Previous Article | Next Article ![]()
Journal of Bacteriology, September 2001, p. 5358-5363, Vol. 183, No. 18
Departamento de Biología Funcional e
Instituto Universitario de Oncología del Principado de Asturias
(I.U.O.P.A), Universidad de Oviedo, 33006 Oviedo, Spain
Received 12 April 2001/Accepted 14 June 2001
Oleandomycin, a macrolide antibiotic produced by
Streptomyces antibioticus, contains two sugars attached
to the aglycon: L-oleandrose and D-desosamine.
oleY codes for a methyltransferase involved in the
biosynthesis of L-oleandrose. This gene was overexpressed in Escherichia coli to form inclusion bodies and in
Streptomyces lividans, producing a soluble protein.
S. lividans overexpressing oleY was used
as a biotransformation host, and it converted the precursor
L-olivosyl-erythronolide B into its
3-O-methylated derivative, L-oleandrosyl-erythronolide B. Two other monoglycosylated
derivatives were also substrates for the OleY methyltransferase:
L-rhamnosyl- and L-mycarosyl-erythronolide B. OleY methyltransferase was purified yielding a 43-kDa single band on
sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The native
enzyme showed a molecular mass of 87 kDa by gel filtration
chromatography, indicating that the enzyme acts as a dimer. It showed a
narrow pH range for optimal activity, and its activity was clearly
stimulated by the presence of several divalent cations, being maximal
with Co2+. The S. antibioticus OleG2
glycosyltransferase is proposed to transfer L-olivose to
the oleandolide aglycon, which is then converted into
L-oleandrose by the OleY methyltransferase. This represents an alternative route for L-oleandrose biosynthesis from
that in the avermectin producer Streptomyces
avermitilis, in which L-oleandrose is transferred
to the aglycon by a glycosyltransferase.
Oleandomycin (Fig.
1A) is a clinically important 14-membered
macrolide antibiotic produced by Streptomyces antibioticus.
Structurally it contains a macrolactone ring (oleandolide) which is
synthesized by the assembly of one starter acetyl-coenzyme A (CoA) and
six extender methylmalonyl CoA units. These reactions are catalyzed by
a modular type I polyketide synthase comprising three large polypeptides, named OleA1, OleA2, and OleA3 (24, 25). The oleandomycin biosynthetic gene cluster has been fully sequenced and
characterized (1, 15, 16, 18, 19, 24, 25) (Fig. 1B). Two
DNA regions flanking the genes encoding the three multifunctional polypeptides of the polyketide synthase contain a number of genes that
code for other enzymatic functions required for the biosynthesis of the
two sugars and their transfer to the aglycon (1, 16, 18),
genes encoding an ABC transporter system responsible for secretion
(15), genes encoding an inactivating-reactivating enzymatic system that confers self-resistance to the producer organism
(18, 26), and a gene encoding a cytochrome P-450 oxygenase
involved in epoxidation of the macrolactone ring at carbon 8 (19,
24). The oleandomycin macrolactone ring is glycosylated by two
6-deoxysugars (L-oleandrose and
D-desosamine). Two glycosyltransferases (OleG1
and OleG2) are responsible for sugar transfer. Insertional inactivation
of oleG1 produced a mutant that accumulates the macrolactone 8,8a-deoxyoleandolide, because both OleG1 and OleG2
glycosyltransferases were affected in this mutant by a polar effect
(16). Complementation experiments using eryBV-
and eryCIII-minus mutants of the erythromycin producer
Saccharopolyspora erythraea showed that oleG1
complemented an eryCIII-minus mutant and oleG2
complemented an eryBV-minus mutant (6).
Therefore, it was concluded that D-desosamine and L-oleandrose were the substrates for the OleG1
and OleG2 glycosyltransferases, respectively. Further support for OleG2
as the L-oleandrose transferase came from
biotransformation experiments. By feeding erythronolide B (EB) to a
Streptomyces albus clone expressing the oleG2
gene and harboring pOLE, a plasmid containing all the genes necessary for the biosynthesis of L-oleandrose,
L-oleandrosyl-erythronolide B (OLE-EB) was formed
(1). One of the genes in pOLE (oleY) was
proposed to encode a 3-O-methyltransferase responsible for the conversion of dTDP-L-olivose into
dTDP-L-oleandrose during the biosynthesis of
L-oleandrose (1).
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.18.5358-5363.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Functional Analysis of OleY L-Oleandrosyl
3-O-Methyltransferase of the Oleandomycin
Biosynthetic Pathway in Streptomyces
antibioticus
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

View larger version (13K):
[in a new window]
FIG. 1.
(A) Chemical structure of the macrolide oleandomycin.
The arrow indicates the site of action of the OleY methyltransferase.
(B) Gene organization of the oleandomycin biosynthetic gene cluster.
oleY is shadowed. For a description of the different
genes and their functions, see references 1, 15, 16, 18, 19, 24,
and 25.
Here we report the oleY expression, purification of the OleY methyltransferase, and evidence demonstrating that methylation occurs at the C-3-O position of the neutral sugar to generate L-oleandrose during biosynthesis of oleandomycin by S. antibioticus. This methylation event occurs once the sugar is attached to the aglycon. Also we show that this methyltransferase can use as substrates at least two other monoglycosylated derivatives, L-rhamnosyl-erythronolide B (RHA-EB) and L-mycarosyl-erythronolide B (MYC-EB).
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Microorganisms, culture conditions, and plasmids. S. antibioticus ATCC 11891, an oleandomycin producer, was used as a donor of chromosomal DNA. S. lividans TK21 and S. albus NAG2 (1) were used as hosts for subcloning and for biotransformation experiments. E. coli XL1-Blue (4) was also used as a host for subcloning. pUC18 was used as subcloning vector in E. coli. pQE60 (Qiagen) and pUWL201 (7) were used as expression vectors in E. coli and S. lividans, respectively. pWHM2109 is a plasmid containing all the L-oleandrose genes from the avermectin biosynthetic gene cluster in Streptomyces avermitilis (27). When antibiotic selection of transformants was needed, 100 µg of ampicillin/ml, 25 µg of thiostrepton/ml, or 25 µg of apramycin/ml was used.
DNA manipulation and sequencing. Plasmid DNA preparations, endonuclease digestions, alkaline phosphatase treatments, ligations, and other DNA manipulations were carried out according to standard procedures for E. coli (21) and for Streptomyces (11).
Constructs for oleY expression in E. coli A 601-bp fragment containing the 5' end of oleY was amplified by PCR. The following oligoprimers were used: 5' GGAATTCTCATGACGTACGACGACCAC 3' for the 5' end and 5' ATCAAGCTTATGCCGATCCCTAGGCTA 3' for the 3' end. An EcoRI site was included in the first oligoprimer and a HindIII site was included in the second to facilitate subcloning, and these sites are underlined. In addition, a BspHI site was also included in the 5' oligoprimer in a region that includes the ATG starting codon to allow subcloning of the gene in expression vectors. PCR conditions were as follows: 100 ng of template DNA was mixed with 30 pmol of each primer and 2 U of Vent DNA polymerase (New England Biolabs) in a total reaction volume of 50 µl containing 2 mM concentration of each deoxynucleoside triphosphate, 10 mM KCl, 10 mM (NH4)2SO4, 20 mM Tris-HCl (pH 8.8), 2 mM MgSO4, 0.1% Triton X-100, and 10% dimethyl sulfoxide (DMSO) (Merck). Polymerization reaction was performed in a thermocycler (MinyCycler; MJ Research) under the following conditions: an initial denaturation of 3 min at 98°C; 30 cycles of 30 s at 98°C, 1 min at 67°C, and 3 min at 72°C; after the 30 cycles, an extra extension step of 5 min at 72°C was added. The PCR product was purified and subcloned into pUC18 as an EcoRI-HindIII fragment, generating pLR14b-1. To add the 3' end of oleY, this construct was digested with BamHI and HindIII and the released fragment was replaced by a 2.7-kb BamHI-HindIII fragment containing the 3' end of oleY, the entire oleP, and the 3' end of oleB, thus reconstituting the entire oleY in pLR14b-2. From this a 1.6-kb BspHI-StuI fragment containing the entire oleY and the 5' end of oleP was rescued and subcloned into the NcoI-BamHI sites (this last site blunt-ended with Klenow polymerase) of the E. coli expression vector pQE60. This final construct, pLR14b-3, was used for overexpression of oleY in E. coli.
Constructs for oleY expression in Streptomyces pLR14b-3 was digested with EcoRI and BglII. In this way oleY, preceded by the ribosomal binding site of pQE60, was rescued. This fragment was subcloned into the EcoRI-BamHI sites of the shuttle (E. coli-Streptomyces) expression vector pUWL201. The final construct, pLR14b-4, was used to transform S. lividans TK21 protoplasts. In this construct, expression of oleY is under the control of the strong constitutive erythromycin resistance gene promoter (ermEp) from S. erythraea.
Expression in E. coli and S.
lividans
E. coli harboring pLR14b-3 was
incubated in 2× TY medium overnight in the presence of 100 µg of
ampicillin/ml. Fresh medium was inoculated, and when the culture
reached an absorbance at 580 nm of approximately 0.4, induction was
initiated by adding a 1 mM final concentration of
isopropyl-
-D-thiogalactopyranoside (IPTG). At different
time intervals, samples were removed and washed twice by centrifugation
and the cells were broken by using an MSE ultrasonic disintegrator at
150 W and 20 kHz (5 pulses of 15 s each with intermittent cooling
on ice water). Soluble and insoluble fractions were separated by centrifugation.
Purification of the OleY methyltransferase.
S.
lividans LR14b-4, a recombinant strain that overexpresses
oleY (see Results), was used as a source of OleY
methyltransferase for enzyme purification. A spore suspension of this
strain was used to inoculate a 250-ml Erlenmeyer flask containing 25 ml
of TSB (Trypticase soy broth; Oxoid) liquid medium in the presence of 5 µg of thiostrepton/ml. This culture was incubated for 24 h at
30°C on an orbital shaker incubator (200 rpm) and used to inoculate
several 2-liter Erlenmeyer flasks containing 500 ml of TSB medium each
(also supplemented with 5 µg of thiostrepton/ml) at a 1:100 dilution.
After 48 h of incubation at 30°C in an orbital shaker, the
mycelia were collected by centrifugation and washed twice with
distilled water. The sample was suspended in buffer A (50 mM Tris-HCl
buffer, pH 8.0, 1 mM dithiothreitol) and disrupted by two passes
through a French press at a pressure of 1,500 lb/in2. DNA was broken by ultrasonic disruption
(3 pulses of 15 s each with intermittent cooling on ice water) at
150 W and 20 kHz. Unbroken cells and cellular debris were removed by
centrifugation at 30,000 × g for 15 min. Nucleic acids
were precipitated with streptomycin sulfate (1% final concentration),
and the precipitates were removed by centrifugation. The supernatant
was fractionated by precipitation with ammonium sulfate. Fractions
precipitating between 25 and 50% saturation were recovered by
centrifugation and diluted into buffer A to reach an ammonium sulfate
final concentration of 0.8 M. This fraction was applied to a
Phenyl-Sepharose 6 Fast Flow (High Sub) column (Pharmacia) previously
equilibrated with buffer A plus 0.8 M ammonium sulfate at a flow rate
of 3 ml/min. Elution took place with a decreasing linear gradient (0.8 to 0 M), active fractions were concentrated by ammonium sulfate
precipitation (95% saturation), and after centrifugation, the
precipitates were resuspended in 4 ml of buffer B (50 mM Tris-HCl [pH
8.0], 20% glycerol, 150 mM NaCl). The sample was applied to a
Sephacryl S-200 column (2.6 by 90 cm) at a flow rate of 0.3 ml/min.
Active fractions were pooled, extensively dialyzed against buffer C (50 mM Tris-HCl, pH 8.0, 20% glycerol), and applied to a Q-Sepharose column (20-ml volume) at a flow rate of 3 ml/min. The column was eluted
with a linear gradient of NaCl (0 to 0.6 M followed by a quick salt
increase to 1 M) in buffer C. Fractions containing the desired
enzymatic activity were pooled and kept in aliquots at
70°C until use.
Enzyme assays. Methylation of different substrates by OleY methyltransferase was carried out in a reaction mixture containing (for a 50-µl final volume) 1 µl of S-adenosyl-L-[methyl-3H]methionine (0.1 mCi/ml; specific activity, 68 Ci/mmol), 1 µl of different macrolide substrates (100 µM final concentration), and 48 µl of extract or purified protein. After different time incubations at 30°C, the reactions were extracted with 50 µl of ethyl acetate. The radioactivity in 25-µl samples was determined after evaporation, resuspension in 100 µl of methanol, and addition of scintillation cocktail.
Protein determinations and PAGE. Protein concentration in the different samples was determined by the protein-dye binding assay (3). Expression of oleY in E. coli and in S. lividans was followed by polyacrylamide gel electrophoresis (PAGE) in the presence of sodium dodecyl sulfate (SDS) as described previously (14). Gel staining was carried out with Coomassie blue.
Biotransformation experiments. Spores of the appropriate recombinant strains were used to inoculate agar plates with solid R5A medium (9), supplemented with 25 µg of thiostrepton/ml and 100-µg/ml concentrations of different macrolides (spiramycin, niddamycin, carbomycin) or glycosylated derivatives (EB, L-olivosyl-erythronolide B[OLV-EB], RHA-EB, and MYC-EB). After 5 days of incubation at 28°C, 2-cm2 pieces of agar were extracted with 2 ml of ethyl acetate and the extracts were evaporated under vacuum and redissolved in 20 µl of methanol.
Chromatographic techniques. Analysis by thin-layer chromatography (TLC) and high-performance liquid chromatography (HPLC) of the EB-related compounds were performed as described previously (1).
| |
RESULTS |
|---|
|
|
|---|
Expression of the OleY methyltransferase gene. The OleY methyltransferase gene was expressed using different expression systems both in E. coli and in S. lividans. After induction by IPTG of the E. coli strain containing pLR14b-3, a derivative of expression vector pQE60, a protein band of an Mr similar to that expected from the gene sequence was observed in Coomassie blue-stained gels. Analysis of soluble and insoluble fractions by SDS-PAGE showed that most OleY protein was found in the insoluble fraction, probably as inclusion bodies. To attempt its expression as a soluble protein, oleY was also expressed in S. lividans using the expression vector pUWL201. In this case, after incubation of the clone carrying pLR14b-4, a band of a size similar to that expected for OleY was observed, and most of the protein was found in the soluble fraction.
The OleY methyltransferase acts on monoglycosylated
macrolactones.
We carried out a series of experiments in order to
identify the substrate of the OleY methyltransferase. Initially we
tested the possibility that the OleY methyltransferase acts on a
dTDP-activated sugar intermediate. Cell extracts of S. lividans LR14b-4 overexpressing oleY were incubated in
the presence of an enzymatic system containing dTDP-4-keto-2,6-dideoxyglucose, extracts of two E. coli
clones (expressing RmlC 3,5-epimerase and RmlD 4-ketoreductase,
respectively), S-adenosyl-methionine, NADPH, and
MgCl2 in order to assess action of OleY on a
sugar biosynthetic intermediate through its conversion to
L-oleandrose. In spite of multiple attempts with
different modifications of the system, all the results were
unsuccessful (Leticia Rodríguez and Steffan Amman, unpublished
results). Subsequent efforts assessed whether OleY methyltransferase
acts on the sugar after transfer to the aglycon. Cosmid cosAB35
contains part of the oleandomycin polyketide synthase, a gene involved
in resistance to oleandomycin and its secretion, two
glycosyltransferases responsible for sugar transfer, cytochrome P-450,
and some sugar biosynthesis genes (15). The latter genes
include two D-desosamine-specific genes
(oleP1 and oleM1) and one gene specific for
synthesis of L-oleandrose, oleY. When
an S. lividans clone harboring cosAB35 was fed with OLV-EB,
a unique biotransformation product was obtained (approximately 40%
conversion) as analyzed by TLC (Fig. 2,
lane 1). The material in this spot was characterized by HPLC and found to be identical in retention time and absorption spectrum to pure OLE-EB, a previously isolated and characterized compound
(1). Since the only difference between these two
monoglycosylated macrolactones is the presence of a methyl group at the
3-hydroxy group of L-olivose, this result
prompted us to anticipate that methylation of
L-olivose was carried out by OleY and that this
methylation event occurred once the sugar was attached to the aglycon.
To confirm this assumption, a second biotransformation was carried out.
Plasmid pLR14b-4 was introduced in S. albus NAG2, a
recombinant strain that contains the erythromycin resistance gene
integrated into the chromosome and that is therefore resistant to all
macrolides. The resultant recombinant strain was fed with OLV-EB, and
after incubation the products were analyzed by TLC. Again, a new spot
corresponding to OLE-EB was produced with high efficiency (Fig. 2, lane
2).
|
The OleG2 glycosyltransferase does not transfer L-oleandrose. S. albus NAG2 harboring pOLV or pOLE was able to convert EB into OLV-EB or OLE-EB by biotransformation (1). Based on the above shown results, OleG2 glycosyltransferase transfers L-olivose, which is further converted into L-oleandrose by the OleY methyltransferase. We wondered if OleG2 was also able to recognize and transfer L-oleandrose. In the course of the present work, an L-oleandrose-synthesizing plasmid (pWHM2109) was made available to us. This plasmid contains seven genes (avrCDEFGHI) of the L-oleandrose gene cluster from the avermectin producer S. avermitilis; it directs the biosynthesis of L-oleandrose as shown by the incorporation of this neutral sugar into the avermectin aglycon (27). Protoplasts of S. albus NAG2 were transformed with pOLV, pOLE, and pWHM2109, and selected transformants from each transformation were fed with either EB or OLV-EB for bioconversion. In the presence of either pOLV or pOLE, EB was converted into OLV-EB and OLE-EB, respectively, according to experiments previously described (1). However, bioconversion of neither EB nor OLV-EB was observed in the recombinant strains containing pWHM2109. Since this plasmid directs the biosynthesis of L-oleandrose, the conclusion can be drawn that the formed L-oleandrose sugar is not recognized by the OleG2 glycosyltransferase.
Purification and characterization of the OleY
methyltransferase.
Using as starting material the S. lividans(pLR14b-4) recombinant strain (overproducing OleY), OleY
methyltransferase was purified using a four-step purification
procedure: ammonium sulfate precipitation and three chromatographic
steps using hydrophobic (Phenyl-Sepharose), gel filtration (Sephacryl
S-200), and anionic exchange (Q-Sepharose) resins (Table
1). The purified enzyme showed a single
band of about 43 kDa on SDS-PAGE and Coomassie staining, as expected, for the deduced product of oleY (Fig.
3). The enzyme was quite stable (in the
presence of 20% glycerol) when kept at low temperature, keeping most
of the activity after 30 days at
70°C. The native molecular mass of
the enzyme was approximately 87 kDa, indicating that the native enzyme
acts as a dimer. Activity of the enzyme occurred within a narrow range
of pH, with optimal pH between 7.2 to 7.6 and the activity drastically
decreasing below pH 6.5 and over pH 7.8 (Fig.
4A). Methylation activity was stimulated by the presence of different divalent cations (100 µM final
concentrations), such as Co2+ (11-fold),
Mn2+ (7-fold), Zn2+
(5-fold), Mg2+ (3.5-fold), and
Fe2+ (1.5-fold), whereas the enzyme activity was
strongly inhibited by the presence of Hg2+ and
Cu2+ or 1 mM EDTA. Different glycosylated
substrates were used for methylation. OLV-EB and RHA-EB were good
substrates for the enzyme, but MYC-EB was a poor substrate (Fig. 4B).
No methylation was found when niddamycin, carbomycin, or spiramycin was
used as substrate.
|
|
|
| |
DISCUSSION |
|---|
|
|
|---|
Seven genes have been identified to be involved in the biosynthesis of the sugar L-oleandrose in the oleandomycin gene cluster in S. antibioticus (1, 16). Five of these genes (oleV, oleW, oleL, oleU, and oleY) code for L-oleandrose-specific enzymes, and two of them (oleS and oleE) code for enzymes catalyzing early common steps in the biosynthesis of the two deoxysugars in oleandomycin, L-oleandrose and D-desosamine. L-Oleandrose is a 2,6-dideoxysugar that possesses a 3-O-methyl group. Comparison of oleY-deduced product with proteins in databases showed similarities with two other proteins proposed to encode sugar O-methyltransferases: TylE from Streptomyces fradiae, a tylosin producer (10), and SnogY from Streptomyces nogalater, a nogalamycin producer (28). OleY was suggested to be responsible for catalyzing the 3-O-methylation step during L-oleandrose biosynthesis (1, 16). It was assumed that this methylation, converting L-olivose into L-oleandrose, would occur during the biosynthesis of the sugar, with L-oleandrose being transferred to the oleandomycin macrolactone ring. This assumption was supported by the isolation of this neutral sugar in its activated form (dTDP-L-oleandrose) from S. avermitilis, a producer of the antihelmintic avermectin that also contains L-oleandrose (as a disaccharide) attached to the aglycon (22). Evidence reported in this paper indicates that the OleG2 glycosyltransferase transfers the unmethylated derivative, L-olivose, which is then converted into L-oleandrose once attached to the oleandomycin aglycon. In vivo biotransformation experiments and in vitro enzymatic assays show that oleY codes for a methylating enzyme able to convert the L-olivose-containing monoglycosylated aglycon (OLV-EB) into its 3-O-methylated derivative, OLE-EB. Only a few other examples of sugar methylation taking place once the sugars have been attached to the aglycon have been reported. TylE and TylF are two O-methyltransferases catalyzing final steps in tylosin biosynthesis in S. fradiae by successively methylating the hydroxy groups at C-2 and C-3 positions of the 6-deoxyallose sugar moiety, thus converting demethylmacrocin into macrocin and then into tylosin (10, 23). These two enzymes act once the three sugars in tylosin have been incorporated into the tylactone. In erythromycin biosynthesis by S. erythraea, eryG codes for a 3-O-methyltransferase that converts L-mycarose into L-cladinose (and therefore erythromycin C into erythromycin A). This is the final step in erythromycin biosynthesis and occurs once both sugars, L-mycarose and D-desosamine, are attached to the aglycon (17). The action of the OleY methyltransferase differs from that of these three methyltransferases. Thus, TylE, TylF, and EryG methylate fully glycosylated intermediates catalyzing final steps in tylosin and erythromycin biosynthesis, respectively. In contrast, OleY acts on a monoglycosylated intermediate that is further converted into a diglycosylated derivative by the transfer of D-desosamine by the OleG1 glycosyltransferase. EryG and OleY methylate sugars (L-mycarose and L-olivose, respectively) attached to the same position of 14-membered aglycons, and they act on a hydroxy group attached to the same carbon atom of the sugar. However, their similarity at the protein level is quite low (18% identical amino acids). This can be due to the fact that the two enzymes act on different sugar substrates and at different steps in the biosynthesis of the corresponding macrolide antibiotic. However, EryG is also able to methylate OLV-EB as OleY does. When a S. erythraea mutant lacking the polyketide synthase genes (JC2 mutant) (20) was grown in the presence of either OLV-EB or OLE-EB, an identical diglycosylated erythronolide B derivative was found in both cases after the biotransformation experiment (A. F. Braña, unpublished results). This should be the result of the incorporation of the D-desosamine moiety by the EryCIII glycosyltransferase (in both OLV-EB and OLE-EB experiments) followed by a 3-O-methylation event (mediated by the EryG enzyme in the case of the OLV-EB experiment). It is noticeable that methylation of L-olivose by EryG occurs in a hydroxy group that shows different stereochemistry than the hydroxy group at L-mycarose (usual substrate for EryG).
OleY methyltransferase was purified to near homogeneity in a four-step procedure and quite efficiently converted OLV-EB and also RHA-EB into 3'-O-methylated derivatives. However, methylation of MYC-EB was less efficient. Some structural features that differentiate L-mycarose from L-olivose and L-rhamnose are the presence of a methyl group at C-3 of L-mycarose and the different stereochemistry of the hydroxy group at C-3. These differences could account for the low methylating activity of OleY on MYC-EB. The native OleY enzyme was found to be a dimer, which is in agreement with two other macrolide sugar O-methyltransferases previously characterized, TylE and TylF, which were found to be a trimer and a dimer, respectively (2, 13).
L-Oleandrose is not a sugar frequently found in nature. As
far as we know it is present in only two macrolide bioactive compounds: the antibacterial oleandomycin and the antihelmintic avermectin. Interestingly, the producer organisms of these two compounds seem to
have evolved two different pathways for synthesis and incorporation of
the same sugar into the aglycon. In S. avermitilis,
L-oleandrose is synthesized as a
nucleotide-activated sugar that is transferred to the aglycon by a
glycosyltransferase which incorporates two successive
L-oleandrose moieties (12, 27). In
contrast, the oleandomycin producer S. antibioticus
synthesizes the unmethylated derivative,
L-olivose, which is transferred to the aglycon by the OleG2 glycosyltransferase and then converted into
L-oleandrose by the OleY methyltransferase (Fig.
5). This intermediate is subsequently glycosylated with D-desosamine by the OleG1
glycosyltransferase, thus generating the final compound,
oleandomycin. Data shown in this paper demonstrate that OleG2
cannot transfer L-oleandrose if it is present in
the cytoplasm in its nucleotide-activated form, thus excluding a role
for OleG2 as an L-oleandrose glycosyltransferase. Another difference between the two sugar pathways resides in the 2-deoxygenation step. Two enzymes are required to catalyze this deoxygenation, a dehydratase and a reductase. Experimental biochemical evidence for the activity of these two enzymes has been reported for
the biosynthesis of granaticin and oleandomycin in Streptomyces violaceoruber Tü22 and in S. antibioticus
Tü99, respectively (8), and for the biosynthesis of
tylosin in S. fradiae (5). 2,3-Dehydration is
first catalyzed by a small family of
Zn2+-dependent dehydratases (5) that
share a high degree of similarity at the protein level. Two mechanisms
exist for catalyzing the C-3 reduction step. In one way, exemplified by
the Gra-orf26 or the Tü99-orf11, the reduction forms a
sugar in which the C-3 hydroxy group is equatorial (8). In
the other approach, exemplified by TylC2, the resulting hydroxy group
is axial (5). The reduction step in the biosynthesis of
L-olivose in S. antibioticus is
carried out by OleW. This protein is identical at the protein level to the Tü99-orf11 reductase, and therefore the hydroxy group at C-3
should be equatorial. On the other hand, in
L-oleandrose biosynthesis in S. avermitilis the enzyme responsible for the reduction step, AveBVIII, shows a high similarity to TylC2 (60% identical amino acids), and therefore it should produce a sugar intermediate with an
axial hydroxy group at C-3.
|
| |
ACKNOWLEDGMENTS |
|---|
This research was supported by grants from the European Union (BIO4-CT96-0080 and QLK3-CT-1999-00095).
We thank Glaxo Smithkline Beecham (Stevenage, United Kingdom) for providing EB, MYC-EB, and RHA-EB, Peter F. Leadlay for providing the S. erythraea JC2 mutant, and S.-E. Wohlert and C. R. Hutchinson for providing plasmid pWHM2109.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Departamento de Biología Funcional e Instituto Universitario de Oncología del Principado de Asturias (I.U.O.P.A), Universidad de Oviedo, 33006 Oviedo, Spain. Phone: 34-985-103652. Fax: 34-985-103652. E-mail: jasf{at}sauron.quimica.uniovi.es.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Aguirrezabalaga, I.,
C. Olano,
N. Allende,
L. Rodriguez,
A. F. Braña,
C. Méndez, and J. A. Salas.
2000.
Identification and expression of genes involved in L-oleandrose biosynthesis and its intermediate L-olivose in the oleandomycin producer Streptomyces antibioticus.
Antimicrob. Agents Chemother.
44:1266-1275 |
| 2. |
Bauer, N. J.,
A. J. Kreuzman,
J. E. Dotzlaf, and W. K. Yeh.
1988.
Purification, characterization, and kinetic mechanism of S-adenosyl-L-methionine:macrocin O-methyltransferase from Streptomyces fradiae.
J. Biol. Chem.
263:15619-15625 |
| 3. | Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254[CrossRef][Medline]. |
| 4. |
Bullock, W. O.,
J. M. Fernández, and J. M. Short.
1987.
XL1-Blue: a high efficiency plasmid transforming recA Escherichia coli strain with -galactosidase selection.
BioTechniques
5:376.
|
| 5. | Chen, H., G. Agnihotri, Z. Guo, N. L. S. X. H. Que Chen, and H.-W. Liu. 1999. Biosynthesis of mycarose: isolation and characterization of enzymes involved in the C-2 deoxygenation. J. Am. Chem. Soc. 121:8124-8125[CrossRef]. |
| 6. | Doumith, M., R. Legrand, C. Lang, J. A. Salas, and M. C. Raynal. 1999. Interspecies complementation in Saccharopolyspora erythraea: elucidation of the function of oleP1, oleG1 and oleG2 from the oleandomycin biosynthetic gene cluster of Streptomyces antibioticus and generation of new erythromycin derivatives. Mol. Microbiol. 34:1039-1048[CrossRef][Medline]. |
| 7. | Doumith, M., P. Weingarten, U. F. Wehmeier, K. Salah-Bey, B. Benhamou, C. Capdevila, J. M. Michel, W. Piepersberg, and M. C. Raynal. 2000. Analysis of genes involved in 6-deoxyhexose biosynthesis and transfer in Saccharopolyspora erythraea. Mol. Gen. Genet. 264:477-485[CrossRef][Medline]. |
| 8. | Draeger, G., S.-H. Park, and H. G. Floss. 1999. Mechanism of the 2-deoxygenation step in the biosynthesis of the deoxyhexose moieties of the antibiotics granaticin and oleandomycin. J. Am. Chem. Soc. 121:2611-2612[CrossRef]. |
| 9. |
Fernández, E.,
U. Wei bach,
C. Sánchez Reillo,
A. F. Braña,
C. Méndez,
J. Rohr, and J. A. Salas.
1998.
Identification of two genes from Streptomyces argillaceus encoding two glycosyltransferases involved in the transfer of a disaccharide during the biosynthesis of the antitumor drug mithramycin.
J. Bacteriol.
180:4929-4937 |
| 10. |
Fouces, R.,
E. Mellado,
B. Diez, and J. L. Barredo.
1999.
The tylosin biosynthetic cluster from Streptomyces fradiae: genetic organization of the left region.
Microbiology
145:855-868 |
| 11. | Hopwood, D. A., M. J. Bibb, K. F. Chater, T. Kieser, C. J. Bruton, H. M. Kieser, D. J. Lydiate, C. P. Smith, J. M. Ward, and H. Schrempf. 1985. Genetic manipulation of Streptomyces. A laboratory manual. The John Innes Foundation, Norwich, England. |
| 12. |
Ikeda, H.,
T. Nonomiya,
M. Usami,
T. Ohta, and S. Omura.
1999.
Organization of the biosynthetic gene cluster for the polyketide anthelmintic macrolide avermectin in Streptomyces avermitilis.
Proc. Natl. Acad. Sci. USA
96:9509-9514 |
| 13. |
Kreuzman, A. J.,
J. R. Turner, and W. K. Yeh.
1988.
Two distinctive O-methyltransferases catalyzing penultimate and terminal reactions of macrolide antibiotic (tylosin) biosynthesis. Substrate specificity, enzyme inhibition, and kinetic mechanism.
J. Biol. Chem.
263:15626-15633 |
| 14. | Laemmli, U. K. 1971. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685. |
| 15. | Olano, C., A. M. Rodriguez, C. Méndez, and J. A. Salas. 1995. A second ABC transporter is involved in oleandomycin resistance and its secretion by Streptomyces antibioticus. Mol. Microbiol. 16:333-343[CrossRef][Medline]. |
| 16. | Olano, C., A. M. Rodriguez, J. M. Michel, C. Méndez, M. C. Raynal, and J. A. Salas. 1998. Analysis of a Streptomyces antibioticus chromosomal region involved in oleandomycin biosynthesis that contains two glycosyltransferases responsible for glycosylation of the macrolactone ring. Mol. Gen. Genet. 259:299-308[CrossRef][Medline]. |
| 17. |
Paulus, T. J.,
J. S. Tuan,
V. E. Luebke,
G. T. Maine,
J. P. DeWitt, and L. Katz.
1990.
Mutation and cloning of eryG, the structural gene for erythromycin O-methyltransferase from Saccharopolyspora erythraea, and expression of eryG in Escherichia coli.
J. Bacteriol.
172:2541-2546 |
| 18. | Quirós, L. M., I. Aguirrezabalaga, C. Olano, C. Méndez, and J. A. Salas. 1998. Two glycosyltransferases and a glycosidase are involved in oleandomycin modification during its biosynthesis by Streptomyces antibioticus. Mol. Microbiol. 28:1177-1186[CrossRef][Medline]. |
| 19. | Rodriguez, A. M., C. Olano, C. Méndez, C. R. Hutchinson, and J. A. Salas. 1995. A cytochrome P450-like gene possibly involved in oleandomycin biosynthesis by Streptomyces antibioticus. FEMS Microbiol. Lett. 127:117-120[CrossRef][Medline]. |
| 20. | Rowe, C. J., J. Cortés, S. Gaisser, J. Staunton, and P. F. Leadlay. 1998. Construction of new vectors for high-level expression in actinomycetes. Gene 216:215-223[CrossRef][Medline]. |
| 21. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 22. |
Schulman, M. D.,
S. L. Acton,
D. L. Valentino, and B. H. Arison.
1990.
Purification and identification of dTDP-oleandrose, the precursor of the oleandrose units of the avermectins.
J. Biol. Chem.
265:16965-16970 |
| 23. |
Seno, E. T., and R. Balz.
1981.
Properties of S-adenosyl-L-methionine: macrocin O-methyltransferase in extracts of Streptomyces fradiae strains which produce normal or elevated levels of tylosin and in mutants blocked in specific O-methylations.
Antimicrob. Agents Chemother.
20:370-377 |
| 24. | Shah, S., Q. Xue, L. Tang, J. R. Carney, M. Betlach, and R. McDaniel. 2000. Cloning, characterization and heterologous expression of a polyketide synthase and P-450 oxidase involved in the biosynthesis of the antibiotic oleandomycin. J. Antibiot. 53:502-508[Medline]. |
| 25. | Swan, D. G., A. M. Rodriguez, C. Vilches, C. Méndez, and J. A. Salas. 1994. Characterisation of a Streptomyces antibioticus gene encoding a type I polyketide synthase which has an unusual coding sequence. Mol. Gen. Genet. 242:358-362[CrossRef][Medline]. |
| 26. |
Vilches, C.,
C. Hernández,
C. Méndez, and J. A. Salas.
1992.
Role of glycosylation and deglycosylation in the biosynthesis of and resistance to oleandomycin in the producer organism Streptomyces antibioticus.
J. Bacteriol.
174:161-165 |
| 27. | Wohlert, S.-E., N. Lomovskaya, K. Kulowski, L. Fonstein, J. L. Occi, K. M. Gewain, D. J. MacNeil, and C. R. Hutchinson. 2001. Insights about the biosynthesis of the avermectin deoxysugar L-oleandrose through heterologous expression of Streptomyces avermitilis deoxysugar genes in Streptomyces lividans. Chem. Biol. 8:681-700[CrossRef][Medline]. |
| 28. | Ylihonko, K., J. Tuikkanen, S. Jussila, L. Cong, and P. Mäntsälä. 1996. A gene cluster involved in nogalamycin biosynthesis from Streptomyces nogalater: sequence analysis and complementation of early-block mutations in the anthracycline pathway. Mol. Gen. Genet. 251:113-120[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»