 |
INTRODUCTION |
Most cells and organisms respond to
heat or other stress by inducing a set of heat shock proteins (HSP) to
cope with accumulation of unfolded and misfolded proteins. Many HSP are
molecular chaperones or proteases, and DnaK (HSP70) and GroEL (HSP60)
are major ubiquitous chaperones that play crucial roles in promoting
protein folding not only under acute stress but also during normal
growth and development (5, 12, 13, 15, 24, 48). In
addition, these chaperones and their cochaperones have been implicated
in the regulation of heat shock response by negatively modulating the
key heat shock regulators, such as
32 (RpoH)
(11, 37, 42) and HrcA repressor (23) in
bacteria and heat shock factors (36) in eukaryotes.
The RpoH protein, homolog of Escherichia coli
32 (14, 20, 49), is widely
distributed among the
,
, and
subgroups of proteobacteria
(references 29 and 48 and references cited therein). Analyses of several RpoH proteins from members of the
and
subgroups of proteobacteria, such as Agrobacterium
tumefaciens and E. coli, revealed that they play a
major role in regulation of the heat shock response by enhancing
transcription of the heat shock genes (8, 14, 28, 31, 47).
In E. coli, where the most-extensive work has been
done, the induction of HSP is regulated primarily by a transient
increase in the
32 level that results from
both increased translation of rpoH mRNA and transient
stabilization of normally unstable
32
(38, 43). Partial melting of secondary structure for the 5' portion of rpoH mRNA activates translation at high
temperatures (27, 50), the mRNA itself serving as a
built-in thermosensor (25). On the other hand, turnover of
32 catalyzed by ATP-dependent proteases, such
as FtsH (HflB) and HslVU (ClpQY) (17, 19, 44), is
modulated by the DnaK-DnaJ-GrpE chaperone team (3, 11, 37, 40,
45), presumably reflecting the cellular state of protein
folding. In addition, the control of
32
activity plays a major role in response to temperature downshift (39, 41) or in the heat shock response with
ftsH mutants in which
32 is highly
stabilized (40). The DnaK chaperone team also participates in the negative regulation of
32 activity
(11, 21, 40, 45). Furthermore, binding of
32 to core RNA polymerase, the initial step
for
32 function, markedly stabilizes
32 (4, 19), precluding precise
assessment of the contribution of control of
32 activity in the wild-type bacteria. RpoH
from other members of the
subgroup of proteobacteria, such as
Serratia marcescens and Pseudomonas aeruginosa,
also appears to exhibit both translational induction and transient
stabilization upon heat shock, leading to the increased RpoH level, as
in E. coli (30).
In the case of the
subgroup of proteobacteria, the mechanisms
underlying heat-induced synthesis of RpoH seem to be quite different.
First, the 5' portion of rpoH mRNA is not predicted to form
the secondary structure, unlike the situation in the
subgroup of
proteobacteria (29; also unpublished results), suggesting the lack of translational control. Second, RpoH synthesis in
Caulobacter crescentus is markedly heat induced by
activating its transcription (32, 46) from the
RpoH-dependent promoter (47), leading to the increase in
RpoH level. Besides, the conserved inverted repeat sequence
(CIRCE), a putative binding site for the HrcA repressor in
gram-positive bacteria (16, 23), is found in the
groE promoter region of several members of the
subgroup (2, 32, 35). Recent studies using the
rpoH
and
hrcA mutants of A. tumefaciens established
that RpoH plays an essential global role in the induction of HSP,
whereas HrcA plays a restricted role in repressing groE
expression under nonstress conditions (low temperatures)
(28).
In this study, we investigated the mechanism of RpoH regulation in
A. tumefaciens by examining the synthesis, stability, and activity of RpoH during the heat shock response. Although the RpoH
level is transiently enhanced upon temperature upshift, this enhancement is preceded by, not followed by, induction of HSP such as
DnaK. Several lines of evidence suggest that induction of HSP is
caused primarily by the DnaK-DnaJ-mediated activation of preexisting
RpoH and only secondarily by increased synthesis of RpoH resulting from
increased rpoH transcription. On the other hand, the
decrease in the amount of RpoH observed during the adaptation phase
results from both decreased synthesis and destabilization of otherwise
stable RpoH. Thus, the
and
subgroups of proteobacteria appear
to have adopted quite distinct strategies in enhancing the RpoH level
and HSP synthesis upon exposure to heat stress.
 |
MATERIALS AND METHODS |
Bacterial strains.
A. tumefaciens strains
used in this work are listed in Table 1.
For many experiments, derivatives of A. tumefaciens strain KN613 (
hrcA) lacking the HrcA repressor were used to
avoid possible complications arising from its effects on expression of
GroE and possibly other proteins. The rpoH promoter region
(see Fig. 3A, line *2) within the 3.5-kb ApaI fragment was
replaced by Plac' (see Fig. 3B), and the
Plac'-rpoH fusion was inserted into the SmaI site of pTWV228 (Takara Shuzo, Tokyo, Japan) unable to
replicate in A. tumefaciens. The resulting plasmid was
inserted in strain KN201 (
rpoH
hrcA)
by selecting for carbenicillin resistance (100 µg/ml); a clone that
carried Plac'-rpoH at the chromosomal rpoH region as the result of plasmid integration (confirmed
by PCR) was designated KN208. An isogenic strain, KN207, carrying the
authentic rpoH promoter was constructed by transforming
KN201 with pTW228-rpoH. The rpoH, dnaK, or
groE promoter on the chromosome was replaced essentially as
described previously (28): the ApaI fragment
containing Plac'-rpoH was inserted into
pK18mobsacB, which was then used to replace the
rpoH gene of KN613, yielding strain KN209. Strains KN214 and
KN614 were obtained from KN209 and KN613, respectively, by replacing
the dnaK promoter (nucleotides
106 to
1 relative to the
initiation codon) by the BstI107-EcoRI fragment
harboring the trc promoter, lacI repressor, and
spectinomycin resistance gene of pTRC99A-SP. Strain KN615 was
constructed by inserting the BstI1071-EcoRI
cassette mentioned above into the EcoNI site at nucleotide
31 of the groE initiation codon; the terminator sequence
within the cassette disrupts transcript from the authentic
groE promoter. E. coli K-12 strain JM109 was used for DNA manipulation.
Growth media.
A. tumefaciens cells were grown at
25°C in YEB complete medium with constant aeration or on YEB agar as
described previously (28). Davis minimal medium
(9) supplemented with 0.2% glucose, 2 µg of thiamine
per ml, 50 µg of 18 L-amino acids (excluding methionine and cysteine) per ml, and 1/100 volume of YEB was used as
minimal medium. Luria-Bertani (LB) broth was used for growing E. coli.
Antisera.
Antiserum against RpoH was prepared from a rabbit
as described previously (28). Anti-DnaK and anti-ClpB sera
were kindly donated by M. Kohiyama (University of Paris) and C. Squires (Tufts University), respectively. Anti-
-galactosidase
antiserum was obtained from Organon Teknika-Cappel.
Construction of plasmids.
To construct
pKK232-PrpoH'-lacZ, most of the cat
gene of pKK232-8 (Amersham-Pharmacia) was removed and a
BglII site was created by PCR using primers
(TCTCCAGTTTTTTTCTCC and
TCTCCAGCAGCCGCACGC). The BglII site was used to
insert a BamHI fragment containing lacZ derived
from pMC1871 (Amersham-Pharmacia) in frame with the first seven codons
of the cat gene. The resulting plasmid was digested with
SmaI, and the rpoH promoter fragment (see Fig.
3A, line *1) was inserted before lacZ to yield
pKK232-PrpoH'-lacZ. To construct
pUCD-PrpoH'-lacZ, a broad-host-range plasmid,
pUCD2 (7), was digested with SacII and
BamHI, blunted by T4 DNA polymerase, and joined with the
PrpoH'-lacZ fragment excised from
pKK232-PrpoH'-lacZ by BseAI and
ScaI. To construct pTRC99A-SP, a SmaI fragment
containing the spectinomycin and streptomycin resistance gene
cassette from pUT/Sm (10) was inserted into the
BsaAI site of pTRC99A (Amersham-Pharmacia). To construct
pBBR-dnaKJn and pBBR-dnaKJr, a 3-kb
EcoRI fragment containing the entire dnaKJ operon
was cloned by using a portion of dnaK (34) as a
probe and was inserted into the EcoRI site of pBBR122
(MoBiTec, Gottingen, Germany). The dnaKJ operon is transcribed in the same direction as the cat gene in
pBBR-dnaKJn, whereas it is transcribed in the opposite (or
reverse) direction in pBBR-dnaKJr (as indicated by the final
letter of the plasmid designation). To construct
pBBR-groESLn and pBBR-groESLr, a 2.5-kb EcoRI fragment containing the groESL operon
(33) was inserted into the EcoRI site of
pBBR122. The groESL operon is transcribed in the same
direction as cat in pBBR-groESLn but in the
opposite direction in pBBR-groESLr.
Determination of protein synthesis and degradation rates.
Mid-logarithmic phase cells were labeled with
L-[35S]methionine (600 µCi; 100 Ci/ml) with or without a subsequent chase with unlabeled Met (200 µg/ml) as indicated for each experiment. Portions of labeled cells
were treated with 5% trichloroacetic acid, and the resulting
precipitates were washed with acetone and suspended in buffer
containing sodium dodecyl sulfate (SDS). Samples with equal
radioactivity were subjected to SDS-polyacrylamide gel electrophoresis (PAGE) either directly or after treatment with antibody against RpoH or
-galactosidase to determine the synthesis rate of the protein. The
intensities of radioactive protein bands were quantified with a phosphorimager.
-Galactosidase activity.
Cells were grown in synthetic
medium and assayed for
-galactosidase activity by the standard
procedure (22).
Immunoblotting.
Immunoblotting of proteins was performed
essentially as described previously (28, 30) by using a
Hybond-ECL nitrocellulose membrane filter (Amersham-Pharmacia), and
detected with specific rabbit antisera by chemiluminescence techniques.
Isolation and analysis of RNA.
Isolation of RNA and primer
extension analysis were performed as described previously
(28). For S1 mapping, primers RpoH-N (GAAGGTGATTCGCCTGCACAATC) and RpoH-R
(CCTTATCTATGGTCTGGAACGGC) were used for PCR amplification of
the sequence from nucleotides
305 to
10 of the rpoH
coding segment; then, 10 cycles of single-direction PCR were
done with 5'-fluorescein isothiocyanate (5'-FITC)-labeled RpoH-R. The
resulting cDNA with the 5'-FITC label was purified by 6%
sequencing gel and used for S1 mapping as described previously (1). S1-protected fragments were resolved by 6%
sequencing gel and visualized by FMBIO-II fluorescent-image analyzer
(Takara Shuzo).
 |
RESULTS |
Transient increase in the rate of RpoH synthesis upon heat
shock.
The level of RpoH in the cell increases transiently upon
shifting the wild-type strain of A. tumefaciens from 25 to
37°C (28). To analyze the mechanisms underlying this
increase, both the amount and synthesis rate of RpoH were examined upon
temperature upshift and the time course of RpoH synthesis was compared
with that of HSP synthesis. In agreement with the previous results, the
RpoH level as determined by immunoblotting increased, peaked at around 15 min, and decreased to a level near the preshift level by 45 min in
complete medium (Fig. 1A). Essentially
the same increase with a similar time course was observed when
synthetic medium supplemented with amino acids was used, except for a
somewhat earlier return (35 min) to the preshift level. Under the same conditions (synthetic medium), the synthesis rate of RpoH, as determined by pulse-labeling with
[35S]methionine followed by
immunoprecipitation, increased more rapidly, peaking at 10 min (sixfold
increase), followed by a rapid decrease to a rate near the preshift
rate by about 20 min (Fig. 1B).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 1.
Transient increases in the level and synthesis rate of
RpoH upon heat shock. (A) Cells of wild-type A.
tumefaciens (GV3101) were grown in complete medium ( ) or
synthetic medium ( ) to the logarithmic growth phase at 25°C and
shifted to 37°C at time zero. Samples were taken at intervals, mixed
with an equal volume of 2× SDS sample buffer, boiled for 2 min, and
analyzed by SDS-PAGE (12.5% polyacrylamide) and immunoblotting
with anti-RpoH antiserum essentially as described previously
(28). The RpoH band was quantified by
densitometry and normalized to the value at 25°C. (B) Log-phase cells
grown in synthetic medium at 25°C were shifted to 37°C. Samples
taken at the times indicated were pulse-labeled with
[35S]methionine for 2 min and treated with
trichloroacetic acid, and RpoH was immunoprecipitated, resolved by
SDS-PAGE (12.5% polyacrylamide), and quantified as described
previously (28). The rate of RpoH synthesis thus obtained
was normalized to the value at zero time. (C) Synthesis rate of DnaK
was determined by growing and pulse-labeling cells with
[35S]methionine as described above for panel B. The cells
were treated with trichloroacetic acid and then analyzed by SDS-PAGE
(7.5% polyacrylamide) . Radioactivity associated with the DnaK band
was determined with a phosphorimager and normalized to the value at
zero time.
|
|
We then determined the synthesis rate of HSP, such as DnaK, known to be
induced transcriptionally from the heat shock promoter (28,
34). As seen in Fig. 1C, induction of DnaK synthesis occurred
almost simultaneously with that of RpoH synthesis and preceded the
increase in the RpoH level. This was unexpected, because the induction
of HSP synthesis should follow the increase in RpoH level if the latter
increase were responsible for HSP induction. Thus, in spite of the
marked enhancement of RpoH level, the increased level per se does not
account for the initial transcriptional activation of heat shock genes,
and the synthesis of RpoH appeared to be coordinately regulated with
that of DnaK and presumably of other HSP as well.
Autogenous control in transcriptional induction of RpoH.
Analysis of rpoH transcription by S1 protection assay
revealed that a single transcript starting from T, 108 nucleotides
upstream of the putative rpoH initiation codon, is markedly
enhanced upon heat shock (Fig. 2). This
result was confirmed by primer extension analysis (data not shown). The
35 and
10 regions of this promoter contained sequences similar to
those of the groE and dnaK heat shock promoters
(28). The region of 49 bp (Fig.
3A, line *1) including the transcription
start site was fused to the promoterless E. coli lacZ, and
the plasmid carrying the fusion (PrpoH'-lacZ) was
introduced into the wild-type strain
(rpoH+) and the
rpoH
strain. When lacZ expression was examined by
measuring
-galactosidase, the
rpoH mutant exhibited
much less activity than the wild type did (Table
2). That this is due to RpoH and not to a
product(s) of adjacent genes whose expression is affected by the
rpoH deletion was shown by the finding that introduction of
another plasmid carrying only rpoH+ was
sufficient to restore the high
-galactosidase activity (data not
shown). These results indicated that rpoH transcription from the above promoter depends largely on RpoH itself.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 2.
Identification of heat-induced rpoH
transcripts by S1 mapping. The transcription start site was determined
with 10 mg of RNA extracted from non-heat-shocked ( ) and heat-shocked
(+) cells using rpoH DNA probe fluorescently labeled at
the 5' end. Wild-type ([WT]) cells of A. tumefaciens
GV3101 were grown in complete medium at 25°C and heat shocked
(shifted to 37°C for 10 min). DNA sequence ladders labeled at
the same 5' end and produced by the Sanger method are shown to the
right. The positions of transcription start site and undigested probe
are indicated by the closed and open arrows, respectively. The
nucleotide sequence of the putative promoter region is shown; the 35
and 10 conserved sequences are underlined, and the start site is
circled.
|
|

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 3.
Heat shock induction of RpoH is abolished by replacing
the promoter. (A) Sequence of the rpoH promoter and part
of the coding region (underlined) is shown. Lines *1 and *2 represent
portions of the sequence that were used or deleted in constructing the
transcriptional fusion PrpoH'-lacZ or
Plac'-rpoH, respectively (see Materials
and Methods). (B) Sequence of a synthetic promoter
(Plac') used to construct
Plac'-rpoH, in which rpoH
transcription is driven by Plac'. The Rho-independent
terminator from E. coli trpA (underlined)
(6) was fused to part of the E. coli
lac promoter (nucleotides 35 to +1) to prevent readthrough
from upstream. (C) A pair of strains with the chromosomal
rpoH+ gene under the authentic
rpoH promoter (KN207) or the Plac'
promoter (KN208) were grown in complete medium to log phase at 25°C
and shifted to 37°C. Samples were taken before or after heat shock as
indicated, treated, and analyzed by SDS-PAGE (10% polyacrylamide), and
RpoH was detected by immunoblotting.
|
|
As expected from these results, heat induction of RpoH synthesis was
completely blocked when rifampin, which inhibits transcription, was
added 1 min before temperature upshift (Table
3). This is in sharp contrast to the
rifampin-resistant increase in the
32 level
observed in E. coli (27) and other members of
the
subgroup of proteobacteria (30). Finally, when the
intact rpoH gene or rpoH driven by a non-heat
shock promoter derived from the E. coli lac promoter
(Plac' [Fig. 3B]) was separately integrated into the
chromosome of the
rpoH strain, the resulting strain
carrying intact rpoH (PrpoH [KN207]) exhibited
normal growth and heat induction of RpoH, whereas the strain carrying
Plac'-rpoH (Plac'[KN208]) grew at a
slightly reduced rate at 25 or 37°C and produced slightly lower
amounts of RpoH which remained unchanged before and after heat shock
(Fig. 3C). We concluded from these results that the heat induction of
RpoH mostly depends on increased rpoH transcription from the
RpoH-dependent promoter, although partial contribution of translational
induction was not rigorously excluded.
Destabilization of normally stable RpoH during the adaptation
phase.
Stability of RpoH was then examined during the heat shock
response by pulse-labeling cells with
[35S]methionine at 25°C, followed by a chase
with excess unlabeled methionine at 25°C or after shift to 37°C,
and determining the remaining RpoH by immunoprecipitation. Unlike
E. coli
32, the A. tumefaciens RpoH was found to be very stable, with a half-life of about 60 min at 25°C (Fig.
4). When the labeled cells were shifted
to 37°C, gradual destabilization was observed after a lag time of
about 10 min. After 20 to 30 min, the half-life of RpoH decreased to
about 20 min and returned to near the initial stability after about 60 min. The transient destabilization (about threefold) seemed to account
for, at least in part, the decrease of RpoH level during the adaptation
phase. Thus, both transient induction of RpoH synthesis at the
transcription level and subsequent protein destabilization appeared to
explain the transient increase in the RpoH level observed upon heat
shock at least under the set of conditions employed.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 4.
Transient destabilization of RpoH during the heat shock
response. A log-phase culture of wild-type cells (GV3101) grown in
synthetic medium at 25°C was divided into two portions, pulse-labeled
with [35S]methionine for 2 min, and chased with excess
unlabeled methionine. Samples were taken after 3 min and then at 10-min
intervals. At the time of second sampling (time zero), one culture was
shifted to 37°C ( ), whereas the other was kept at 25°C ( ).
Immunoprecipitates obtained with anti-RpoH antiserum were analyzed by
SDS-PAGE. Averages from three experiments are plotted with standard
errors (indicated by the error bars).
|
|
Rapid initial induction of HSP depends primarily on activation of
RpoH.
The above finding that the induction of HSP (DnaK) precedes
the increase in the RpoH level (Fig. 1) suggested that the
transcription of heat shock promoters does not necessarily require the
increase in RpoH level. To further substantiate this observation, we
analyzed the heat shock response in strain KN208 carrying
Plac'-rpoH in which the RpoH level does not
increase upon heat shock. Surprisingly, almost normal induction of HSP
such as ClpB, DnaK, and GroEL (Fig. 5A,
compare KN208 with KN207) as well as normal accumulation of dnaK mRNA (Fig. 5B, compare KN208 with GV3101) was observed,
indicating that the increase in RpoH level was not essential for the
heat shock response and that the level attained by the lac
promoter was sufficient for HSP induction. Moreover, addition of
chloramphenicol to the wild-type strain 1 min prior to heat shock
(>95% inhibition of protein synthesis) did not affect accumulation of
dnaK mRNA significantly as determined by primer extension
analysis (Fig. 5B). Evidently, the transcriptional induction of heat
shock genes did not depend on newly synthesized proteins;
namely, the preexisting RpoH was sufficient for induction. Thus, RpoH
must be somehow activated prior to the enhanced synthesis upon
temperature upshift. Such an activation even without increased RpoH
level appeared to cause virtually normal heat shock response in
A. tumefaciens.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 5.
Neither enhanced RpoH level nor de novo protein
synthesis is required for induction of heat shock genes. (A) Induction
of HSP was analyzed by pulse-labeling cells with
[35S]methionine at 25°C or after heat shocking (HS) the
cells (shifting the cells to 37°C for 10 min) and resolving the
proteins by SDS-PAGE as described in the legend to Fig. 1C. The
positions for ClpB, DnaK, and GroEL are indicated on the basis of the
immunoblotting data with specific antisera (28).
The results with the wild type (KN613), the
rpoH mutant (KN201), and derivatives of KN201
carrying intact rpoH (KN207) or
Plac'-rpoH (KN208) on the chromosome
(indicated by an asterisk) are presented. (B) Induction of
dnaK mRNA was analyzed by growing cells as described
above for panel A, and chloramphenicol (Cm) was added (+) to a
concentration of 100 µg/ml 1 min prior to temperature upshift as
indicated. Samples were taken before ( ) and 10 min (+) after heat
shock (HS), RNA was extracted, and primer extension was performed using
a fluorescence-labeled primer for dnaK transcript as
described previously (28).
|
|
Effects of changes in the cellular levels of DnaK or GroE
chaperones on HSP synthesis.
To examine the role of chaperones in
modulating the RpoH activity, a set of strains that can overexpress or
underexpress the DnaK-DnaJ or GroEL-GroES chaperones was constructed.
The overexpressing strains were constructed by introducing a multicopy
pBBR122 plasmid carrying the dnaK-dnaJ or
groES-groEL operon into strain KN613 (
hrcA).
Cells harboring these plasmids overproduced the respective chaperones
as expected (Fig. 6A). The smaller
overexpression of GroEL detected (3- to 5-fold) compared to that of
DnaK (ca. 10-fold) may be due in part to the higher basal expression of
GroEL found in strains lacking HrcA repressor (28). To
determine whether HSP synthesis was affected in these strains, the
cellular level of ClpB, a good indicator of the heat shock response, as
well as that of RpoH was examined. The level of ClpB but not RpoH was found to be reduced severalfold in strains overexpressing DnaK compared
to the control strain carrying vector alone (Fig. 6A, compare
lanes 2 and 3 with 1). In contrast, overexpression of GroE (to the
extents observed in the present experiments) affected the RpoH or ClpB
level only slightly (lanes 4 and 5).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 6.
Effects of changes in the levels of DnaKJ chaperones or
GroESL chaperones on the levels of other HSP during steady-state
growth. Cells were grown in synthetic medium at 25°C, and proteins
were analyzed by SDS-PAGE followed by immunoblotting using specific
antisera against E. coli ClpB, DnaK, GroEL, or A.
tumefaciens RpoH as indicated to the left. (A) Overproduction
of chaperones by multicopy pBBR122 plasmid carrying the
dnaKJ or groESL operon in strain KN613.
Lanes: 1, pBBR122 (control); 2, pBBR122-dnakJn; 3, pBBR122-dnaKJr; 4, pBBR122-groESLn; 5, pBBR122-groESLr. Both DnaKJ and GroESL were expressed
slightly more efficiently when the respective operon was inserted in
the plasmid in the direction opposite that of the cat
gene ("r" constructs) than when the operon was inserted in the same
direction as that of cat ("n" constructs), perhaps
due to activity of some uncharacterized promoter(s). (B) Reduced
production of DnaK in strains in which the chromosomal
dnaK promoter was replaced by the trc
promoter in the rpoH+
(PrpoH-rpoH) or Plac'-rpoH
background. Lanes: 1, KN613 (rpoH+
strain [control]); 2, KN614 (dnaKJ driven by
the trc promoter in the
rpoH+ strain); 3, KN209
(Plac'-rpoH strain [control]); 4, KN214
(dnaKJ driven by the trc promoter in the
Plac'-rpoH strain). (C) Reduced
production of GroESL in which the chromosomal groE
promoter was replaced by the trc promoter. Lanes: 1, KN613 (rpoH+ strain [control]); 2, KN615 (groESL driven by the trc promoter
in the rpoH+ strain).
|
|
Strains that underexpress the chaperones were constructed by replacing
the heat shock promoter of the chromosomal dnaK or groE operon by the trc promoter. The resulting
strains produced much lower levels of respective chaperones in the
absence of isopropyl-
-D-thiogalactopyranoside. When the DnaK chaperones were reduced, both ClpB and RpoH were dramatically enhanced (Fig. 6B, compare lanes 1 and 2). Again, the
reduced GroE expression had little effect on the RpoH or ClpB level
(Fig. 6C). All the results taken together strongly suggested that the
DnaK but not GroE chaperones negatively modulate the synthesis of other
HSP including RpoH, although DnaK overexpression failed to reduce the
RpoH level for unknown reasons (see Discussion).
It should be noted, however, that the marked increase in the ClpB level
in the DnaK-depleted strain could be a secondary consequence of an
increase in the RpoH level. To test this possibility, another DnaK-underexpressing mutant was constructed using the
Plac'-rpoH strain (KN209) in which the RpoH level
does not increase upon heat shock. The resulting strain (KN214)
produced very low levels of DnaK while showing no increase in RpoH as
expected (Fig. 6B, compare lanes 3 and 4). Even in this strain, the
amount of ClpB was elevated to the level similar to that found in the
rpoH+ background (Fig. 6B, compare lanes 2 and 4), suggesting that the enhanced synthesis of HSP (such as ClpB)
resulted from reduced levels of DnaK and not from increased levels of
RpoH. The latter pair of strains with Plac'-rpoH
background were used for subsequent experiments to assess the effects
of reduced DnaK level on RpoH activity (see below).
Effects of altered chaperone levels on transcription of heat shock
promoters.
To determine whether the changes in HSP synthesis
caused by altered DnaK levels resulted from altered transcription from
the RpoH-dependent heat shock promoters, the reporter plasmid
pUCD-PrpoH'-lacZ was introduced into the set of
strains to examine LacZ expression. Indeed, rpoH
transcription as determined by
-galactosidase activity was reduced
in the DnaK-overexpressing strain but dramatically enhanced in the
DnaK-underexpressing strain (Table 4). In
contrast, the changes in the GroEL-GroES level did not affect LacZ
expression appreciably. These results suggested that the DnaK
chaperones serve specifically as a negative modulator of the
RpoH-mediated transcription by inhibiting RpoH activity.
We then examined the effects of altered chaperone levels on
transcription from heat shock promoters during the heat shock response
by pulse-labeling the same set of strains with
[35S]methionine followed by immunoprecipitation
with anti-
-galactosidase antiserum (Fig.
7). The rates of LacZ expression before
the temperature shift agreed well with the
-galactosidase activities
in strains overexpressing or underexpressing DnaK chaperones (compare
the values at zero time in Fig. 7 with the values in Table 4). The higher or lower LacZ expression in these strains appeared to be maintained during the time period examined. However, when the extent of
induction was compared under conditions of various DnaK levels, it was
higher with the DnaK-overexpressing strain (11-fold) than with the
control (8.7-fold) and was lower with the DnaK-underexpressing strain
(2.7-fold) (Fig. 7). Moreover, the induction reached its maximum faster
with the DnaK-overexpressing strain than with the control. These
results suggested that the DnaK chaperone intimately modulates the
transcription of heat shock genes throughout the heat shock response.
The data are also consistent with the notion that the pool of free
DnaKJ chaperones rather than the total DnaKJ levels is important for
the negative regulation of RpoH activity. In contrast, GroE
underexpression had no appreciable effects on heat shock induction,
whereas GroE overexpression resulted in slightly reduced induction,
suggesting a possible subsidiary role of GroE chaperones in regulating
the RpoH activity.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 7.
Time course of change in RpoH activity (LacZ expression
from the pUCD-PrpoH'-lacZ reporter
plasmid) during the heat shock response. The same set of strains used
in Table 4 were grown in synthetic medium at 25°C and shifted to
37°C at time zero. Samples taken at the times indicated were
pulse-labeled with [35S]methionine for 2 min, chased with
excess unlabeled methionine for 1 min, and treated with 10%
trichloroacetic acid in ice. Radiolabeled E. coli
32- -galactosidase fusion protein (GF807-FS
[26]) was added as an internal reference to each sample
containing the same radioactivity, immunoprecipitated with
anti- -galactosidase antiserum, and resolved by SDS-PAGE (7.5%
polyacrylamide). The radioactivities of -galactosidase bands were
normalized to that of the reference protein and are shown as
percentages of the maximum synthesis rate in the control (wild-type
[WT]) strain. (A) Data for the rpoH+
strain (KN613) carrying pBBR122 (control or WT ),
pBBR122-dnaKJr (Excess DnaKJ ),
pBBR122-groESLr (Excess GroESL ), or KN615
(Ptrc-groE) (Reduced GroESL ) are shown. (B) Data for
the pair of Plac'-rpoH strains, KN209
(control or WT ) and KN214 (Reduced DnaKJ ), are shown.
|
|
 |
DISCUSSION |
The amino acid sequences of A. tumefaciens RpoH (34 kDa) and E. coli
32 have 36%
identity (29). A. tumefaciens RpoH and E. coli
32 recognize similar heat shock
promoters and presumably play identical catalytic roles as
transcriptional activators of heat shock genes such as groE
and dnaK (28). The regulation of RpoH also
appeared to be similar in both species; namely, the cellular level of
RpoH increased transiently upon heat shock. However, the mechanism underlying transient increases in RpoH is quite different. In A. tumefaciens, the increase occurred at the level of transcription rather than translation and was largely mediated by RpoH itself. This
conclusion was based on several lines of evidence. (i) S1 mapping of
RNA detected a major heat-inducible rpoH transcript initiated at the heat shock promoter (Fig. 2). (ii) lacZ
expression driven by the rpoH promoter was drastically
reduced in the
rpoH mutant (Table 2). (iii)
Heat-inducible synthesis of RpoH in the wild type was completely
inhibited by rifampin, unlike the situation with RpoH in the
subgroup of proteobacteria (Table 3). (iv) The intact rpoH
promoter but not the Plac' promoter gave rise to the
heat-inducible RpoH synthesis (Fig. 3). Similar autogenous control of
rpoH transcription involving an RpoH-dependent promoter has
been reported in C. crescentus based on both in
vivo and in vitro experiments (47). Thus, autogenous
transcriptional control of rpoH appears to be conserved at
least in some members of the
subgroup of proteobacteria.
The control of RpoH level in A. tumefaciens differs from
that in E. coli in another important respect, namely, the
control of proteolytic degradation. RpoH was quite stable in A. tumefaciens during steady-state growth at 25°C, and no further
stabilization occurred upon shift to 37°C, indicating that
stabilization of RpoH does not contribute to the increased RpoH level
significantly. Rather, gradual destabilization was observed after a
short lag and continued until the RpoH level returned to the preshift
level (Fig. 4). This mode of regulation should be contrasted with that found with E. coli
32, which is
normally very unstable and transiently stabilized upon heat shock
(38, 43). Besides the clear difference in stability under
steady-state growth, the change in RpoH stability occurs at different
phases of the heat shock response. Although details of the mechanisms
for controlling RpoH stability remain unknown, available evidence
suggests the involvement of homeostatic mechanism(s) for maintaining
the cellular RpoH level within a certain range. For example,
replacement of the rpoH promoter by Plac
prevented not only the increase in RpoH level upon heat shock but also
the transient decrease during the adaptation phase (Fig. 3C and data not shown). Also, overexpression of DnaKJ chaperones reduced
transcription from the rpoH promoter (Table 4) but did not
reduce the RpoH level significantly (Fig. 6A).
In addition to the distinct regulatory strategies for controlling RpoH
levels, the mechanism of induction of heat shock promoters appears to
differ strikingly between A. tumefaciens and E. coli. In E. coli, the increased amount of RpoH
primarily determines the rate of HSP synthesis through increased
transcription from heat shock promoters, although the recent results
with ftsH mutants suggested potential involvement of
activity control as an auxiliary or alternative mechanism
(40). In A. tumefaciens, a similar increase in
RpoH level occurred, but not early enough to explain the induction of
DnaK as well as RpoH itself (Fig. 1), suggesting that activation rather
than increased level of RpoH is mainly responsible for initial
induction of HSP. Consistent with this expectation, the strain unable
to enhance the RpoH level upon heat shock exhibited virtually normal
HSP induction (Fig. 5A). Moreover, near normal heat induction of
dnaK mRNA was observed even in the absence of de novo
protein synthesis (Fig. 5B). The question then arises, what is the role
of transcriptional induction of RpoH upon heat shock? Increasing the
RpoH level by introducing extra rpoH copies did increase
transcription from heat shock promoters, resulting in higher HSP levels
and LacZ expression from the PrpoH'-lacZ fusion
construct (data not shown). It thus appears that increasing the RpoH
level provides a subsidiary or fail-safe mechanism in sustaining the
increased synthesis of HSP, although it hardly contributes to the
initial phase of HSP induction. This mode of regulation in A. tumefaciens is in marked contrast with the regulation of
32 in E. coli, in which control of
activity at the induction phase is detectable only under special
circumstances, as in the ftsH mutants where
32 is much stabilized. The differences in
regulatory strategy observed in A. tumefaciens and E. coli are summarized in Table 5.
As for the mechanism of controlling RpoH activity upon heat shock, the
activation may occur at any of the steps of RpoH function including
binding to core RNA polymerase and transcription by RNA polymerase
holoenzyme containing RpoH. The DnaK chaperone machinery appears to
play an important regulatory role in this process, since the cellular
level of DnaK but not GroE showed a strong negative correlation with
the amount of transcription from the heat shock promoters. Direct or
indirect inhibition of RpoH activity by DnaK chaperones under nonstress
conditions and release of inhibition upon heat stress would be a highly
plausible mechanism. If the regulation were to involve direct
interaction between RpoH and DnaK-DnaJ chaperones, the mechanism may be
similar to the control of activity of
32
postulated for E. coli (3, 11, 40, 45).
However, possible involvement of other negative factors cannot be
excluded. Activity of such factors might in turn be affected positively
by DnaKJ, in much the same way that the HrcA repressor of
Bacillus subtilis is affected by GroESL (23).
Such negative factors might also bind and stabilize RpoH, possibly
explaining the failure of the DnaK-overexpressing strain to reduce the
RpoH level (Fig. 6A).
In any event, the DnaK-DnaJ chaperones with their changing substrate
binding activity are the most likely candidates that monitor the
cellular state of protein folding and play an important regulatory role
in the activity control of RpoH. In view of the difficulty in analyzing
the control of activity and stability of
32 in
E. coli because of the simultaneous involvement of DnaKJ
chaperones in both processes, the present system in A. tumefaciens may provide a unique opportunity to learn more about
the mechanisms of controlling RpoH activity during the early phase of
the heat shock response.
We are grateful to M. Kohiyama and C. Squires for providing
antisera and to C. Kado and V. de Lorenzo for providing plasmids. We
also thank M. T. Morita and M. Kanemori for helpful discussions and Masako Nakayama and Seiji Takahara for technical assistance.
| 1.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1987.
Current protocols in molecular biology.
Wiley, New York, N.Y.
|
| 2.
|
Babst, M.,
H. Hennecke, and H. M. Fischer.
1996.
Two different mechanisms are involved in the heat-shock regulation of chaperonin gene expression in Bradyrhizobium japonicum.
Mol. Microbiol.
19:827-839[CrossRef][Medline].
|
| 3.
|
Blaszczak, A.,
C. Georgopoulos, and K. Liberek.
1999.
On the mechanism of FtsH-dependent degradation of the 32 transcriptional regulator of Escherichia coli and the role of the DnaK chaperone machine.
Mol. Microbiol.
31:157-166[CrossRef][Medline].
|
| 4.
|
Blaszczak, A.,
M. Zylicz,
C. Georgopoulos, and K. Liberek.
1995.
Both ambient temperature and the DnaK chaperone machine modulate the heat shock response in Escherichia coli by regulating the switch between 70 and 32 factors assembled with RNA polymerase.
EMBO J.
14:5085-5093[Medline].
|
| 5.
|
Bukau, B., and A. L. Horwich.
1998.
The HSP70 and HSP60 chaperone machines.
Cell
92:351-366[CrossRef][Medline].
|
| 6.
|
Christie, G. E.,
P. J. Farnham, and T. Platt.
1981.
Synthetic sites for transcription termination and a functional comparison with tryptophan operon termination sites in vitro.
Proc. Natl. Acad. Sci. USA
78:4180-4184[Abstract/Free Full Text].
|
| 7.
|
Close, T. J.,
D. Zaitlin, and C. I. Kado.
1984.
Design and development of amplifiable broad-host-range cloning vectors: analysis of the vir region of Agrobacterium tumefaciens plasmid pTiC58.
Plasmid
12:111-118[CrossRef][Medline].
|
| 8.
|
Cowing, D. W.,
J. C. Bardwell,
E. A. Craig,
C. Woolford,
R. W. Hendrix, and C. A. Gross.
1985.
Consensus sequence for Escherichia coli heat shock gene promoters.
Proc. Natl. Acad. Sci. USA
82:2679-2683[Abstract/Free Full Text].
|
| 9.
|
Davis, B. D.
1949.
Isolation of biochemically deficient mutants of bacteria by means of penicillin.
Proc. Natl. Acad. Sci. USA
35:1-10[Free Full Text].
|
| 10.
|
de Lorenzo, V.,
M. Herrero,
U. Jakubzik, and K. N. Timmis.
1990.
Mini-Tn5 transposon derivatives for insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in gram-negative eubacteria.
J. Bacteriol.
172:6568-6572[Abstract/Free Full Text].
|
| 11.
|
Gamer, J.,
G. Multhaup,
T. Tomoyasu,
J. S. McCarty,
S. Rudiger,
H. J. Schonfeld,
C. Schirra,
H. Bujard, and B. Bukau.
1996.
A cycle of binding and release of the DnaK, DnaJ and GrpE chaperones regulates activity of the Escherichia coli heat shock transcription factor 32.
EMBO J.
15:607-617[Medline].
|
| 12.
|
Georgopoulos, C.,
K. Liberek,
M. Zylicz, and D. Ang.
1994.
Properties of the heat shock proteins of Escherichia coli and the autoregulation of the heat shock response, p. 209-249.
In
R. I. Morimoto, A. Tissieres, and C. Georgopoulos (ed.), The biology of heat shock and molecular chaperones. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 13.
|
Gross, C. A.
1996.
Function and regulation of the heat shock proteins, p. 1382-1399.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. ASM Press, Washington, D.C.
|
| 14.
|
Grossman, A. D.,
J. W. Erickson, and C. A. Gross.
1984.
The htpR gene product of E. coli is a sigma factor for heat-shock promoters.
Cell
38:383-390[CrossRef][Medline].
|
| 15.
|
Hartl, F. U.
1996.
Molecular chaperones in cellular protein folding.
Nature
381:571-579[CrossRef][Medline].
|
| 16.
|
Hecker, M.,
W. Schumann, and U. Volker.
1996.
Heat-shock and general stress response in Bacillus subtilis.
Mol. Microbiol.
19:417-428[CrossRef][Medline].
|
| 17.
|
Herman, C.,
D. Thevenet,
R. D'Ari, and P. Bouloc.
1995.
Degradation of 32, the heat shock regulator in Escherichia coli, is governed by HflB.
Proc. Natl. Acad. Sci. USA
92:3516-3520[Abstract/Free Full Text].
|
| 18.
|
Holsters, M.,
B. Silva,
F. Van Vliet,
C. Genetello,
M. De Block,
P. Dhaese,
A. Depicker,
D. Inze,
G. Engler, and R. Villarroel.
1980.
The functional organization of the nopaline A. tumefaciens plasmid pTiC58.
Plasmid
3:212-230[CrossRef][Medline].
|
| 19.
|
Kanemori, M.,
H. Yanagi, and T. Yura.
1999.
Marked instability of the 32 heat shock transcription factor at high temperature. Implications for heat shock regulation.
J. Biol. Chem.
274:22002-22007[Abstract/Free Full Text].
|
| 20.
|
Landick, R.,
V. Vaughn,
E. T. Lau,
R. A. VanBogelen,
J. W. Erickson, and F. C. Neidhardt.
1984.
Nucleotide sequence of the heat shock regulatory gene of E. coli suggests its protein product may be a transcription factor.
Cell
38:175-182[CrossRef][Medline].
|
| 21.
|
Liberek, K., and C. Georgopoulos.
1993.
Autoregulation of the Escherichia coli heat shock response by the DnaK and DnaJ heat shock proteins.
Proc. Natl. Acad. Sci. USA
90:11019-11023[Abstract/Free Full Text].
|
| 22.
|
Miller, J. H.
1992.
A short course in bacterial genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 23.
|
Mogk, A.,
G. Homuth,
C. Scholz,
L. Kim,
F. X. Schmid, and W. Schumann.
1997.
The GroE chaperonin machine is a major modulator of the CIRCE heat shock regulon of Bacillus subtilis.
EMBO J.
16:4579-4590[CrossRef][Medline].
|
| 24.
|
Morimoto, R.,
A. Tissieres, and C. Georgopoulos (ed.).
1994.
The biology of heat shock proteins and molecular chaperones.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 25.
|
Morita, M. T.,
Y. Tanaka,
T. S. Kodama,
Y. Kyogoku,
H. Yanagi, and T. Yura.
1999.
Translational induction of heat shock transcription factor 32: evidence for a built-in RNA thermosensor.
Genes Dev.
13:655-665[Abstract/Free Full Text].
|
| 26.
|
Nagai, H.,
H. Yuzawa,
M. Kanemori, and T. Yura.
1994.
A distinct segment of the sigma 32 polypeptide is involved in DnaK-mediated negative control of the heat shock response in Escherichia coli.
Proc. Natl. Acad. Sci. USA
91:10280-10284[Abstract/Free Full Text].
|
| 27.
|
Nagai, H.,
H. Yuzawa, and T. Yura.
1991.
Interplay of two cis-acting mRNA regions in translational control of 32 synthesis during the heat shock response of Escherichia coli.
Proc. Natl. Acad. Sci. USA
88:10515-10519[Abstract/Free Full Text].
|
| 28.
|
Nakahigashi, K.,
E. Z. Ron,
H. Yanagi, and T. Yura.
1999.
Differential and independent roles of a 32 homolog (RpoH) and an HrcA repressor in the heat shock response of Agrobacterium tumefaciens.
J. Bacteriol.
181:7509-7515[Abstract/Free Full Text].
|
| 29.
|
Nakahigashi, K.,
H. Yanagi, and T. Yura.
1995.
Isolation and sequence analysis of rpoH genes encoding 32 homologs from Gram-negative bacteria: conserved mRNA and protein segments for heat shock regulation.
Nucleic Acids Res.
23:4383-4390.
|
| 30.
|
Nakahigashi, K.,
H. Yanagi, and T. Yura.
1998.
Regulatory conservation and divergence of 32 homologs from gram-negative bacteria: Serratia marcescens, Proteus mirabilis, Pseudomonas aeruginosa, and Agrobacterium tumefaciens.
J. Bacteriol.
180:2402-2408[Abstract/Free Full Text].
|
| 31.
|
Narberhaus, F.,
M. Kowarik,
C. Beck, and H. Hennecke.
1998.
Promoter selectivity of the Bradyrhizobium japonicum RpoH transcription factors in vivo and in vitro.
J. Bacteriol.
180:2395-2401[Abstract/Free Full Text].
|
| 32.
|
Reisenauer, A.,
C. D. Mohr, and L. Shapiro.
1996.
Regulation of a heat shock 32 homolog in Caulobacter crescentus.
J. Bacteriol.
178:1919-1927[Abstract/Free Full Text].
|
| 33.
|
Segal, G., and E. Z. Ron.
1993.
Heat shock transcription of the groESL operon of Agrobacterium tumefaciens may involve a hairpin-loop structure.
J. Bacteriol.
175:3083-3088[Abstract/Free Full Text].
|
| 34.
|
Segal, G., and E. Z. Ron.
1995.
The dnaKJ operon of Agrobacterium tumefaciens: transcriptional analysis and evidence for a new heat shock promoter.
J. Bacteriol.
177:5952-5958[Abstract/Free Full Text].
|
| 35.
|
Segal, G., and E. Z. Ron.
1996.
Heat shock activation of the groESL operon of Agrobacterium tumefaciens and the regulatory roles of the inverted repeat.
J. Bacteriol.
178:3634-3640[Abstract/Free Full Text].
|
| 36.
|
Shi, Y.,
D. D. Mosser, and R. I. Morimoto.
1998.
Molecular chaperones as HSF1-specific transcriptional repressors.
Genes Dev.
12:654-666[Abstract/Free Full Text].
|
| 37.
|
Straus, D.,
W. Walter, and C. A. Gross.
1990.
DnaK, DnaJ, and GrpE heat shock proteins negatively regulate heat shock gene expression by controlling the synthesis and stability of 32.
Genes Dev.
4:2202-2209[Abstract/Free Full Text].
|
| 38.
|
Straus, D. B.,
W. A. Walter, and C. A. Gross.
1987.
The heat shock response of E. coli is regulated by changes in the concentration of 32.
Nature
329:348-351[CrossRef][Medline].
|
| 39.
|
Straus, D. B.,
W. A. Walter, and C. A. Gross.
1989.
The activity of 32 is reduced under conditions of excess heat shock protein production in Escherichia coli.
Genes Dev.
3:2003-2010[Abstract/Free Full Text].
|
| 40.
|
Tatsuta, T.,
T. Tomoyasu,
B. Bukau,
M. Kitagawa,
H. Mori,
K. Karata, and T. Ogura.
1998.
Heat shock regulation in the ftsH null mutant of Escherichia coli: dissection of stability and activity control mechanisms of 32 in vivo.
Mol. Microbiol.
30:583-593[CrossRef][Medline].
|
| 41.
|
Taura, T.,
N. Kusukawa,
T. Yura, and K. Ito.
1989.
Transient shut off of Escherichia coli heat shock protein synthesis upon temperature shift down.
Biochem. Biophys. Res. Commun.
163:438-443[CrossRef][Medline].
|
| 42.
|
Tilly, K.,
N. McKittrick,
M. Zylicz, and C. Georgopoulos.
1983.
The DnaK protein modulates the heat-shock response of Escherichia coli.
Cell
34:641-646[CrossRef][Medline].
|
| 43.
|
Tilly, K.,
J. Spence, and C. Georgopoulos.
1989.
Modulation of stability of the Escherichia coli heat shock regulatory factor 32.
J. Bacteriol.
171:1585-1589[Abstract/Free Full Text].
|
| 44.
|
Tomoyasu, T.,
J. Gamer,
B. Bukau,
M. Kanemori,
H. Mori,
A. J. Rutman,
A. B. Oppenheim,
T. Yura,
K. Yamanaka,
H. Niki,
S. Hiraga, and T. Ogura.
1995.
Escherichia coli FtsH is a membrane-bound, ATP-dependent protease which degrades the heat-shock transcription factor 32.
EMBO J.
14:2551-2560[Medline].
|
| 45.
|
Tomoyasu, T.,
T. Ogura,
T. Tatsuta, and B. Bukau.
1998.
Levels of DnaK and DnaJ provide tight control of heat shock gene expression and protein repair in Escherichia coli.
Mol. Microbiol.
30:567-581[CrossRef][Medline].
|
| 46.
|
Wu, J., and A. Newton.
1996.
Isolation, identification, and transcriptional specificity of the heat shock sigma factor 32 from Caulobacter crescentus.
J. Bacteriol.
178:2094-2101[Abstract/Free Full Text].
|
| 47.
|
Wu, J., and A. Newton.
1997.
The Caulobacter heat shock sigma factor gene rpoH is positively autoregulated from a 32-dependent promoter.
J. Bacteriol.
179:514-521[Abstract/Free Full Text].
|
| 48.
|
Yura, T.,
M. Kanemori, and M. T. Morita.
2000.
The heat shock response: regulation and function, p. 3-18.
In
G. Storz, and R. Hengge-Aronis (ed.), Bacterial stress responses. ASM Press, Washington, D.C.
|
| 49.
|
Yura, T.,
T. Tobe,
K. Ito, and T. Osawa.
1984.
Heat shock regulatory gene (htpR) of Escherichia coli is required for growth at high temperature but is dispensable at low temperature.
Proc. Natl. Acad. Sci. USA
81:6803-6807[Abstract/Free Full Text].
|
| 50.
|
Yuzawa, H.,
H. Nagai,
H. Mori, and T. Yura.
1993.
Heat induction of 32 synthesis mediated by mRNA secondary structure: a primary step of the heat shock response in Escherichia coli.
Nucleic Acids Res.
21:5449-5455[Abstract/Free Full Text].
|