Previous Article | Next Article 
Journal of Bacteriology, August 2001, p. 4806-4813, Vol. 183, No. 16
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.16.4806-4813.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Dual Repression by Fe2+-Fur and
Mn2+-MntR of the mntH Gene, Encoding an
NRAMP-Like Mn2+ Transporter in Escherichia
coli
Silke I.
Patzer* and
Klaus
Hantke
Mikrobiologie/Membranphysiologie,
Universität Tübingen, Tübingen, Germany
Received 19 March 2001/Accepted 30 May 2001
 |
ABSTRACT |
The uptake of Mn2+, a cofactor for several enzymes in
Escherichia coli, is mediated by MntH, a proton-dependent
metal transporter, which also recognizes Fe2+ with lower
affinity. MntH belongs to the NRAMP family of eukaryotic Fe2+ and Mn2+ transporters. In E. coli strains with chromosomal mntH-lacZ fusions, mntH was partially repressed by both Mn2+ and
Fe2+. Inactivation of fur resulted in the loss
of Fe2+-dependent repression of mntH
transcription, demonstrating that Fe2+ repression depends
on the global iron regulator Fur. However, these fur
mutants still showed Mn2+-dependent repression of
mntH. The Mn2+-responsive transcriptional
regulator of mntH was identified as the gene product of
o155 (renamed MntR). mntR mutants were impaired in Mn2+ but not Fe2+ repression of
mntH transcription. Binding of purified MntR to the
mntH operator was manganese dependent. The binding region was localized by DNase I footprinting analysis and covers a nearly perfect palindrome. The Fur binding site, localized within 22 nucleotides of the mntH operator by in vivo operator
titration assays, resembles the Fur-box consensus sequence.
 |
INTRODUCTION |
In eukaryotes, Fe2+ and
Mn2+ are transported by the NRAMP family of transporters.
Recently, NRAMP homologues from both gram-negative and gram-positive
bacteria have been biochemically characterized as pH-dependent
secondary transporters of divalent metal ions with a preference for
Mn2+, and to a lesser extent, for Fe2+
(1, 15, 18, 27), hence the designation MntH, for
H+-dependent manganese transporter.
Iron and manganese are both toxic at high intracellular concentrations.
Therefore, their uptake into bacteria is tightly regulated. In
gram-negative bacteria and in gram-positive bacteria with a low GC
content, the genes encoding iron uptake proteins are negatively regulated by Fur (ferric uptake regulator). In the presence of Fe2+, this protein binds to palindromic sequences within
Fur-regulated promoters and represses transcription of the genes. A
decreased intracellular iron concentration leads to a lower DNA binding activity of the regulatory protein and concomitantly to derepression of
the regulated genes. In gram-positive species with a high GC content,
iron regulation is accomplished by the diphtheria toxin repressor
(DtxR)-like proteins. Fur and DtxR are representatives of two distinct
repressor families. In addition to the iron regulator Fur, the Fur
family includes the regulator of Zn2+ transport, Zur
(8, 11, 21), and the regulator of the peroxide stress
response, PerR (4). Recent DNA binding studies have suggested that TroR, a member of the DtxR family, from Treponema pallidum is a Mn2+ sensor (25), but it
has not been possible to test the role of TroR in vivo. The distantly
related MntR from Bacillus subtilis has been described as a
bifunctional regulator of two Mn2+ transporters. Under
low-Mn2+ conditions, MntR activates transcription of an ABC
transporter, whereas under high-Mn2+ conditions, MntR acts
as a transcriptional repressor of mntH, an NRAMP homologue
(27). Under high-Mn2+ conditions, the DtxR
homologue ScaR from Streptococcus gordonii represses
transcription of the scaABC operon, which encodes the components of an ABC-type transporter for Mn2+
(13).
In this work, the regulation of mntH expression in
Escherichia coli by divalent metal ions was studied. We
report the identification of the gene product of o155, which
we renamed MntR, a new Mn2+ regulator in E. coli, and the repression of mntH transcription by
Mn2+-MntR and Fe2+-Fur. The MntR protein was
purified and shown to bind the mntH operator in vitro.
 |
MATERIALS AND METHODS |
Bacterial strains, plasmids, and growth conditions.
M9
minimal medium (19) contained 0.2% glucose as a carbon
source. For MA medium, M9 was supplemented with tryptophan, tyrosine, and phenylalanine (0.1 mg ml
1 [each]) and
4-aminobenzoic acid (40 µM) and 4-hydroxybenzoic acid (40 µM).
MacConkey plates contained 40 g of MacConkey agar base (Difco,
Detroit, Mich.) and 10 g of D-lactose per liter. Mutagenesis with 1-methyl-3-nitro-1-nitrosoguanidine (MNNG), P1 transductions, and
-galactosidase assays were performed as described previously (19).
The E. coli strains and plasmids used in this work are
listed in Table 1 or are described in
Results and Fig. 3. All nucleotide positions and section numbers are
those of the E. coli K-12 strain MG1655 genome sequence
reported by Blattner et al. (3).
Strains with chromosomal
lacZ operon fusions were obtained
by infection of
E. coli H1443 (
E. coli MC4100,
but
aroB;
30)
with a Mud1 (Amp
r
lac cts) lysate prepared from strain MAL103 as described
previously
(
6). SIP744 was isolated as a strain carrying a
Mud1 fusion
that was repressed by iron and induced by 2,2'-dipyridyl
(an Fe
2+ chelator) as judged by cross-streaking on
MacConkey plates (
21).
To separate the iron-regulated Mud1
phage from other possible
Mud1 phage insertions, a P1 lysate from
E. coli SIP744 was used
to transduce strains H1443 and
MC4100 (
5). Selection for Amp
r resulted in
strains SIP879 and SIP882, respectively. The Mud1
insertion site was
localized by the method described in reference
21 and was
determined to be at bp 3609 to 3610 of section 217
in the open reading
frame
f412 (
3), which has recently been
identified as
mntH (
15,
18).
E. coli H1717 with the Fur-regulated
fhuF-lacZ
fusion was utilized for the Fur titration assay as described previously
(
30).
In the
fur-28 allele, nucleotides (nt) 2284 to 2215 of
section 62 are deleted, giving rise to an inactive Fur. This mutation
was generated by MNNG treatment,
fur-28 was introduced into
strains
SIP879 and SIP882 by cotransduction with
zbf-15::Tn
10, resulting
in strains
SIP890 (MC4100, but
mntH::Mud1
fur-28
zbf-15::Tn
10 aroB) and SIP894 (MC4100, but
mntH::Mud1
fur-28
zbf-15::Tn
10),
respectively. The isogenic
fur+ strains are designated SIP891 (MC4100, but
mntH::Mud1
zbf-15::Tn
10 aroB) and SIP895 (MC4100, but
mntH::Mud1
zbf-15::Tn
10), respectively.
Strain
LCB272 carries
zbh-272::Tn
10 on F' 106 (
20).
Plasmids pSP116/1 and pSP116/10 comprise the PCR product obtained with
primers MNTR1 (TAAACACGCGCATACACCTCTTG [nt 360 to 382,
section 74]) and MNTR2 (GCGTGCGTAAAAAAGGCAGGCTC [nt 1067 to 1045,
section 74]) in the
SmaI site of pHSG575 and the
EcoRV site of
pACYC184, respectively. The PCR product
obtained with primers
MNTR2 and MNTR3 (TGAGTCGTCGCGCAGGTACGCC
[nt 580 to 601, section
74]) was bluntly cloned into the
NdeI/
EcoRI sites of pT7-7, which
were previously
end filled, resulting in pSP116/25. The sequence
of the PCR-amplified
mntR was
verified.
Plasmid pSP61/18 carries the
fur gene on a 0.78-kb PCR
product obtained with primers FUR1 (GTAACTTTTGCTGTTGTACCTGTAC
[nt 2847
to 2823, section 62]) and FUR2
(GGCAGGAAATACGCAGTAATAACAA [nt
2073 to 2097 section 62])
inserted in the
SmaI site of pHSG575.
pSP117/11 contains the
PCR product obtained from
E. coli SIP879
with primers MUD1
(CACGTACATGCCGCCAAACTCACCA) and YFEP3
(GCAACAACGGCAAGTGCCAGTAC
[nt 4764 to 4742, section 217])
inserted in the
EcoRV site of
pBC-SK
+. For
subcloning of the
mntH operator, PCR was carried out with
primers YFEP8 (GCCTCTAAAACATAGCCTTTGCT [nt 4391 to 4413, section
217]), YFEP9 (CAAAGTTACCGGGATCGATATAA [nt 4271 to
4293, section
217]), YFEP10 (ATTCTCGTTTGGCATAGCATGAA [nt
4440 to 4418, section
217]), and YFEP11 (GTTATGTAAATGTGCTAACATTA
[nt 4560 to 4538, section
217]), or primers YFEP6
(ACGAGAATGATTATCAAATTCAT [nt 4433 to 4455,
section 217])
and YFEP7 (ATGAATTTGATAATCATTCTCGT [nt 4455 to 4433,
section 217]) were annealed, and the fragments were then inserted
into
the
EcoRV site of pBC-SK
+ as depicted in Fig.
3.
Recombinant DNA techniques.
Standard procedures
(28) or those recommended by the manufacturer were
followed for isolation of chromosomal and plasmid DNA, DNA
modification, ligation, transformation, PCR, and agarose gel
electrophoresis. DNA was sequenced by the dideoxy chain termination method using an ALFexpress DNA sequencer (Pharmacia Biotech, Freiburg, Germany). Mutations in the chromosomal mntR allele were
localized by cycle sequencing of two independently generated
PCR-amplified fragments using the primers MNTR1 and MNTR2 and a Thermo
Sequenase Cy5 dye terminator kit (Pharmacia Biotech). Oligonucleotides
were synthesized by Eurogentec (Seraing, Belgium).
DNase I footprinting.
DNase I protection experiments were
done as described previously (22). For metal ion binding
studies, lower concentrations of MgCl2 (50 µM) and
CaCl2 (10 µM) were applied. The labeled target DNA was
generated by PCR with the primers YFEP9 and carbocyamine dye
(Cy5)-labeled YFEP5C (TGTTGTGTATGGAAGCTGAAAG [nt 4581 to
4560, section 217]) for the MntH-coding strand and YFEP3 and
fluorescent Cy5-labeled YFEP4C (GCAATGAACGCAGGTCCCATTA [nt
4303 to 4324, section 217]) for the noncoding strand. Standard
sequencing reactions were carried out with the Cy5-labeled primer and
pSP117/11 as DNA template.
Overproduction and purification of MntR.
MntR was
overproduced from pSP116/25 using E. coli BL21 (DE3)
(31). Bacterial cells were disrupted in a French pressure cell, and the supernatant was chromatographed on a fast protein liquid
chromatography MonoQ HR 5/5 column (Pharmacia) with 50 mM Tris-HCl, pH
7.4, and a linear gradient of NaCl (0 to 0.3 M).
Computer analyses.
Nucleic acid and amino acid sequences
were analyzed by the PC/GENE 6.85 program package (IntelliGenetics,
Mountain View, Calif.). For sequence similarity searches, the BLAST
facilities of the National Center for Biotechnology Information
(http://www.ncbi.nlm.nih.gov) were used.
 |
RESULTS |
Regulation of mntH.
To identify new genes
regulated by fur in E. coli, random Mud1 phage
insertion mutants that were repressed by iron and derepressed by the
iron chelator 2,2'-dipyridyl were selected as described in Materials
and Methods. The Mud1 insertion site of one mutant (SIP879) was
localized in the mntH gene by sequencing the insertion site
as described in Materials and Methods. On MacConkey plates, mutant
SIP879 formed red colonies, indicating acid production from lactose and
high expression of the operon fusion with the lacZ reporter
gene. The mntH-lacZ fusion was repressed in cells in the
diffusion zone of a filter paper strip impregnated with 100 µM
(NH4)2Fe(SO4)2 or 20 µM MnCl2, as shown by the formation of white colonies. In
cells on MacConkey plates containing 40 µM
(NH4)2Fe(So4)2, the
fusion was derepressed by the chelators 2,2'-dipyridyl,
desferri-ferrioxamine B, and EDTA (each 10 mM). The
-galactosidase
activity of mutant SIP879 (mntH-lacZ) was measured in the
presence of various divalent metal ions (Fig. 1). Of the metal ions tested, only
Fe2+ and Mn2+ repressed the
mntH-lacZ operon fusion fivefold.

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 1.
Regulation of mntH-lacZ by divalent metal
ions. E. coli SIP879 (mntH-lacZ) was grown
aerobically for 6 h in MA medium supplemented with a 10 µM
concentration of the indicated metal ion, and -galactosidase
activities were then measured. Values are averages of experiments
carried out in triplicate.
|
|
The influence of iron was also observed in the different behaviors of
aroB+ and
aroB strains.
aroB is one of the genes necessary for the
biosynthesis of
the
E. coli siderophore enterochelin, which mediates
ferric
iron transport. The
mntH-lacZ fusion in strain SIP882
(
mntH-lacZ aroB+) was repressed more strongly
than in the isogenic
aroB mutant
SIP879 (data not shown).
This is probably due to the better supply
of iron, which exerts a
repressing effect, for
aroB+ strains.
Iron repression of mntH is mediated by Fur.
To
determine whether iron regulation is mediated by Fur, the
fur gene on the chromosome of strain SIP879
(mntH-lacZ) was inactivated. In the fur mutant
SIP890, the mntH-lacZ fusion was no longer repressed by
iron, whereas regulation by manganese was unimpaired (Fig. 2A). The isogenic
fur+ strain SIP891 showed the same regulation as
strain SIP879. The derepression in the presence of iron in the
fur mutant was complemented by the fur-carrying
plasmid pSP61/18 (Fig. 2A). This indicates that Fur alone is
responsible for the iron repression. The same results were obtained for
the aroB+ strains SIP894 (mntH-lacZ
fur) and SIP895 (mntH-lacZ) (data not shown).

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 2.
Response of mntH-lacZ in wild-type,
mntR mutant, and fur mutant cells to various
concentrations of
(NH4)2Fe(SO4)2 (A) and
MnCl2 (B). The mntR mutant SIP933 was
complemented with pSP116/1 (plasmid carrying mntR), and the
fur mutant SIP890 was complemented with pSP61/18 (plasmid
carrying fur). Cells were grown aerobically for 6 h in
MA medium (white bars) or in MA medium amended with 5 µM (black bars)
or 20 µM (gray bars) metal ions, and -galactosidase activities
were then determined. Values are averages of experiments carried out in
triplicate.
|
|
Localization of the Fur binding site in vivo.
To localize the
DNA region within the mntH operator responsible for Fur
binding, an in vivo titration assay (30) was employed. Introduction of a Fur binding site on a high-copy-number plasmid titrates Fur and hence derepressed the Fur-regulated
fhuF'-lacZ expression in E. coli H1717, resulting
in red colonies on MacConkey plates containing 40 µM
(NH4)2Fe(SO4)2. In
contrast, E. coli H1717 harboring the vector forms white
colonies. E. coli H1717 transformed with the plasmid
pSP117/11 carrying the mntH operator region (nt 3610 to
4764, section 217) cloned on pBC-SK+ resulted in red
colonies (Fig. 3), indicating Fur
binding, whereas the colonies of the vector control were white. The
region responsible for the Fur regulation was narrowed down to nt 4433 to 4455 of section 217 by subcloning as depicted in Fig. 3. Deletion of
nt 4452 from this region (pSP118/14) resulted in lower activity, whereas pSP118/18, comprising nt 4433 to 4454, was fully active in the
in vivo titration assay (data not shown). The binding site GAgAATGATtATCAaatTC matches the Fur-box consensus sequence
GATAATGATAATCATTATC (9) in 14 of 19 nt
(mismatches are shown as lowercase letters).

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 3.
Mapping of the Fur box and of the potential MntR binding
site on the mntH operator region. The DNA inserts (shaded
boxes) were obtained with the primers specified in Materials and
Methods and were then ligated into the EcoRV site of
pBC-SK+. Thick arrows show the position and orientation of
the lacZ promoter in each construct. The numbers reflect the
positions in section 217 of the E. coli genome
(3). Activity in the Fur titration assay signifies
derepression of fhuF'-lacZ expression in E. coli H1717 carrying the corresponding plasmid. This results in red
colonies on MacConkey plates containing 40 µM
(NH4)2Fe(SO4)2.
E. coli H1717(pBC-SK+) cells grew as pale
colonies on these plates. For the MntR titration assay, E. coli SIP879 was transformed with the plasmids and analyzed on
MacConkey plates with 80 µM MnCl2. E. coli
SIP879(pBC-SK+) formed white colonies; colonies of
transformants with activity were reddish. Parentheses indicate
partially reduced activity. Plus and minus signs indicate the relative
amount of activity, with ++ being the highest relative amount.
|
|
Identification of the Mn2+ regulator MntR.
To find
the regulator responsible for the Mn2+ regulation, strain
SIP879 (mntH-lacZ) was mutagenized with MNNG and screened for derepressed red colonies on MacConkey plates containing 10 µM
Mn2+. The impaired manganese repression of the selected
mutants is summarized in Table 2. Mutant
SIP932 was transformed with an E. coli gene library
(21) and screened for white colonies on MacConkey
manganese plates. One plasmid (pSP115/25) complemented strain SIP932 as
well as mutants SIP924, SIP931, SIP933, SIP943, and SIP949. The plasmid
comprises nt 10296 of section 73 to nt 1924 of section 74 of the
E. coli genome. Subclones were constructed, of which
plasmids pSP116/1 and pSP116/10 contained only o155 and restored repression by manganese (see Fig. 2B for pSP116/1). The mutations were cotransducible with the tetracycline resistance marker
zbh-272::Tn10 at 18.4 min on the
genetic map of E. coli. This confirmed that the
Mn2+-deregulated mutants are mutated in the region of
o155. By sequencing, the mutations were all localized in
o155 (Table 2). The amino acid sequence of O155 reveals 16%
identity to MntR from B. subtilis and shows that it belongs
to the DtxR family of bacterial metalloregulators. Hence
o155 was renamed mntR (Mn2+
transporter regulation).
MNNG mutagenesis of SIP882 (
mntH-lacZ aroB+) did
not result in derepressed red colonies on MacConkey manganese plates.
P1 transduction
of the
mntR mutant SIP932 with
aroB+ revealed that in an
aroB+ strain the
mntH-lacZ fusion is
fully repressed by iron provided
by the ferric enterochelin transport
system.
Subcloning of the mntH operator region affording
manganese regulation in vivo.
When cloned on the high-copy-number
vector pBC-SK+, the region nt 3610 to 4764 of section 217 covering the mntH operator (pSP117/11) titrated MntR from
the chromosomal mntH-lacZ fusion of strain SIP879; colonies
of SIP879 transformed with pSP117/11 were reddish on MacConkey plates
containing 80 µM MnCl2, whereas SIP879 transformed with
the vector pBC-SK+ formed white colonies. This indicates
that the insert binds to MntR. By subcloning, this MntR binding site
was narrowed down to nt 4391 to 4440 of section 217 (Fig. 3), which
contains a nearly perfect palindrome (see Fig. 5C).
Interaction of MntR with the mntH operator region.
After overproduction, MntR was purified by anion-exchange
chromatography to electrophoretic homogeneity. Sodium dodecyl
sulfate-polyacrylamide gel electrophoresis of purified MntR revealed a
single protein with a molecular mass of
17 kDa, consistent with the
predicted size of 17.6 kDa (Fig. 4). The
DNA binding properties of MntR were investigated by DNase I footprint
assays. The target DNA fragment encompassed at least 195 nt upstream of
the translational start of mntH and was labeled on each
strand. Footprinting experiments in the presence of Mn2+
showed a core region of protection that is depicted in Fig.
5. At higher MntR
concentrations, partial protection adjacent to the
core region occurred. Even without added Mn2+ the DNA was
protected, probably due to the high Mg2+ concentrations (5 mM) in the DNase I buffer. Therefore, lower Mg2+
concentrations at which DNase I was still active were used for metal
ion specificity studies (see Materials and Methods). The low-specificity ion chelator EDTA (100 µM) impaired DNA protection. Addition of 150 µM Mn2+ restored DNA binding, whereas no
protection was observed in the presence of 150 µM Co2+,
Cu2+, Fe2+, Ni2+, or
Zn2+. Zn2+ did not protect but altered the
DNase I fragmentation pattern.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 4.
Sodium dodecyl sulfate-polyacrylamide gel
electrophoresis analysis of the purified MntR. mntR was
overexpressed using the T7 expression system on pSP116/25 carried by
strain BL21(DE3). Lane 1, soluble fraction of cell lysate after
induction; lane 2, MntR purified by MonoQ anion-exchange
chromatography. Proteins were stained with Coomassie blue. The
positions and molecular masses of the standard proteins are shown on
the left.
|
|

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 5.
DNase I footprinting analysis of the MntH-coding
(A) and noncoding (B) strands of the mntH operator with MntR
protein. The 311-bp DNA fragment comprising nt 4581 to 4271 of section
217, labeled on the MntH-coding strand with the fluorescence-labeled
YFEP5C primer (A), and the 462-bp fragment encompassing nt 4303 to 4764 of section 217, labeled on the noncoding strand with the Cy5-labeled
YFEP4C primer (B), were incubated without (row 1) or with (row 2)
purified MntR protein as described in Materials and Methods. The
nucleotide sequence obtained from the dideoxynucleotide sequencing
reaction with the same end-labeled primer is given at the bottom of
each panel; the protected region is expanded for clarity. (C)
Nucleotide sequence of the mntH operator region with the
translational start site. The boxed region indicates the nucleotides
protected from DNase I by MntR. The area active in the in vivo Fur
titration assay is shaded. Palindromic sequences are denoted by
convergent arrows, with complementary bases shown in bold. Nucleotides
are numbered according to E. coli genome section 217.
|
|
 |
DISCUSSION |
This study identifies a new metalloregulatory protein in E. coli, MntR, that senses Mn2+ and belongs to the DtxR
family. The crystal structures of two iron regulatory proteins of the
DtxR family, DtxR from Corynebacterium diphtheriae and IdeR
from Mycobacterium tuberculosis, have been solved (24,
26). The proteins comprise three distinct domains: an
amino-terminal DNA binding domain containing a helix-turn-helix motif,
a central dimerization domain including the key residues for metal ion
coordination, and a carboxy-terminal
-spectrin SH3-like domain
proposed to regulate repressor activity and also to contribute to metal
ion binding (23). In contrast to the Mn2+-responsive metalloregulator ScaR (13),
MntR from E. coli, the Mn2+-sensing TroR from
T. pallidum (25), and MntR from B. subtilis (27) lack the C-terminal third (SH3-like)
domain of DtxR. Therefore, the third domain is not correlated with the
metal ion specificity for Mn2+ or Fe2+.
Regulation of the transporter gene mntH by Mn2+
is only accomplished by MntR and not by Fur, although the E. coli Fur protein also functions in vitro with Mn2+ as
a corepressor. This might also occur in vivo under certain conditions.
At high, toxic Mn2+ concentrations, iron uptake is
repressed and growth ceases. Mutants selected for Mn2+
resistance are often mutated in fur, which allows the cells
to synthesize specific iron uptake systems (12).
It seems reasonable that in E. coli the NRAMP homologue
transporter MntH, which takes up Mn2+ as well as
Fe2+, is regulated by both ions via specific regulators. In
contrast to mntH from E. coli, no iron regulation
has been reported for mntH from B. subtilis
(27). It is possible that in B. subtilis the
repression by Fe2+ is only found at iron concentrations
higher than the ones tested (up to 1 µM). Besides the NRAMP
homologous proton-coupled Mn2+ transporter MntH, B. subtilis contains the ABC-type Mn2+ transporter
MntABCD, which is specific for Mn2+ and which is activated
by MntR under low-Mn2+ conditions (27). ScaR
from S. gordonii and TroR from T. pallidum have
been described as repressors of ABC-type transporters, probably for
Mn2+ uptake (13, 25). The ScaABC transporter
from S. gordonii is not controlled by iron
(13). It is unlikely that E. coli also
possesses an ABC transporter for Mn2+ uptake since
Mn2+ uptake is reported to be solely dependent on the
membrane potential rather than on ATP (2, 29).
MntR protected a core region of 25 nt on the coding strand and on the
noncoding strand of the mntH operator with a 3' stagger. This is in accordance with other classic helix-turn-helix repressors that bind to DNA as a dimer, e.g.,
phage repressor CI (14, 34). Higher concentrations of MntR extended the protection zone in DNase I footprinting assays. Similarly, for ScaR and TroR, which
occupy 22 nt with a palindromic sequence, at least two distinct DNA-protein complexes have been observed in mobility-shift DNA binding
assays, which indicates multiple binding interactions between the
regulator and the operator (13, 25). Likewise, polymerization of the Fur repressor has been observed in footprinting experiments (e.g., see reference 9) and by electron and
atomic force microscopy (10, 16); however, the crystal
structure of the DNA complex is not yet known. The structure of the
DtxR-DNA complex revealed that DNA surprisingly interacts with two
dimeric repressor proteins bound to opposite sides of the operator
(35). Similar to ScaR, TroR, and DtxR, MntR-DNA binding
seems to be more complex than that of a classic repressor. Consistent
with this complexity, MntR from B. subtilis acts not only as
a repressor but also as an activator (27).
The sequence within the promoter recognition region of mntH
shows similarity to the sequences bound by the MntR regulator of
B. subtilis (27) (Fig.
6A) and low similarity to the
Mn2+-responsive metalloregulators, TroR from T. pallidum and ScaR (13) (Fig. 6B), to the DtxR
consensus sequence (17), and to the Fur-box consensus
sequence (9). The operator region of E. coli
mntR contains no recognizable MntR box, giving no hint for
autoregulation, which has not been examined further.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 6.
Analysis of the manganese repressor binding site
sequences. (A) Alignment of the MntR box from E. coli with
the putative MntR recognition site from the mntH and
mntABCD control regions of B. subtilis
(27). (B) Comparison of the MntR box from E. coli with the binding site for TroR from T. pallidum
(25) and ScaR from S. gordonii
(13). Bases that are identical in at least two sequences
are shaded; bases common to all three sequences are marked by
asterisks.
|
|
In many enzymes, Mn2+ can be replaced by Mg2+
and vice versa. For example, in the DNase I footprinting assays in this
study, DNase I activity was strongly enhanced by Mn2+ in
the absence of Mg2+. Thus, the physiological relevance of
manganese for enzyme activity is often not known. However, in E. coli, a number of metalloenzymes that require Mn2+ are
known, e.g., Mn2+-containing superoxide dismutase (MnSOD),
protein phosphatases PrpA and -B, cofactor-independent
3-phosphoglycerate mutase (iPGM), agmatinase, phosphoenolpyruvate
carboxylase, and exonuclease SbcCD. Possibly because there are enzymes
that certainly need Mn2+ as a cofactor, the MntH uptake
system is not completely repressed by Fe2+-Fur (Fig. 1 and
2). Derepression of the Mn2+ transport system via the Fur
system may indicate that Mn2+ or
Mn2+-containing enzymes substitute for iron or
iron-containing enzymes under iron limitation.
 |
ACKNOWLEDGMENTS |
We thank Volkmar Braun (Universität Tübingen) for
discussions and Karen A. Brune (Konstanz) for critical reading of the manuscript.
This work was supported by the Deutsche Forschungsgemeinschaft (grant
HA 1186/3-1) and the Fonds der Chemischen Industrie.
 |
FOOTNOTES |
*
Corresponding author. Mailing address:
Mikrobiologie/Membranphysiologie, Universität Tübingen, Auf
der Morgenstelle 28, 72076 Tübingen, Germany. Phone:
49-7071-2974646. Fax: 49-7071-295843. E-mail:
silke.patzer{at}mikrobio.uni-tuebingen.de.
 |
REFERENCES |
| 1.
|
Agranoff, D.,
I. M. Monahan,
J. A. Mangan,
P. D. Butcher, and S. Krishna.
1999.
Mycobacterium tuberculosis expresses a novel pH-dependent divalent cation transporter belonging to the Nramp family.
J. Exp. Med.
190:717-724[Abstract/Free Full Text].
|
| 2.
|
Bhattacharyya, P.
1970.
Active transport of manganese in isolated membranes of Escherichia coli.
J. Bacteriol.
104:1307-1311[Abstract/Free Full Text].
|
| 3.
|
Blattner, F. R.,
G. I. Plunkett,
C. A. Bloch,
N. T. Perna,
V. Burland,
M. Riley,
J. Collado-Vides,
J. D. Glasner,
C. K. Rode,
G. F. Mayhew,
J. Gregor,
N. W. Davis,
H. A. Kirkpatrick,
M. A. Goeden,
D. J. Rose,
B. Mau, and Y. Shao.
1997.
The complete genome sequence of Escherichia coli K-12.
Science
277:1453-1474[Abstract/Free Full Text].
|
| 4.
|
Bsat, N.,
A. Herbig,
L. Casillas-Martinez,
P. Setlow, and J. D. Helmann.
1998.
Bacillus subtilis contains multiple Fur homologues: identification of the iron uptake (Fur) and peroxide regulon (PerR) repressors.
Mol. Microbiol.
29:189-198[CrossRef][Medline].
|
| 5.
|
Casadaban, M. J.
1976.
Transposition and fusion of the lac genes to selected promoters in Escherichia coli using bacteriophage lambda and Mu.
J. Mol. Biol.
104:541-555[CrossRef][Medline].
|
| 6.
|
Casadaban, M. J., and S. N. Cohen.
1979.
Lactose genes fused to exogenous promoters in one step using a Mu-lac bacteriophage: in vitro probe for transcriptional control sequences.
Proc. Natl. Acad. Sci. USA
76:4530-4533[Abstract/Free Full Text].
|
| 7.
|
Chang, A. C., and S. N. Cohen.
1978.
Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid.
J. Bacteriol.
134:1141-1156[Abstract/Free Full Text].
|
| 8.
|
Dalet, K.,
E. Gouin,
Y. Cenatiempo,
P. Cossart, and Y. Héchard.
1999.
Characterisation of a new operon encoding a Zur-like protein and an associated ABC zinc permease in Listeria monocytogenes.
FEMS Microbiol. Lett.
174:111-116[CrossRef][Medline].
|
| 9.
|
de Lorenzo, V.,
S. Wee,
M. Herrero, and J. B. Neilands.
1987.
Operator sequences of the aerobactin operon of plasmid CoIV-K30 binding the ferric uptake regulation (fur) repressor.
J. Bacteriol.
169:2624-2630[Abstract/Free Full Text].
|
| 10.
|
Fréchon, D., and E. Le Cam.
1994.
Fur (ferric uptake regulation) protein interaction with target DNA: comparison of gel retardation, footprinting and electron microscopy analyses.
Biochem. Biophys. Res. Commun.
201:346-355[CrossRef][Medline].
|
| 11.
|
Gaballa, A., and J. D. Helmann.
1998.
Identification of a zinc-specific metalloregulatory protein, Zur, controlling zinc transport operons in Bacillus subtilis.
J. Bacteriol.
180:5815-5821[Abstract/Free Full Text].
|
| 12.
|
Hantke, K.
1987.
Selection procedure for deregulated iron transport mutants (fur) in Escherichia coli K-12: fur not only affects iron metabolism.
Mol. Gen. Genet.
210:135-139[CrossRef][Medline].
|
| 13.
|
Jakubovics, N. S.,
A. W. Smith, and H. F. Jenkinson.
2000.
Expression of the virulence-related Sca (Mn2+) permease in Streptococcus gordonii is regulated by a diphtheria toxin metallorepressor-like protein ScaR.
Mol. Microbiol.
38:140-153[CrossRef][Medline].
|
| 14.
|
Jordan, S. R., and C. O. Pabo.
1988.
Structure of the lambda complex at 2.5 A resolution: details of the repressor-operator interactions.
Science
242:893-899[Abstract/Free Full Text].
|
| 15.
|
Kehres, D. G.,
M. L. Zaharik,
B. B. Finlay, and M. E. Maguire.
2000.
The NRAMP proteins of Salmonella typhimurium and Escherichia coli are selective manganese transporters involved in the response to reactive oxygen.
Mol. Microbiol.
36:1085-1100[CrossRef][Medline].
|
| 16.
|
Le Cam, E.,
D. Fréchon,
M. Barray,
A. Fourcade, and E. Delain.
1994.
Observation of binding and polymerization of Fur repressor onto operator-containing DNA with electron and atomic force microscopes.
Proc. Natl. Acad. Sci. USA
91:11816-11820[Abstract/Free Full Text].
|
| 17.
|
Lee, J. H.,
T. Wang,
K. Ault,
J. Liu,
M. P. Schmitt, and R. K. Holmes.
1997.
Identification and characterization of three new promoter/operators from Corynebacterium diphtheriae that are regulated by the diphtheria toxin repressor (DtxR) and iron.
Infect. Immun.
65:4273-4280[Abstract].
|
| 18.
|
Makui, H.,
E. Roig,
S. T. Cole,
J. D. Helmann,
P. Gros, and M. F. M. Cellier.
2000.
Identification of the Escherichia coli K-12 Nramp orthologue (MntH) as a selective divalent metal ion transporter.
Mol. Microbiol.
35:1065-1078[CrossRef][Medline].
|
| 19.
|
Miller, J. H.
1992.
A short course in bacterial genetics: a laboratory manual and handbook for Escherichia coli and related bacteria.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 20.
|
Pascal, M. C.,
J. F. Burini,
J. Ratouchniak, and M. Chippaux.
1982.
Regulation of the nitrate reductase operon: effect of mutations in chlA, B, D and E genes.
Mol. Gen. Genet.
188:103-106[CrossRef][Medline].
|
| 21.
|
Patzer, S. I., and K. Hantke.
1998.
The ZnuABC high-affinity zinc uptake system and its regulator Zur in Escherichia coli.
Mol. Microbiol.
28:1199-1210[CrossRef][Medline].
|
| 22.
|
Patzer, S. I., and K. Hantke.
2000.
The zinc-responsive regulator Zur and its control of the znu gene cluster encoding the ZnuABC zinc uptake system in Escherichia coli.
J. Biol. Chem.
275:24321-24332[Abstract/Free Full Text].
|
| 23.
|
Pohl, E.,
R. K. Holmes, and W. G. Hol.
1999.
Crystal structure of a cobalt-activated diphtheria toxin repressor-DNA complex reveals a metal-binding SH3-like domain.
J. Mol. Biol.
292:653-667[CrossRef][Medline].
|
| 24.
|
Pohl, E.,
R. K. Holmes, and W. G. J. Hol.
1999.
Crystal structure of the iron-dependent regulator (IdeR) from Mycobacterium tuberculosis shows both metal binding sites fully occupied.
J. Mol. Biol.
285:1145-1156[CrossRef][Medline].
|
| 25.
|
Posey, J. E.,
J. M. Hardham,
S. J. Norris, and F. C. Gherardini.
1999.
Characterization of a manganese-dependent regulatory protein, TroR, from Treponema pallidum.
Proc. Natl. Acad. Sci. USA
96:10887-10892[Abstract/Free Full Text].
|
| 26.
|
Qiu, X.,
E. Pohl,
R. K. Holmes, and W. G. Hol.
1996.
High-resolution structure of the diphtheria toxin repressor complexed with cobalt and manganese reveals an SH3-like third domain and suggests a possible role of phosphate as co-corepressor.
Biochemistry
35:12292-12302[CrossRef][Medline].
|
| 27.
|
Que, Q., and J. D. Helmann.
2000.
Manganese homeostasis in Bacillus subtilis is regulated by MntR, a bifunctional regulator related to the diphtheria toxin repressor family of proteins.
Mol. Microbiol.
35:1454-1468[CrossRef][Medline].
|
| 28.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 29.
|
Silver, S.,
P. Johnseine, and K. King.
1970.
Manganese active transport in Escherichia coli.
J. Bacteriol.
104:1299-1306[Abstract/Free Full Text].
|
| 30.
|
Stojiljkovic, I.,
A. J. Bäumler, and K. Hantke.
1994.
Fur regulon in gram-negative bacteria. Identification and characterization of new iron-regulated Escherichia coli genes by a Fur titration assay.
J. Mol. Biol.
236:531-545[CrossRef][Medline]. (Erratum, 240:276)
|
| 31.
|
Studier, F. W., and B. A. Moffatt.
1986.
Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes.
J. Mol. Biol.
189:113-130[CrossRef][Medline].
|
| 32.
|
Tabor, S.
1996.
Unit 16.2: expression using the T7 RNA polymerase/promoter system.
In
F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology. John Wiley & Sons, Inc., New York, N.Y.
|
| 33.
|
Takeshita, S.,
M. Sato,
M. Toba,
W. Masahashi, and T. Hashimoto-Gotoh.
1987.
High-copy-number and low-copy-number plasmid vectors for lacZ -complementation and chloramphenicol- or kanamycin-resistance selection.
Gene
61:63-74[CrossRef][Medline].
|
| 34.
|
Tullius, T. D., and B. A. Dombroski.
1986.
Hydroxyl radical "footprinting": high-resolution information about DNA-protein contacts and application to lambda repressor and Cro protein.
Proc. Natl. Acad. Sci. USA
83:5469-5473[Abstract/Free Full Text].
|
| 35.
|
White, A.,
X. Ding,
J. C. van der Spek,
J. R. Murphy, and D. Ringe.
1998.
Structure of the metal-ion-activated diphtheria toxin repressor/tox operator complex.
Nature
394:502-506[CrossRef][Medline].
|
Journal of Bacteriology, August 2001, p. 4806-4813, Vol. 183, No. 16
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.16.4806-4813.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Podzelinska, K., He, S.-M., Wathier, M., Yakunin, A., Proudfoot, M., Hove-Jensen, B., Zechel, D. L., Jia, Z.
(2009). Structure of PhnP, a Phosphodiesterase of the Carbon-Phosphorus Lyase Pathway for Phosphonate Degradation. J. Biol. Chem.
284: 17216-17226
[Abstract]
[Full Text]
-
Ouyang, Z., He, M., Oman, T., Yang, X. F., Norgard, M. V.
(2009). A manganese transporter, BB0219 (BmtA), is required for virulence by the Lyme disease spirochete, Borrelia burgdorferi. Proc. Natl. Acad. Sci. USA
106: 3449-3454
[Abstract]
[Full Text]
-
Smith, K. F., Bibb, L. A., Schmitt, M. P., Oram, D. M.
(2009). Regulation and Activity of a Zinc Uptake Regulator, Zur, in Corynebacterium diphtheriae. J. Bacteriol.
191: 1595-1603
[Abstract]
[Full Text]
-
Chen, Z., Lewis, K. A., Shultzaberger, R. K., Lyakhov, I. G., Zheng, M., Doan, B., Storz, G., Schneider, T. D.
(2007). Discovery of Fur binding site clusters in Escherichia coli by information theory models. Nucleic Acids Res
35: 6762-6777
[Abstract]
[Full Text]
-
Quatrini, R., Lefimil, C., Veloso, F. A., Pedroso, I., Holmes, D. S., Jedlicki, E.
(2007). Bioinformatic prediction and experimental verification of Fur-regulated genes in the extreme acidophile Acidithiobacillus ferrooxidans. Nucleic Acids Res
35: 2153-2166
[Abstract]
[Full Text]
-
Lucarelli, D., Russo, S., Garman, E., Milano, A., Meyer-Klaucke, W., Pohl, E.
(2007). Crystal Structure and Function of the Zinc Uptake Regulator FurB from Mycobacterium tuberculosis. J. Biol. Chem.
282: 9914-9922
[Abstract]
[Full Text]
-
Runyen-Janecky, L., Dazenski, E., Hawkins, S., Warner, L.
(2006). Role and Regulation of the Shigella flexneri Sit and MntH Systems.. Infect. Immun.
74: 4666-4672
[Abstract]
[Full Text]
-
He, J., Miyazaki, H., Anaya, C., Yu, F., Yeudall, W. A., Lewis, J. P.
(2006). Role of Porphyromonas gingivalis FeoB2 in Metal Uptake and Oxidative Stress Protection. Infect. Immun.
74: 4214-4223
[Abstract]
[Full Text]
-
Sabri, M., Leveille, S., Dozois, C. M.
(2006). A SitABCD homologue from an avian pathogenic Escherichia coli strain mediates transport of iron and manganese and resistance to hydrogen peroxide.. Microbiology
152: 745-758
[Abstract]
[Full Text]
-
Ikeda, J. S., Janakiraman, A., Kehres, D. G., Maguire, M. E., Slauch, J. M.
(2005). Transcriptional Regulation of sitABCD of Salmonella enterica Serovar Typhimurium by MntR and Fur. J. Bacteriol.
187: 912-922
[Abstract]
[Full Text]
-
Mazon, G., Erill, I., Campoy, S., Cortes, P., Forano, E., Barbe, J.
(2004). Reconstruction of the evolutionary history of the LexA-binding sequence. Microbiology
150: 3783-3795
[Abstract]
[Full Text]
-
Platero, R., Peixoto, L., O'Brian, M. R., Fabiano, E.
(2004). Fur Is Involved in Manganese-Dependent Regulation of mntA (sitA) Expression in Sinorhizobium meliloti. Appl. Environ. Microbiol.
70: 4349-4355
[Abstract]
[Full Text]
-
Diaz-Mireles, E., Wexler, M., Sawers, G., Bellini, D., Todd, J. D., Johnston, A. W. B.
(2004). The Fur-like protein Mur of Rhizobium leguminosarum is a Mn2+-responsive transcriptional regulator. Microbiology
150: 1447-1456
[Abstract]
[Full Text]
-
Oram, D. M., Avdalovic, A., Holmes, R. K.
(2004). Analysis of Genes That Encode DtxR-Like Transcriptional Regulators in Pathogenic and Saprophytic Corynebacterial Species. Infect. Immun.
72: 1885-1895
[Abstract]
[Full Text]
-
Paik, S., Brown, A., Munro, C. L., Cornelissen, C. N., Kitten, T.
(2003). The sloABCR Operon of Streptococcus mutans Encodes an Mn and Fe Transport System Required for Endocarditis Virulence and Its Mn-Dependent Repressor. J. Bacteriol.
185: 5967-5975
[Abstract]
[Full Text]
-
Patzer, S. I., Baquero, M. R., Bravo, D., Moreno, F., Hantke, K.
(2003). The colicin G, H and X determinants encode microcins M and H47, which might utilize the catecholate siderophore receptors FepA, Cir, Fiu and IroN. Microbiology
149: 2557-2570
[Abstract]
[Full Text]
-
Garrido, M. E., Bosch, M., Medina, R., Bigas, A., Llagostera, M., Perez de Rozas, A. M., Badiola, I., Barbe, J.
(2003). fur-independent regulation of the Pasteurella multocida hbpA gene encoding a haemin-binding protein. Microbiology
149: 2273-2281
[Abstract]
[Full Text]
-
Hazlett, K. R. O., Rusnak, F., Kehres, D. G., Bearden, S. W., La Vake, C. J., La Vake, M. E., Maguire, M. E., Perry, R. D., Radolf, J. D.
(2003). The Treponema pallidum tro Operon Encodes a Multiple Metal Transporter, a Zinc-dependent Transcriptional Repressor, and a Semi-autonomously Expressed Phosphoglycerate Mutase. J. Biol. Chem.
278: 20687-20694
[Abstract]
[Full Text]
-
Janulczyk, R., Ricci, S., Bjorck, L.
(2003). MtsABC Is Important for Manganese and Iron Transport, Oxidative Stress Resistance, and Virulence of Streptococcus pyogenes. Infect. Immun.
71: 2656-2664
[Abstract]
[Full Text]
-
Schmitt, M. P.
(2002). Analysis of a DtxR-Like Metalloregulatory Protein, MntR, from Corynebacterium diphtheriae That Controls Expression of an ABC Metal Transporter by an Mn2+-Dependent Mechanism. J. Bacteriol.
184: 6882-6892
[Abstract]
[Full Text]
-
Boyer, E., Bergevin, I., Malo, D., Gros, P., Cellier, M. F. M.
(2002). Acquisition of Mn(II) in Addition to Fe(II) Is Required for Full Virulence of Salmonella enterica Serovar Typhimurium. Infect. Immun.
70: 6032-6042
[Abstract]
[Full Text]
-
Yamaguchi, K., Suzuki, I., Yamamoto, H., Lyukevich, A., Bodrova, I., Los, D. A., Piven, I., Zinchenko, V., Kanehisa, M., Murata, N.
(2002). A Two-Component Mn2+-Sensing System Negatively Regulates Expression of the mntCAB Operon in Synechocystis. Plant Cell
14: 2901-2913
[Abstract]
[Full Text]
-
Ogawa, T., Bao, D. H., Katoh, H., Shibata, M., Pakrasi, H. B., Bhattacharyya-Pakrasi, M.
(2002). A Two-component Signal Transduction Pathway Regulates Manganese Homeostasis in Synechocystis 6803, a Photosynthetic Organism. J. Biol. Chem.
277: 28981-28986
[Abstract]
[Full Text]
-
Kehres, D. G., Janakiraman, A., Slauch, J. M., Maguire, M. E.
(2002). Regulation of Salmonella enterica Serovar Typhimurium mntH Transcription by H2O2, Fe2+, and Mn2+. J. Bacteriol.
184: 3151-3158
[Abstract]
[Full Text]
-
Fuangthong, M., Herbig, A. F., Bsat, N., Helmann, J. D.
(2002). Regulation of the Bacillus subtilis fur and perR Genes by PerR: Not All Members of the PerR Regulon Are Peroxide Inducible. J. Bacteriol.
184: 3276-3286
[Abstract]
[Full Text]