Previous Article | Next Article 
Journal of Bacteriology, September 2001, p. 5198-5202, Vol. 183, No. 17
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.17.5198-5202.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Regulation and Mechanism of Action of the Small Heat Shock
Protein from the Hyperthermophilic Archaeon
Pyrococcus furiosus
Pongpan
Laksanalamai,
Dennis
L.
Maeder, and
Frank T.
Robb*
Center of Marine Biotechnology, University of
Maryland Biotechnology Institute, Baltimore, Maryland 21202
Received 5 January 2001/Accepted 4 June 2001
 |
ABSTRACT |
The small heat shock protein (sHSP) from the hyperthermophile
Pyrococcus furiosus was specifically induced at the
level of transcription by heat shock at 105°C. The gene encoding this
protein was cloned and overexpressed in Escherichia
coli. The recombinant sHSP prevented the majority of E.
coli proteins from aggregating in vitro for up to 40 min at
105°C. The sHSP also prevented bovine glutamate dehydrogenase from
aggregating at 56°C. Survivability of E. coli
overexpressing the sHSP was enhanced approximately sixfold during
exposure to 50°C for 2 h compared with the control culture,
which did not express the sHSP. Apparently, the sHSP confers a survival
advantage on mesophilic bacteria by preventing protein aggregation at
supraoptimal temperatures.
| |
TEXT |
Hyperthermophilic microorganisms
that can grow at or above 100°C are now fairly well known. However,
little is known about their adaptive responses to extremely high
temperatures. Ubiquitous heat shock responses are observed when
organisms are confronted by near-lethal temperatures. Sets of proteins
with diverse functions known as heat shock proteins (HSPs) are induced
in response to abrupt temperature changes (11). The
synthesis of these proteins can lead to acquired thermotolerance,
allowing the organisms to survive at even higher temperatures (9,
21, 33, 36). HSPs have been divided into five classes based on
their molecular weights: HSP100, HSP90, HSP70, HSP60, and small HSPs
(sHSPs) (35). Most HSPs function as molecular chaperones,
catalyzing refolding of denatured proteins, assisting maturation of
newly synthesized proteins, or suppressing protein aggregation
(7, 8, 10, 22).
sHSPs are a common class of HSPs; their molecular masses range from 15 to 42 kDa, and they normally form multisubunit complexes of 200 to 800 kDa (13). Some sHSPs are abundant in nonstressed cells
(18), but others are stress induced (20, 29).
Most sHSPs share a conserved motif with 
-crystallin proteins, which are ubiquitous proteins found in vertebrate eye lenses and which are
known to function as molecular chaperones (10, 15, 34). The in vivo functions of sHSPs remain unclear. It has been proposed that they confer thermotolerance or tolerance to chemical challenges such as superoxide (17). Survival of an HSP30-deficient
mutant of Neurospora crassa under high-temperature,
carbohydrate-limited conditions was shown to be reduced dramatically
compared to survival of the wild type (26). However,
mechanisms of action have not been defined.
In particular, the functions and regulation of archaeal sHSPs remain
unclear, although the sHSP from the hyperthermophilic methanogenic
archaeon Methanococcus jannaschii has been cloned and
expressed and its crystal structure has been reported
(14). Based on its crystal structure, the M. jannaschii sHSP forms oligomeric structures having 24 subunits of
the 16.5-kDa monomer. We have studied the sHSP from Pyrococcus
furiosus (Pfu-sHSP), a hyperthermophilic archaeon that grows
optimally at about 100°C (4). We report the cloning and
regulation of Pfu-sHSP, the effects of its overexpression in
Escherichia coli, and the mechanism of its action in
stabilizing a mesophilic protein at elevated temperatures.
Sequence comparison and phylogenetic analysis.
The Pfu-sHSP
gene was identified from the genome sequence (27) based on
its similarity to other -crystallin-like sHSP genes. The protein is
composed of 167 amino acids encoded by an open reading frame of 504 nucleotides (GenBank accession no. AF256212) and has a predicted
pI of 5.25. The low-molecular-weight sHSPs have significantly higher
diversities in size and amino acid sequence than do the
higher-molecular-weight HSPs (24). The amino acid sequence
of Pfu-sHSP showed low similarity to the sHSP of Clostridium acetobutylicum and to other bacterial and eukaryotic sHSPs
(31). Typically, a nonconserved region occurs at the amino
terminus (14).
Comparison of the amino acid sequences of Pfu-sHSP with other sHSPs by
BestFit (Wisconsin Package, version 10.0; Genetics Computer Group,
Madison, Wis.) reveals, not surprisingly, that the sHSP of the marine
hyperthermophilic archaeon Pyrococcus horikoshii (5) has the highest percent identity and similarity to
Pfu-sHSP. Interestingly, the sHSP from the bacterium Aquifex
aeolicus is more similar to that of P. furiosus than
are sHSPs from archaea with lower optimal growth
temperatures. The sHSP from the mesophilic bacterium C. acetobutylicum shows the lowest percent identity to Pfu-sHSP
(Table 1).
Native Pfu-sHSP and its mRNA are induced by heat shock.
In
order to determine whether Pfu-sHSP is regulated in response to heat
shock, we obtained polyclonal antiserum against Pfu-sHSP by
immunization of a rabbit with purified, recombinant Pfu-sHSP (BioWorld,
Dublin, Ohio). Western blot analysis using this antiserum demonstrated
that Pfu-sHSP is indeed heat shock inducible. P. furiosus
was cultured in a modified 20-liter fermentor (New Brunswick) under standard conditions with 5 g of
S0/liter (1). The cultures were
incubated at 95°C for 4 h and then shifted to 105°C for 0, 30, 60, or 120 min before being chilled on ice and harvested by
centrifugation at 7,500 × g for 15 min. Heat shock was
carried out at 105°C because the maximum temperature for growth of
P. furiosus is 103°C (4). The total protein
levels of the cell extracts were measured, and equal amounts of protein were loaded onto each lane of a sodium dodecyl sulfate
(SDS)-polyacrylamide gel (Fig. 1A).
Western blot analysis was done as described elsewhere (30). A strong signal was observed at 20 kDa (Fig. 1B,
lanes 2 to 4), corresponding to 30, 60, and 120 min after the onset of
heat shock, whereas no signal was observed for the non-heat-shocked control culture (Fig. 1B, lane 1). This indicates that native Pfu-sHSP
is strictly heat inducible and that Pfu-sHSP is apparently not required
for rapid growth at the optimal growth temperature.
View larger version (48K):
[in this window]
[in a new window]
|
FIG. 1.
Expression of native Pfu-sHSP. Protein expression is
shown by SDS-15% PAGE and Western blot analysis in panels A
and B, respectively. (A and B) Lanes 1, culture growing at 95°C;
lanes 2, 3, and 4, P. furiosus cultures after heat shock
treatment at 105°C for 30, 60, and 120 min, respectively. The
vertical bars on the left show the section of the gel represented in
the Western blot analysis. Northern blot analyses of Pfu-sHSP gene mRNA
expression and P. furiosus GDH gene mRNA (control)
expression are shown in panels C and D, respectively. (C and D) Lanes
1, autoradiogram of a blot of mRNA from non-heat-shocked cells; lanes
2, corresponding mRNA signals from heat-shocked cells.
|
|
We measured the expression of mRNA from the gene encoding Pfu-sHSP
under heat shock conditions by Northern blot analysis
(
30).
Total RNA was isolated from
P. furiosus
after exposure to 105°C
for 120 min and compared to a
non-heat-shocked control culture.
Total RNA (4 µg) was
electrophoresed on a 1.5% agarose gel for
Northern blot analysis with
a radiolabeled PCR probe from the
Pfu-sHSP gene generated by PCR
amplification using [
32P]dCTP. Hybridization
with this probe revealed a transcript of
600 nucleotides, corresponding
to the size of the putative Pfu-sHSP
gene (Fig.
1C). A radiolabeled
probe from the gene encoding
P. furiosus glutamate
dehydrogenase (GDH), which is expressed constitutively
(
3,
32), was used as a control (Fig.
1D).
Cloning, overexpression, and purification of Pfu-sHSP in E.
coli.
The region encoding the 504-nucleotide Pfu-sHSP gene
was amplified from P. furiosus genomic DNA by PCR using
primers Pfu-shspN, containing an NcoI site (C'CATG_G
[underlined in the full primer sequence])
(5'GCCATGGTGAGGAGAATAAGAAGATGG), and Pfu-shspC,
containing an XhoI site (C'TCGA_G [underlined in the full
primer sequence]) (5'ACTCGAGCTATTCAACTTTAACTTCGAATCCTTC). The gene
fragment was cloned into the pCR Zero Blunt vector (Invitrogen,
Carlsbad, Calif.). The insert was digested by NcoI and
XhoI and then subcloned into the IPTG
(isopropyl-1-thio-
-D-galactopyranoside)-inducible
pET19b expression vector (Novagen, Madison, Wis.). The construct
was designated pPfu-shsp. E. coli BL21(DE3) (Novagen),
carrying pSJS1240, which encodes the rare E. coli
Arg-tRNAAGA and Ile-tRNAATA
(16), was used as an expression host. E. coli
cultures were grown in Luria-Bertani broth in the presence of 50 µg
each of ampicillin and spectinomycin per ml to an
A595 of 0.6. Pfu-sHSP expression was
induced by the addition of 1 mM IPTG for 3 h. The same strain
carrying pET19b and pSJS1240 was the negative control. SDS-polyacrylamide gel electrophoresis (PAGE) of E. coli
overexpressing Pfu-sHSP crude extract revealed an additional protein of
20 kDa, which corresponds to the protein molecular weight deduced from the predicted amino acid sequence. After induction, E. coli
cells overexpressing Pfu-sHSP were harvested and resuspended in 25 mM potassium phosphate buffer (pH 7.0)-2 mM dithiothreitol-1 mM EDTA (buffer A). The cells were disrupted using a French press (SLM Instruments, Urbana, Ill.) at 16,000 lb/in2, and
the extract was centrifuged at 5,000 × g for 15 min.
Pfu-sHSP appeared in the particulate fraction as indicated by SDS-PAGE. The pellet was washed and dissolved in buffer A by heating at 85°C
for 20 min. The dissolved pellet was then filtered and loaded onto an
anion-exchange column (MonoQ; Pharmacia Biotech, Uppsala, Sweden)
previously equilibrated with buffer A. Pfu-sHSP was eluted as a single
peak at 0.35 M NaCl by using a linear gradient from 0 to 1 M NaCl.
Fractions were subsequently pooled and concentrated.
Protection of E. coli cell extracts by Pfu-sHSP at
105°C.
Several sHSPs are known to prevent aggregation of
proteins during heating in vitro (15, 23). We examined the
effect of Pfu-sHSP expressed in E. coli. The cells were
harvested and prepared as described above. The total protein
concentration was determined using the Bradford protein assay kit
(Bio-Rad, Hercules, Calif.). The cell extracts were diluted in buffer A
to a uniform protein concentration of 4 mg/ml. Diluted cell extracts
were covered with mineral oil and heated at 105°C for 0, 20, 30, and
40 min in 1.5-ml microcentrifuge tubes. After being cooled to room
temperature, the samples were centrifuged at 10,000 × g for 5 min at 25°C and the supernatants were collected.
The residual proteins were visualized by SDS-PAGE and subjected to the
Bradford protein concentration assay. At least 90% of the proteins in
the E. coli cell extracts containing overexpressed Pfu-sHSP
remained soluble after heat treatment for 40 min and appeared in the
supernatant fractions (Fig. 2).
Approximately 30% of the soluble proteins remained in the control
supernatants after heat treatment. SDS-PAGE showed that
high-molecular-weight proteins of E. coli were protected by
Pfu-sHSP, whereas those in the control were rapidly aggregated at
105°C (Fig. 2). This finding indicates that sHSP prevents aggregation of many different proteins at or above their denaturing temperatures.
View larger version (124K):
[in this window]
[in a new window]
|
FIG. 2.
SDS-15% PAGE analysis of thermal protection of
E. coli crude extracts by Pfu-sHSP at 105°C. Lanes 1 (E. coli crude extracts without Pfu-sHSP) and 2 (E. coli with overexpressed Pfu-sHSP) represent control
experiments without heat treatment. Lanes 3, 5, and 7 show E.
coli crude extracts without overexpressed Pfu-sHSP heated to
105°C for 20, 30, and 40 min, respectively; lanes 4, 6, and 8 show
E. coli crude extracts with overexpressed Pfu-sHSP
heated to 105°C for 20, 30, and 40 min, respectively.
|
|
Pfu-sHSP prevents aggregation of mesophilic GDH as a result of heat
inactivation.
Since Pfu-sHSP can prevent aggregation of other
proteins in response to heat stress, we addressed the question of
whether or not it could extend the half-life
(t1/2) of a purified enzyme in vitro.
Bovine glutamate dehydrogenase (boGDH) (Sigma, Milwaukee, Wis.) was
used as a model. boGDH is a mesophilic enzyme with an optimal assay
temperature of 25°C that is inactivated rapidly at 56°C. Purified
Pfu-sHSP was added to solutions of boGDH during heat treatment at
56°C in EPPS
(N-2-hydroxyethylpiperazine-N'-3-propanesulfonic acid) buffer, pH 8.0, to a boGDH concentration of 0.9 mg/ml,
with 2.25 mg of purified Pfu-sHSP/ml. Samples were removed and assayed at 0, 2, 4, and 8 min and centrifuged at 10,000 × g
for 2 min. The residual activities of boGDH in the supernatant samples
were assayed as described previously (28) using a Beckman
DU640 spectrophotometer with the temperature controlled at the optimum,
25°C. The assay mixture contained 100 mM EPPS (pH 8.0), 65 mM
glutamic acid, and 16.25 mM NADP. There was no detectable GDH activity
in the purified Pfu-sHSP (data not shown).
The
t1/2 for boGDH precipitation was
measured by centrifugation and recording of the
A280 of the supernatant. In the
experiment
in which boGDH was incubated alone, the apparent
t1/2 was approximately
2 min, whereas
the boGDH to which sHSP was added did not precipitate
at all during the
course of the experiment. The activity of boGDH
in the supernatants, on
the other hand, declined in both cases
(Fig.
3). Thus, much of the boGDH that remained
in solution was
soluble but inactive. In this case, the enzyme was
maintained
in solution but not preserved from denaturation. This is an
important
result, indicating that the probable mode of action of
Pfu-sHSP
is toward aggregation of nonnative proteins, thus allowing
them
to be recruited to either refolding or protein turnover pathways.
View larger version (25K):
[in this window]
[in a new window]
|
FIG. 3.
Effects of Pfu-sHSP on boGDH incubated at 56°C for up
to 8 min. Solubility is shown as log2
A280 of boGDH in the presence ( ) and
absence ( ) of Pfu-sHSP (solid lines). Activity of boGDH is shown in
the presence ( ) and absence ( ) of Pfu-sHSP (dashed lines).
|
|
We addressed the question of the subunit structure of Pfu-sHSP by
incubating purified Pfu-sHSP and
E. coli extracts containing
expressed Pfu-sHSP in 0.01% (wt/vol) glutaraldehyde to cross-link
the
proteins. The control and cross-linked preparations were subjected
to
SDS-PAGE and visualized by silver staining and Western blotting
(Fig.
4). In contrast to
M. jannaschii sHSP, which is reported
to occur mostly as 24-mers
(
14), Pfu-sHSP appears to be polydisperse.
This
characteristic has been reported for several other
-crystallin
homologs (
6). The polydisperse patterns of the Pfu-sHSP
polymer
from purified Pfu-sHSP and from
E. coli crude
extracts are indistinguishable.
View larger version (88K):
[in this window]
[in a new window]
|
FIG. 4.
Cross-linking of purified Pfu-sHSP and Pfu-sHSP in
unpurified E. coli extracts as visualized by Western
blot analysis (a) and silver-stained SDS-12% PAGE (b). Lanes 1, un-cross-linked purified Pfu-sHSP; lanes 2, cross-linked purified
Pfu-sHSP; lanes 3, un-cross-linked E. coli extracts;
lanes 4, cross-linked E. coli extracts.
|
|
Survivability at 50°C of E. coli overexpressing
Pfu-sHSP.
sHSPs from the chestnut (Castanea sativa) and
from murine and human -crystallin have been shown to
confer slight thermotolerance at 50°C on E. coli
(23, 25, 34). We show here that an archaeal sHSP can also
confer very significant thermotolerance on a typical mesophilic
bacterium. E. coli cultures containing pPfu-shsp/pSJS1240 were induced as described above, and the cells were diluted in Luria-Bertani broth containing 50 µg each of ampicillin and
spectinomycin per ml to an A595
of 0.6. The cultures were rapidly shifted to 50°C in a water bath
shaker. Samples were removed at 0, 20, 40, 60, and 120 min, diluted
appropriately, and plated on Luria-Bertani agar containing 50 µg each
of ampicillin and spectinomycin per ml, and the plates were incubated
at 37°C overnight. Cell viability was determined by counting of CFU
after overnight incubation. The first-order rate of decline of
viability of E. coli overexpressing Pfu-sHSP was
significantly higher, approximately six- to sevenfold, than that of the
culture transformed with pET19b and pSJS1240 (Fig.
5). As a result, the difference in
viability between protected and unprotected cells after a 120-min
exposure at 50°C was approximately 50-fold.
View larger version (14K):
[in this window]
[in a new window]
|
FIG. 5.
Effect of recombinant Pfu-sHSP expression on E.
coli viability at 50°C. The reduction of viability as an
exponential function of time is shown. , pET19b/pSJS1240; ,
pPfu-shsp/pSJS1240.
|
|
We conclude that Pfu-sHSP increases the thermotolerance of
E. coli by preventing aggregation of heat-compromised proteins.
Because many proteins from hyperthermophiles are nonfunctional
at the
optimal growth temperatures of mesophiles, it is intriguing
that a
component of the adaptive response of an archaeon growing
at 100°C
can enhance the heat resistance in
E. coli cells growing
at
"mesophilic" temperatures. However, Trent et al. found that
the
chaperonin TF55 from
Sulfolobus shibatae can bind a
denatured
protein at 25°C as efficiently as at 70°C
(
37). These findings
will enable us to assess the
biological activity of sHSP mutants
by using
E. coli as a
surrogate genetic system for
P. furiosus,
which lacks
systems for mutation selection and recombinant gene
expression.
| |
ACKNOWLEDGMENTS |
We thank Juan M. Gonzalez for providing P. furiosus
genomic DNA, Jocelyne DiRuggiero and Robert Belas for critical
discussions, and Anchalee Jiemjit for technical assistance and
assistance with the manuscript.
This work was supported by grants from the National Science Foundation
(grant BES-9632554 to F.T.R.) and the Knut and Alice Wallenberg Foundation.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Center of Marine
Biotechnology, University of Maryland Biotechnology Institute, 701 E. Pratt St., Baltimore, MD 21202. Phone: (410) 234-8870. Fax: (410)
234-8896. E-mail: robb{at}umbi.umd.edu.
Contribution 524 from the Center of Marine Biotechnology.
| |
REFERENCES |
| 1.
|
Adams, M. W. W.
1995.
Large-scale growth of hyperthermophiles, p. 47-49.
In
F. T. Robb, and A. R. Place (ed.), Archaea: a laboratory manual, vol. 3. Thermophiles. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 2.
|
Deckert, G.,
P. V. Warren,
T. Gaasterland,
W. G. Young,
A. L. Lenox,
D. E. Graham,
R. Overbeek,
M. A. Snead,
M. Keller,
M. Aujay,
R. Huber,
R. A. Feldman,
J. M. Short,
G. J. Olsen, and R. V. Swanson.
1998.
The complete genome of the hyperthermophilic bacterium Aquifex aeolicus.
Nature
392:353-358[CrossRef][Medline].
|
| 3.
|
DiRuggiero, J., and F. T. Robb.
1996.
Enzymes of central nitrogen metabolism from hyperthermophiles: characterization, thermostability, and genetics.
Adv. Protein Chem.
48:311-339[Medline].
|
| 4.
|
Fiala, G., and K. O. Stetter.
1986.
P. furiosus sp. nov. represents a novel genus of marine heterotrophic archaebacteria growing optimally at 100°C.
Arch. Microbiol.
145:56-61[CrossRef].
|
| 5.
|
Gonzalez, J. M.,
Y. Masuchi,
F. T. Robb,
J. W. Ammerman,
D. L. Maeder,
M. Yanagibayashi,
J. Tamaoka, and C. Kato.
1998.
Pyrococcus horikoshii sp. nov., a hyperthermophilic archaeon isolated from a hydrothermal vent at the Okinawa Trough.
Extremophiles
2:123-130[CrossRef][Medline].
|
| 6.
|
Haley, D. A.,
M. P. Bova,
Q.-L. Huang,
H. S. Mchaourab, and P. L. Stewart.
2000.
Small heat-shock protein structures reveal a continuum from symmetric to variable assemblies.
J. Mol. Biol.
298:261-272[CrossRef][Medline].
|
| 7.
|
Hartl, F. U.
1996.
Molecular chaperones in cellular protein folding.
Nature
381:571-580[CrossRef][Medline].
|
| 8.
|
Hayes, S. A., and J. F. Dice.
1996.
Roles of molecular chaperones in protein degradation.
J. Cell Biol.
132:255-258[Free Full Text].
|
| 9.
|
Hightower, L. E.
1991.
Heat shock, stress proteins, chaperones, and proteotoxicity.
Cell
66:191-197[CrossRef][Medline].
|
| 10.
|
Horwitz, J.
1992.
-Crystallin can function as a molecular chaperone.
Proc. Natl. Acad. Sci. USA
89:10449-10453[Abstract/Free Full Text].
|
| 11.
|
Kagawa, H. K.,
J. Osipiuk,
N. Maltsev,
R. Overbeek,
E. Quaite-Randall,
A. Joachimiak, and J. D. Trent.
1995.
The 60 kDa heat shock proteins in the hyperthermophilic archaeon Sulfolobus shibatae.
J. Mol. Biol.
253:712-725[CrossRef][Medline].
|
| 12.
|
Kawarabayasi, Y.,
M. Sawada,
H. Horikawa,
Y. Haikawa,
Y. Hino,
S. Yamamoto,
M. Sekine,
S. Baba,
H. Kosugi,
A. Hosoyama,
Y. Nagai,
M. Sakai,
K. Ogura,
R. Otsuka,
H. Nakazawa,
M. Takamiya,
Y. Ohfuku,
T. Funahashi,
T. Tanaka,
Y. Kudoh,
J. Yamazaki,
N. Kushida,
A. Oguchi,
K. Aoki,
T. Yoshizawa,
Y. Nakamura,
F. T. Robb,
K. Horikoshi,
Y. Masuchi,
H. Shizuya, and H. Kikuchi.
1998.
Complete sequence and gene organization of the genome of a hyper-thermophilic archaebacterium, Pyrococcus horikoshii OT3.
DNA Res.
5:55-76[Abstract].
|
| 13.
|
Kim, K. K.,
H. Yakota,
S. Santoso,
D. Lerner,
R. Kim, and S.-H. Kim.
1998.
Purification, crystallization and preliminary X-ray crystallographic data analysis of a small heat shock protein homolog from Methanococcus jannaschii, a hyperthermophile.
J. Struct. Biol.
121:76-80[CrossRef][Medline].
|
| 14.
|
Kim, K. K.,
R. Kim, and S.-H. Kim.
1998.
Crystal structure of a small heat shock protein.
Nature
394:595-599[CrossRef][Medline].
|
| 15.
|
Kim, R.,
K. K. Kim,
H. Yokota, and S.-H. Kim.
1998.
Small heat shock protein of Methanococcus jannaschii, a hyperthermophile.
Proc. Natl. Acad. Sci. USA
95:9129-9133[Abstract/Free Full Text].
|
| 16.
|
Kim, R.,
S. J. Sandler,
S. Goldman,
H. Yokota,
A. J. Clark, and S.-H. Kim.
1998.
Overexpression of archaeal proteins in Escherichia coli.
Biotechnol. Lett.
20:207-210[CrossRef].
|
| 17.
|
Kitagawa, M.,
Y. Matsumura, and T. Tsuchido.
2000.
Small heat shock proteins, IbpA and IbpB, are involved in resistances to heat and superoxide stress in Escherichia coli.
FEMS Microbiol. Lett.
184:165-171[CrossRef][Medline].
|
| 18.
|
Klemenz, R.,
A. C. Andres,
E. Frohli,
R. Schafer, and A. Aoyama.
1993.
Expression of the murine small heat shock proteins hsp25 and B-crystallin in the absence of stress.
J. Cell Biol.
120:639-645[Abstract/Free Full Text].
|
| 19.
|
Klenk, H. P.,
R. A. Clayton,
J. Tomb,
O. White,
K. E. Nelson,
K. A. Ketchum,
R. J. Dodson,
M. Gwinn,
E. K. Hickey,
J. D. Peterson,
D. L. Richardson,
A. R. Kerlavage,
D. E. Graham,
N. C. Kyrpides,
R. D. Fleischmann,
J. Quackenbush,
N. H. Lee,
G. G. Sutton,
S. Gill,
E. F. Kirkness,
B. A. Dougherty,
K. McKenney,
M. D. Adams,
B. Loftus,
S. Peterson,
C. I. Reich,
L. K. McNeil,
J. H. Badger,
A. Glodek,
L. Zhou,
R. Overbeek,
J. D. Gocayne,
J. F. Weidman,
L. McDonald,
T. Utterback,
M. D. Cotton,
T. Spriggs,
P. Artiach,
B. P. Kaine,
S. M. Sykes,
P. W. Sadow,
K. P. D'Andrea,
C. Bowman,
C. Fujii,
S. A. Garland,
T. M. Mason,
G. J. Olsen,
C. M. Fraser,
H. O. Smith,
C. R. Woese, and J. C. Venter.
1997.
The complete genome sequence of the hyperthermophilic, sulphate-reducing archaeon Archaeoglobus fulgidus.
Nature
390:364-370[CrossRef][Medline].
|
| 20.
|
Leroux, M. R.,
R. Melki,
B. Gordon,
D. Batelier, and E. P. M. Candido.
1997.
Structure-function studies on small heat shock protein oligomeric assembly and interaction with unfolded polypeptides.
J. Biol. Chem.
272:24646-24656[Abstract/Free Full Text].
|
| 21.
|
Lindquist, S.
1992.
Heat shock proteins and stress tolerance in microorganisms.
Curr. Opin. Genet.
2:748-755[CrossRef][Medline].
|
| 22.
|
Martin, J., and F. U. Hartl.
1997.
Chaperone-assisted protein folding.
Curr. Opin. Struct. Biol.
7:41-52[CrossRef][Medline].
|
| 23.
|
Muchowski, P., and J. I. Clark.
1998.
ATP-enhanced molecular chaperone functions of the small heat shock protein human B-crystallin.
Proc. Natl. Acad. Sci. USA
95:1004-1009[Abstract/Free Full Text].
|
| 24.
|
Nagao, R. T.,
E. Czarnecka,
W. B. Gurley,
F. Schoffl, and J. L. Key.
1985.
Genes for low-molecular-weight heat shock proteins of soybeans: sequence analysis of a multigene family.
Mol. Cell. Biol.
5:3417-3428[Abstract/Free Full Text].
|
| 25.
|
Plater, M. L.,
D. Goode, and M. J. C. Crabbe.
1996.
Effects of site-directed mutations on the chaperone-like activity of B-crystallin.
J. Biol. Chem.
271:28558-28566[Abstract/Free Full Text].
|
| 26.
|
Plesofsky-Vig, N., and R. Brambl.
1995.
Disruption of the gene for hsp30, an -crystallin-related heat shock protein of Neurospora crassa, causes defects in thermotolerance.
Proc. Natl. Acad. Sci. USA
92:5032-5036[Abstract/Free Full Text].
|
| 27.
|
Robb, F. T.,
D. L. Maeder,
J. R. Brown,
J. DiRuggiero,
M. D. Stump,
R. K. Yeh,
R. B. Weiss, and D. M. Dunn.
2001.
Genomic sequence of hyperthermophile Pyrococcus furiosus: implications for physiology and enzymology.
Methods Enzymol.
330:134-157[Medline].
|
| 28.
|
Robb, F. T.,
J. B. Park, and M. W. W. Adams.
1992.
Characterization of an extremely thermostable glutamate dehydrogenase: a key enzyme in the primary metabolism of the hyperthermophilic archaebacterium Pyrococcus furiosus.
Biochim. Biophys. Acta
1120:267-272[CrossRef][Medline].
|
| 29.
|
Roy, S. K.,
T. Hiyama, and H. Nakamoto.
1999.
Purification and characterization of the 16-KDa heat-shock-responsive protein from the thermophilic cyanobacterium Synechococcus vulcanus, which is an -crystallin-related, small heat shock protein.
Eur. J. Biochem.
262:406-416[Medline].
|
| 30.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 31.
|
Sauer, U., and P. Durre.
1993.
Sequence and molecular characterization of a DNA region encoding a small heat shock protein of Clostridium acetobutylicum.
J. Bacteriol.
175:3394-3400[Abstract/Free Full Text].
|
| 32.
|
Schreier, H. J.,
K. A. Robinson-Bidle,
A. M. Romashko, and G. V. Patel.
1999.
Heterologous expression in the archaea: transcription from Pyrococcus furiosus gdh and mlrA promoters in Haloferax volcanii.
Extremophiles
3:11-19[CrossRef][Medline].
|
| 33.
|
Smith, D. R.,
L. A. Doucette-Stamm,
C. Deloughery,
H. M. Lee,
J. Dubois,
T. Aldredge,
R. Bashirzadeh,
D. Blakely,
R. Cook,
K. Gilbert,
D. Harrison,
L. Hoang,
P. Keagle,
W. Lumm,
B. Pothier,
D. Qiu,
R. Spadafora,
R. Vicaire,
Y. Wang,
J. Wierzbowski,
R. Gibson,
N. Jiwani,
A. Caruso,
D. Bush,
H. Safer,
D. Patwell,
S. Prabhakar,
S. McDougall,
G. Shimer,
A. Goyal,
S. Pietrokovski,
G. M. Church,
C. J. Daniels,
J.-I. Mao,
P. Rice,
J. Nolling, and J. N. Reeve.
1997.
Complete genome sequence of Methanobacterium thermoautotrophicum  H: functional analysis and comparative genomics.
J. Bacteriol.
179:7135-7155[Abstract/Free Full Text].
|
| 34.
|
Soto, A.,
I. Allona,
C. Collada,
M.-A. Guevara,
R. Casado,
E. Rodriguez-Cerezo,
C. Aragoncillo, and L. Gomez.
1999.
Heterologous expression of a plant small heat-shock protein enhances Eschericia coli viability under heat and cold stress.
Plant Physiol.
120:521-528[Abstract/Free Full Text].
|
| 35.
|
Trent, J. D.
1996.
A review of acquired thermotolerance, heat-shock proteins and molecular chaperones in archaea.
FEMS Microbiol. Rev.
18:249-258.
|
| 36.
|
Trent, J. D.,
M. Gabrielsen,
B. Jensen,
J. Neuhard, and J. Olsen.
1994.
Acquired thermotolerance and heat shock proteins in thermophiles from the three phylogenetic domains.
J. Bacteriol.
176:6148-6152[Abstract/Free Full Text].
|
| 37.
|
Trent, J. D.,
E. Nimmesgern,
J. S. Wall,
F. U. Hartl, and A. L. Horwich.
1991.
A molecular chaperone from a thermophilic archaebacterium is related to the eukaryotic protein t-complex polypeptide-1.
Nature
354:490-493[CrossRef][Medline].
|
| 38.
|
Tzeng, S.-S.,
K. W. Yeh,
Y. M. Chen, and C.-Y. Lin.
1992.
Two Oryza sativa genomic DNA clone 16.9-kilodalton heat shock proteins.
Plant Physiol.
99:1723-1725[Free Full Text].
|
Journal of Bacteriology, September 2001, p. 5198-5202, Vol. 183, No. 17
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.17.5198-5202.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Baldridge, G. D., Burkhardt, N. Y., Felsheim, R. F., Kurtti, T. J., Munderloh, U. G.
(2007). Transposon Insertion Reveals pRM, a Plasmid of Rickettsia monacensis. Appl. Environ. Microbiol.
73: 4984-4995
[Abstract]
[Full Text]
-
Albers, S.-V., Jonuscheit, M., Dinkelaker, S., Urich, T., Kletzin, A., Tampe, R., Driessen, A. J. M., Schleper, C.
(2006). Production of Recombinant and Tagged Proteins in the Hyperthermophilic Archaeon Sulfolobus solfataricus. Appl. Environ. Microbiol.
72: 102-111
[Abstract]
[Full Text]
-
Shockley, K. R., Ward, D. E., Chhabra, S. R., Conners, S. B., Montero, C. I., Kelly, R. M.
(2003). Heat Shock Response by the Hyperthermophilic Archaeon Pyrococcus furiosus. Appl. Environ. Microbiol.
69: 2365-2371
[Abstract]
[Full Text]
-
Vierke, G., Engelmann, A., Hebbeln, C., Thomm, M.
(2003). A Novel Archaeal Transcriptional Regulator of Heat Shock Response. J. Biol. Chem.
278: 18-26
[Abstract]
[Full Text]
-
Bova, M. P., Huang, Q., Ding, L., Horwitz, J.
(2002). Subunit Exchange, Conformational Stability, and Chaperone-like Function of the Small Heat Shock Protein 16.5 from Methanococcus jannaschii. J. Biol. Chem.
277: 38468-38475
[Abstract]
[Full Text]
Top
Abstract
Text
