TEXT

Top Abstract Text References

Integration of the genome of bacteriophage lambda into the chromosome of its host and excision of the prophage form of lambda have long been studied as the paradigm of site-specific recombination. Recombination between the attP site on the circularized, 48-kDa viral genome and the attB site on the chromosome results in integration, whereas recombination between the attL and attR sites at the prophage junctions results in excision. While the earliest studies focused on the intact viral genome, by the 1970s systems were developed for studying integration and excision both in vivo and in vitro using artificial substrates such as the att² phage which carry two recombining sites on a single virus genome and plasmids carrying cloned att sites. Integration was found to require the phage-encoded Int and the host-encoded integration host factor proteins, whereas excision required both these proteins and the phage-encoded Xis and host-encoded factor for inversion stimulation (FIS) proteins (Fig. 1) (for a review, see reference 7).

View larger version (12K): [in this window] [in a new window]   FIG. 1.   Diagram of lambda prophage excision. Heavy dashed lines, chromosomal DNA; light lines, lambda DNA; horizontal arrow, primer (5' ATGTGTTCACAGGTTGCTCCG); short vertical arrows, restriction enzyme sites.

My interest in lambda excision was piqued by an earlier work on replicative transposition of bacteriophage Mu, in particular, the requirement for a special mechanism for promoting the rapid synapsis of Mu prophage ends (6). The question arose as to whether a mechanism exists to promote the long-range DNA interactions required for synapsis of attL and attR during excision. The lambda prophage, like the Mu prophage, is large (about 10 kb larger than Mu) and resides within the complex structure of the host nucleoid. However, synapsis of the lambda prophage ends is not subject to the topological restraints imposed on synapsis of Mu ends. Lambda recombination can occur between att sites in direct or indirect orientation and as an intramolecular or intermolecular reaction. Synapsis of Mu ends requires that they be plectonemically interwound in only one orientation.

If a special mechanism is required for rapid synapsis of lambda prophage termini, an appealing model is the following. Upon induction, in situ, bidirectional replication of the prophage from an internal origin is initiated, with replication proceeding beyond the prophage ends into adjacent bacterial DNA, resulting in an "onionskin" of multiple prophage copies (3). If, rather than moving apart on the DNA, the replication forks are held together, perhaps at a membrane site, then the replicating DNA will be spooled through the replication machinery and the termini will be drawn together, perhaps assisting in synapsis. The model predicts that excision should be slowed in the absence of lambda-specific replication. While evidence exists which shows that excised lambda can be observed as early as 15 min after thermoinduction of a cI857 lysogen (5), a careful comparison with the kinetics of excision of nonreplicating prophage is lacking. In this study I reexamined excision of lambda prophages using a sensitive, new assay to address the predictions of this model.

Recombination between attL and attR during excision restores attB and attP (Fig. 1). A primer derived from a sequence in the bacterial DNA adjacent to attB can be used to assess the relative amounts of attL and attB and the percent excision. DNA is isolated at intervals after induction, purified by phenol extraction, and cleaved with selected restriction enzymes (AvaI and HaeII in these experiments). The cleaved DNA is used together with a ³²P-end-labeled primer in 30 cycles of primer extension in a PCR apparatus. Two fragments can be generated: a 219-bp attL-associated fragment from the primer site to the AvaI site and a 190-bp attB-associated fragment from the primer site to the HaeII site. The former is present before excision and the latter is present after excision. The fragments are separated on a sequencing gel and quantified with a phosphorimager.

For the initial experiment, cultures of Escherichia coli N99 sup⁰ cI857P⁺ and cI857Psus80 lysogens were grown at 30°C and induced by shifting to 42°C. Samples were removed at intervals into a sodium dodecyl sulfate lysis mixture at 80°C and incubated for 10 min, and DNA was isolated and processed as described above. The resulting data are shown in Fig. 2, and the calculated percent excision is plotted against time after induction in Fig. 3A. More-rapid excision of the wild-type prophage (about 50% by 20 min) than of the nonreplicating P prophage (about 10% by 20 min) was observed. The difference in the actual number of excision events was even greater, since the wild-type prophage copy number increases after induction (3).

View larger version (86K): [in this window] [in a new window]   FIG. 2.   Excision of lambda prophage. Iterative primer extension was performed as described in the text at intervals after induction of P+ and P lysogens at 42°C. Fragments associated with attL (219 bp) and attB (190 bp) are indicated. A sequencing lane is included for size markers.

View larger version (12K): [in this window] [in a new window]   FIG. 3.   Kinetics of prophage excision after induction. The percent excision is calculated as the ratio of the attB-associated fragment to the total of the attB- and attL-associated fragments. (A) Excision of P () and P+ () prophage at 42°C. (B) Excision of P prophage at 42°C () and after shifting to 36°C () after 8 min at 42°C. (C) Excision of P prophage in the presence of plasmids expressing Int or Xis, designated pInt or pXis, respectively, when IPTG is present. , both plasmids without IPTG; , both plasmids with IPTG; , pInt without IPTG; , pInt with IPTG; , pXis without IPTG; , pXis with IPTG.

While the low rate of excision of the P prophage is consistent with the model, it could have resulted from a limitation of one of the proteins required for excision due to (i) synthesis of Int and Xis from a single copy of the prophage rather than from an amplified number of copies of the replicating prophage or (ii) thermolability of a protein at the inducing temperature of 42°C. Integration, but not excision, has been reported to be temperature sensitive (2).

Thermoinduction of the P lysogen was repeated, and part of the culture was transferred to 36°C after 8 min at 42°C. As shown in Fig. 3B, excision at 36°C ensued rapidly and proceeded essentially to completion, indicating that some component of the excision machinery is thermolabile. To determine if thermolability of Int or Xis is responsible for the observed inhibition of excision, compatible plasmids carrying the int gene or the xis gene under IPTG (isopropyl--D-thiogalactopyranoside)-inducible promoters were introduced, separately and in combination, into the P lysogen. Cultures of the plasmid-containing strains were shifted to 42°C to express Int and Xis from the prophage, and IPTG was added at the time of the shift to half of each culture. The results reported in Fig. 3C show that expression of Int from the plasmid allowed rapid and complete excision of the prophage at 42°C; i.e., elevated levels of Int, along with Xis supplied either only from the prophage or also from a plasmid, are sufficient for efficient excision at 42°C.

While I have not measured the actual amounts or the activity of the Int protein under the different conditions described above, I infer from the excision data that the Int protein shows reduced activity at the elevated temperature of 42°C. If the Int protein displays reduced activity and is limiting in the excision reaction at 42°C, then increasing the amount of the protein should increase the amount of excision observed. Therefore, a reasonable interpretation of the above data is as follows. Low levels of excision are observed at 42°C when low levels of Int are synthesized from a single copy of a prophage such as the nonreplicating P prophage. Intermediate levels of excision are observed at 42°C when intermediate levels of Int are supplied from the amplified copies of a replicating prophage. High levels of excision are observed at 42°C when high levels of Int are synthesized from a high-copy-number plasmid.

The results presented here, while not supporting the proposed model, do not exclude the possibility that the replication forks are held together as proposed, as has been suggested for chromosomal forks (1, 4). In this context, the amplification of prophage copies raises a very interesting question. Excision from the onionskin of amplified copies requires that a particular attL recombines with its partner attR and not with an attR from a different copy of the prophage. Such a transrecombination would result in a tandem prophage dimer and a deletion, not in an excision. How the appropriate synapse is made and whether or not inappropriate synapses are made remain to be determined. Even though these experiments failed to adduce support for the synapsis model, the model nicely suggests how appropriate att sites could be synapsed by the spooling of the distal att sites on the same prophage DNA through the fixed replication machinery.