella bronchiseptica inhibits colonization of rat
trachea (1). We are therefore examining the cause of enhanced motility in the rpoS mutant and its possible link
to the observed mutualism defect. The
S-dependent
regulon of S. enterica serovar Typhimurium contains genes
not present in E. coli (19). Thus, the
S-dependent regulon of any given bacterium may reflect
the specific environmental challenges faced by that bacterium. If so,
then the
S-dependent regulon of X. nematophilus may include novel gene products that mediate nematode colonization.
X. nematophilus does not require rpoS for virulence. The rpoS mutant is as virulent as and survives and proliferates as well as the wild-type parent when injected directly into the hemolymph of insect larvae. Therefore, X. nematophilus does not require rpoS to evade the insect immune system, express the insecticidal toxin (10), or utilize nutrients in the insect carcass. We found that the rpoS mutant was either as virulent as its parent or slightly more virulent, depending on the statistical analysis used. It is therefore possible that rpoS negatively regulates virulence properties in X. nematophilus. We have not yet analyzed whether the rpoS mutant possesses a competitive phenotype when coinoculated with wild-type cells. Such experiments have the potential to reveal subtle contributions of rpoS to virulence. For example, wild-type E. coli and an rpoS mutant can colonize mouse large intestines equally well when singly inoculated. However, the rpoS mutant exhibits a competitive advantage over the wild type in coinoculation experiments (22).
The development of the X. nematophilus-host interaction model will assist our dissection of molecular mechanisms that underlie both mutualism and pathogenesis, and it will provide valuable insight into the mechanisms used by bacteria to differentially sense and respond to two distinct host environments. In addition, this model can be extended to include investigations of host-response mechanisms, providing a more comprehensive understanding of the intimate associations between bacteria and animals.| |
ACKNOWLEDGMENTS |
|---|
This work was supported by NIH grant GM59776.
We owe many thanks to Harry Kaya (UC Davis), Patricia Stock (UC Davis), Steve Forst (UW-Milwaukee) (particularly for his help with outer membrane protein analyses), Alan Wolfe (Loyola University of Chicago), and members of the Ensign and Goodrich-Blair labs (UW-Madison) for experimental recommendations and useful discussions. We also thank Roberto Kolter (Harvard Medical School) for providing ZK918, Kurt Heungens, Murray Clayton, and Rick Nordheim (UW-Madison) for statistical analyses, and Karl Reich (Abbott Laboratories) for construction of pKR100.
| |
FOOTNOTES |
|---|
*
Corresponding author. Mailing address: Department of
Bacteriology, University of Wisconsin
Madison, 1550 Linden Dr.,
Madison, WI 53706. Phone: (608) 265-4537. Fax: (608) 262-9865. E-mail: hgblair{at}bact.wisc.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Akerley, B. J., P. A. Cotter, and J. F. Miller. 1995. Ectopic expression of the flagellar regulon alters development of the Bordetella-host interaction. Cell 80:611-620[CrossRef][Medline]. |
| 2. | Boemare, N., J.-O. Thaler, and A. Lanois. 1997. Simple bacteriological tests for phenotypic characterization of Xenorhabdus and Photorhabdus phase variants. Symbiosis 22:167-175. |
| 3. | Boemare, N. E., and R. J. Akhurst. 1988. Biochemical and physiological characterization of colony form variants in Xenorhabdus spp. (Enterobacteriaceae). J. Gen. Microbiol. 134:751-761. |
| 4. |
Bohannon, D. E.,
N. Connell,
J. Keener,
A. Tormo,
M. Espinosa-Urgel,
M. M. Zambrano, and R. Kolter.
1991.
Stationary-phase-inducible "gearbox" promoters: differential effects of katF mutations and the role of 70.
J. Bacteriol.
173:4482-4492 |
| 5. | Burland, V., G. I. Plunkett, D. L. Daniels, and F. R. Blattner. 1993. DNA sequence and analysis of 136 kilobases of the Escherichia coli genome: organizational symmetry around the origin of replication. Genomics 16:551-561[CrossRef][Medline]. |
| 6. | Caetano-Annoles, G. 1993. Amplifying DNA with arbitrary oligonucleotide primers. PCR Methods Appl. 3:85-92[Medline]. |
| 7. | Dunphy, G. B., and J. M. Webster. 1988. Lipopolysaccharides of Xenorhabdus nematophilus (Enterobacteriaceae) and their haemocyte toxicity in non-immune Galleria mellonella (Insecta: Lepidoptera) larvae. J. Gen. Microbiol. 134:1017-1028. |
| 8. | Eisenstark, A., M. J. Calcutt, M. Becker-Hapak, and A. Ivanova. 1996. Role of Escherichia coli rpoS and associated genes in defense against oxidative damage. Free Radic. Biol. Med. 21:975-993[CrossRef][Medline]. |
| 9. |
Elias, A. F.,
J. L. Bono,
J. A. Carroll,
P. Stewart,
K. Tilly, and P. Rosa.
2000.
Altered stationary-phase response in a Borrelia burgdorferi rpoS mutant.
J. Bacteriol.
182:2909-2918 |
| 10. | ffrench-Constant, R., and D. Bowen. 1999. Photorhabdus toxins: novel biological insecticides. Curr. Opin. Microbiol. 2:284-288[CrossRef][Medline]. |
| 11. |
Forst, S., and K. Nealson.
1996.
Molecular biology of the symbiotic-pathogenic bacteria Xenorhabdus spp. and Photorhabdus spp.
Microbiol. Rev.
60:21-43 |
| 12. | Forst, S. A., and N. Tabatabai. 1997. Role of the histidine kinase, EnvZ, in the production of outer membrane proteins in the symbiotic-pathogenic bacterium Xenorhabdus nematophilus. Appl. Environ. Microbiol. 63:962-968[Abstract]. |
| 13. |
Galán, J. E., and A. Collmer.
1999.
Type III secretion machines: bacterial devices for protein delivery into host cells.
Science
284:1322-1328 |
| 14. |
Gerritsen, L. J. M.,
G. DeRaay, and P. H. Smits.
1992.
Characterization of form variants of Xenorhabdus luminescens.
Appl. Environ. Microbiol.
58:1975-1979 |
| 15. |
Giddens, S. R.,
A. Tormo, and H. K. Mahanty.
2000.
Expression of the antifeeding gene anfA1 in Serratia entomophila requires RpoS.
Appl. Env. Microbiol.
66:1711-1714 |
| 16. | Guiney, D. G. 1997. Regulation of bacterial virulence gene expression by the host environment. J. Clin. Investig. 100:S7-S10. |
| 17. |
Hales, L. M., and H. A. Shuman.
1999.
The Legionella pneumophila rpoS gene is required for growth within Acanthamoeba castellanii.
J. Bacteriol.
181:4879-4889 |
| 18. | Hengge-Aronis, R. 1993. Survival of hunger and stress: the role of rpoS in early stationary phase gene regulation in Escherichia coli. Cell 72:165-168[CrossRef][Medline]. |
| 19. |
Ibanez-Ruiz, M.,
V. Robbe-Saule,
D. Hermant,
S. Labrude, and F. Norel.
2000.
Identification of RpoS ( S)-regulated genes in Salmonella enterica serovar Typhimurium.
J. Bacteriol.
182:5749-5756 |
| 20. |
Ichikawa, J. K.,
C. Li,
J. Fu, and S. Clarke.
1994.
A gene at 59 minutes on the Escherichia coli chromosome encodes a lipoprotein with unusual amino acid repeat sequences.
J. Bacteriol.
176:1630-1638 |
| 21. | Kaya, H. K., and R. Gaugler. 1993. Entomopathogenic nematodes. Annu. Rev. Entomol. 38:181-206. |
| 22. |
Krogfelt, K. A.,
M. Hjulgaard,
K. Sørensen,
P. S. Cohen, and M. Givskov.
2000.
rpoS gene function is a disadvantage for Escherichia coli BJ4 during competitive colonization of the mouse large intestine.
Infect. Immun.
68:2518-2524 |
| 23. | Lange, R., and R. Hengge-Aronis. 1991. Identification of a central regulator of stationary phase gene expression in Escherichia coli. Mol. Microbiol. 5:49-59[Medline]. |
| 24. |
Lee, S. H.,
M. J. Angelichio,
J. J. Mekalanos, and A. Camilli.
1998.
Nucleotide sequence and spatiotemporal expression of the Vibrio cholerae vieSAB genes during infection.
J. Bacteriol.
180:2298-2305 |
| 25. | Matin, A. 1991. The molecular basis of carbon-starvation-induced general resistance in Escherichia coli. Mol. Microbiol. 5:3-10[Medline]. |
| 26. |
Maxwell, P. W.,
G. Chen,
J. M. Webster, and G. B. Dunphy.
1994.
Stability and activities of antibiotics produced during infection of the insect Galleria mellonella by two isolates of Xenorhabdus nematophilus.
Appl. Environ. Microbiol.
60:715-721 |
| 27. |
McCann, M. P.,
J. P. Kidwell, and A. Matin.
1991.
The putative factor KatF has a central role in development of starvation-mediated general resistance in Escherichia coli.
J. Bacteriol.
173:4188-4194 |
| 28. | McFall-Ngai, M. J., and E. G. Ruby. 1998. Sepiolids and Vibrios: when first they meet. BioScience 48:257-265[CrossRef]. |
| 29. | Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 30. |
Miller, V. L., and J. J. Mekalanos.
1988.
A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR.
J. Bacteriol.
170:2575-2583 |
| 31. |
Mulvey, M. R., and P. C. Loewen.
1989.
Nucleotide sequence of katF of Escherichia coli suggests KatF protein is a novel transcription factor.
Nucleic Acids Res.
17:9979-9991 |
| 32. |
Mulvey, M. R.,
J. Switala,
A. Borys, and P. C. Loewen.
1990.
Regulation of transcription of katE and katF in Escherichia coli.
J. Bacteriol.
172:6713-6720 |
| 33. | Nickerson, C. A., and R. I. Curtis, III. 1997. Role of sigma factor RpoS in initial stages of Salmonella typhimurium infection. Infect. Immun. 65:1814-1823[Abstract]. |
| 34. | Ong, K. L., and F. N. Chang. 1997. Analysis of proteins from different phase variants of the entomopathogenic bacteria Photorhabdus luminescens by two-dimensional zymography. Electrophoresis 18:834-839[CrossRef][Medline]. |
| 35. | O'Toole, G. A., and R. Kolter. 1998. Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signalling pathways: a genetic analysis. Mol. Microbiol. 28:449-461[CrossRef][Medline]. |
| 36. | Pardon, P., M. Y. Popoff, C. Coynault, J. Marly, and I. Miras. 1986. Virulence-associated plasmids of Salmonella serotype Typhimurium in experimental murine infection. Ann. Microbiol. (Paris) 137B:47-60. |
| 37. |
Persson, B. C., and G. R. Bjork.
1993.
Isolation of the gene (miaE) encoding the hydroxylase involved in the synthesis of 2-methylthio-cis-ribozeatin in tRNA of Salmonella typhimurium and characterization of mutants.
J. Bacteriol.
175:7776-7785 |
| 38. | Preston, G. M., B. Haubold, and P. B. Rainey. 1998. Bacterial genomics and adaptation to life on plants: implications for the evolution of pathogenicity and symbiosis. Curr. Opin. Microbiol. 1:589-597[CrossRef][Medline]. |
| 39. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 40. |
Sarniguet, A.,
J. Kraus,
M. D. Henkels,
A. M. Muehlchen, and J. E. Loper.
1995.
The sigma factor S affects antibiotic production and biological control activity of Pseudomonas fluorescens Pf-5.
Proc. Natl. Acad. Sci. USA
92:12255-12259 |
| 41. | Sierra, G. 1956. A simple method for the detection of lipolytic activity of micro-organisms and some observations on the influence of the contact between cells and fatty substrates. Antonie Leeuwenhoek 23:15-22. |
| 42. | Simon, R., U. Priefer, and A. Pühler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Biotechnology 1:784-791[CrossRef]. |
| 43. |
Visick, K. L., and E. G. Ruby.
1998.
The periplasmic, group III catalase of Vibrio fischeri is required for normal symbiotic competence and is induced both by oxidative stress and by approach to stationary phase.
J. Bacteriol.
180:2087-2092 |
| 44. |
Volgyi, A.,
A. Fodor,
A. Szentirmai, and S. Forst.
1998.
Phase variation in Xenorhabdus nematophilus.
Appl. Environ. Microbiol.
64:1188-1193 |
| 45. | Way, J. C., M. A. Davis, D. Morisato, D. E. Roberts, and N. Kleckner. 1984. New Tn10 derivatives for transposon mutagenesis and for construction of lacZ operon fusions by transposition. Gene 32:369-379[CrossRef][Medline]. |
| 46. |
Weis, V. M.,
A. L. Small, and M. J. McFall-Ngai.
1996.
A peroxidase related to the mammalian antimicrobial protein myeloperoxidase in the Euprymna-Vibrio mutualism.
Proc. Natl. Acad. Sci. USA
93:13683-13688 |
| 47. | Woodring, J. L., and H. K. Kaya. 1988. Steinernematid and Heterorhabditid nematodes: a handbook of biology and techniques. Southern Cooperative Series Bulletin 331. Arkansas Agricultural Experiment Station, Fayetteville, Ark. |
| 48. |
Xu, J., and R. E. Hurlbert.
1990.
Toxicity of irradiated media for Xenorhabdus spp.
Appl. Environ. Microbiol.
56:815-818 |
| 49. |
Xu, J.,
S. Lohrke,
I. M. Hurlbert, and R. E. Hurlbert.
1989.
Transformation of Xenorhabdus nematophilus.
Appl. Environ. Microbiol.
55:806-812 |
| 50. |
Yildiz, F. H., and G. K. Schoolnik.
1998.
Role of rpoS in stress survival and virulence of Vibrio cholerae.
J. Bacteriol.
180:773-784 |
| 51. |
Zambrano, M. M.,
D. A. Siegele,
M. Almirón,
A. Tormo, and R. Kolter.
1993.
Microbial competition: Escherichia coli mutants that take over stationary phase cultures.
Science
259:1757-1760 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Appl. Environ. Microbiol. | Infect. Immun. | Eukaryot. Cell |
|---|---|---|
| Mol. Cell. Biol. | J. Virol. | Microbiol. Mol. Biol. Rev. |
| ALL ASM JOURNALS |