Previous Article | Next Article 
Journal of Bacteriology, September 2001, p. 5414-5425, Vol. 183, No. 18
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.18.5414-5425.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Selection and Characterization of Escherichia coli
Variants Capable of Growth on an Otherwise Toxic Tryptophan
Analogue
Jamie M.
Bacher1 and
Andrew D.
Ellington1,2,*
Institute for Cellular and Molecular
Biology1 and Department of Chemistry and
Biochemistry,2 University of Texas at
Austin, Austin, Texas 78712
Received 20 December 2000/Accepted 6 June 2001
 |
ABSTRACT |
Escherichia coli isolates that were tolerant of
incorporation of high proportions of 4-fluorotryptophan were
evolved by serial growth. The resultant strain still preferred
tryptophan for growth but showed improved growth relative to the
parental strain on other tryptophan analogues. Evolved clones fully
substituted fluorotryptophan for tryptophan in their proteomes within
the limits of mass spectral and amino acid analyses. Of the genes
sequenced, many genes were found to be unaltered in the evolved strain;
however, three genes encoding enzymes involved in tryptophan uptake and
utilization were altered: the aromatic amino acid permease
(aroP) and tryptophanyl-tRNA synthetase
(trpS) contained several amino acid substitutions, and
the tyrosine repressor (tyrR) had a nonsense mutation.
While kinetic analysis of the tryptophanyl-tRNA synthetase
suggests discrimination against 4-fluorotryptophan, an analysis of
the incorporation and growth patterns of the evolved bacteria suggest that other mutations also aid in the adaptation to the tryptophan analogue. These results suggest that the incorporation of unnatural amino acids into organismal proteomes may be possible but that extensive evolution may be required to reoptimize proteins and metabolism to accommodate such analogues.
 |
INTRODUCTION |
Cellular growth in the presence of
unnatural amino acids often results in at least the partial
incorporation of the analogues into proteins. For example,
although 4-fluorotryptophan (4fW) is eventually toxic to cells,
bacteria can grow for several generations in its presence and proteins
that contain high levels of this analogue can be isolated (5,
29). Similarly, p-Cl-phenylalanine has been shown to
replace phenylalanine in vivo, but it drastically decreases luciferase
activity (14). Azaleucine can also be partially incorporated in place of arginine and has been shown to suppress an
otherwise lethal mutation in thymidylate synthase (20). It has recently been shown that a tRNA synthetase with compromised editing
function will allow the replacement of valine with cysteine, threonine,
or
-aminobutyrate (9). Similarly, a tyrosyl-tRNA synthetase mutant has been isolated which discriminates against azatyrosine less readily than the wild type (13). All of
these examples demonstrate that the partial substitution of one amino acid for another is possible.
Current methods for unnatural amino acid incorporation in vivo involve
either the site-specific incorporation of an unnatural amino acid into
a few proteins (11) or the partial incorporation into many
proteins. In contrast, we and Wong (37) have
attempted to incorporate unnatural amino acids throughout an organismal proteome. Such attempts to develop unnatural organisms should enhance
our understanding of the extent to which even the most basic
biochemistry is evolvable or optimal and may suggest metabolic alternatives for engineered organisms. In order to explore these possibilities, we attempted to evolve Escherichia coli
variants which could survive on 4fW, which is otherwise toxic (5,
29).
Evolutionary approaches have the drawback that diverse genetic and
metabolic possibilities are available to organisms under selection, and
it was not clear in advance which evolutionary path would be taken.
Based on previous experiments by Wong (37), we
hypothesized that a relatively small number of proteins which were
adversely affected by 4fW would mutate to accommodate the analogue. The
fluorine-for-hydrogen substitution adds only ~0.15 Å in diameter,
and this substitution was expected to be generally insignificant, as
has previously been observed when the activities of
fluorotryptophan-substituted enzymes have been examined
(27). It was also possible that the fluorine substitution
would alter the electronic properties of tryptophan. However, while
there are examples of the N1 of the indole ring being functional,
enzymes which so use tryptophan are rare. In addition to the adaptation of proteins to 4fW substitution, there were other possible outcomes. Mutations in tryptophan-incorporating enzymes, such as tRNA synthetases or permeases, that would discriminate against the analogue might be
isolated. Examples of mutant tRNA synthetases with increased specificity are known, so this was considered to be a relatively probable outcome (6). Similarly, 4fW might be
selectively degraded, for example, by tryptophanase, or novel
mechanisms for the defluorination of the analogue or the de novo
synthesis of tryptophan might arise. While the latter possibility at
first seems farfetched, recent work has demonstrated the mutational
proximity of proteins in the histidine and tryptophan (W) biosynthetic
pathways (15), while other work has demonstrated that
neighboring genes in the tryptophan pathway can be mutated to
functionally replace one another (1).
We made use of a serial dilution technique in which the 4fW-to-W
ratio was gradually made more strict until only 4fW was added to the
media. After over 3,000 h of serial dilution, a strain of bacteria was
isolated that was capable of growth in media where the only W available
was the 4fW analogue. While the strain still exhibits a marked growth
preference for W, and thus does not contain a new genetic code, a
number of coordinate genetic changes were required for adaptation
to 4fW.
 |
MATERIALS AND METHODS |
Strains and media.
E. coli strain C600
trpE (thi-1 thr-1 leuB6 lacY1 tonA21 supE44
mcrA
trpE) was a gift of I. J. Molineux at the
University of Texas at Austin. This strain was transformed with the
plasmid pUC18 (yielding C600p) prior to the initiation of selection
experiments. Luria-Bertani (LB) and M9 media were supplemented with
ampicillin (Ap), kanamycin (Kn), or chloramphenicol (Cm)
(3). For selection experiments, M9 media with 0.4%
glucose were supplemented with 0.0005% thiamine and 20 µg (each) of
threonine and leucine/ml. L-W and
DL-4fW were introduced at various ratios so that
a total concentration of 20 µg/ml of the
L-enantiomer was generally maintained (in some
instances, the total concentration of the
L-enantiomer was increased; see below). The
resultant minimal media were designated M9B1TL, followed by the percent
of tryptophan with the 4-fluoro-adduct; for example, M9B1TL95%
indicates 38 µg of DL-4fW/ml-1 µg of W/ml.
Serial transfer.
Overnight cultures grown in LB plus Ap
medium were initially inoculated separately with two clones of C600p,
designated C600p-1 and C600p-2. These cultures were then diluted
1:100 into M9B1TL95% plus Ap and growth curves were generated by
monitoring the optical density of the culture at 600 nm
(OD600). Upon reaching either an
OD600 of approximately 0.5 or stationary phase,
the cultures were further diluted 1:100 into fresh media
containing ampicillin and various ratios of 4fW to W. Glycerol stocks
were made prior to each transfer and stored at
80°C for later
analysis. Once stable and reproducible growth was observed at a given
4fW proportion, the evolving strains were successively transferred into
97, 98, 99, and 99.5% 4fW (see Fig. 2). To avoid the possibility that tryptophan might become limiting for growth, the total amount of W and
4fW in later transfers was increased to 40 µg total of the
L-enantiomer/ml: 79.8 µg of DL-4fW/ml and 0.1 µg of W/ml, referred to as 2x99.72%. The remaining transfers
were to M9B1TL3x99.85% (60 µg total of the
L-enantiomer/ml, 99.85% of which was 4fW), followed by
M9B1TL3x99.92% and then M9B1TL3x99.97%. The strain C600p-2 did
not survive beyond the first M9B1TL3x99.92% transfer. After seven
serial transfers in M9B1TL3x99.97%, two clones (B7-3 and B7-4) were
isolated from the C600p-1 population and used in further experiments.
Plasmid DNA prepared from these clones indicated that they had retained
the original pUC18 plasmid.
Characterization of growth capabilities.
Overnight cultures
of strains (C600p, B7-3, and B7-4) were grown in M9B1TL95% plus Ap
medium were used to inoculate (by 1:100 dilutions) several media
representing a range of 4fW-to-W ratios or a range of W concentrations.
These cultures were aliquoted into triplicate wells of plates used by
the Bioscreen C (Labsystems Oy, Helsinki, Finland), a plate reader
designed to monitor cell growth. Using the Bioscreen C, growth curves
were generated for each culture and averaged. The growth rate of each
culture was estimated by fitting the log phase of each growth curve to
the following equation: y = a log
x + b, in which y is the
OD600, x is the time, and a
is growth rate. Growth rates were then plotted against 4fW proportions.
Similar experiments were carried out with 5-fluorotryptophan (5fW) and 6fW.
Expression vector construction, protein purification, and
characterization.
The kanamycin kinase gene was amplified from the
vector p182Sfi-Kan (K. A. Marshall and A. D. Ellington,
unpublished data) using primers Kan1.39
(5'-CGCGGATCCGGCCACCATGGCCAAGCGAACCGGAAT-3') and
Kan2.39
(5'-CCGGAATTCTGAGGCCTGACAGGCCTTAGAAGAACTCGT-3'),
digested with EcoRI and BsaBI, and then cloned
into pGEX-KG (12) digested with SmaI and
EcoRI. This glutathione S-transferase (GST)
expression vector, called pGSR, was used to transform strains B7-3 and
B7-4.
Overnight LB-plus-Kn cultures of B7-3 and B7-4 containing pGSR were
used to inoculate M9B1TL95% plus Kn. This culture was in turn diluted
1:100 into 100 ml of M9B1TL95% plus Kn. At mid-log phase, cells were
concentrated by centrifugation and resuspended in 100 ml of either
M9B1TLW plus Kn or M9B1TL3x100% plus Kn, both supplemented with 0.3 mM
IPTG (isopropyl-
-D-thiogalactopyranoside). After 16 h of growth, cells were harvested and lysed in 5 ml of bacterial
protein extraction reagent (B-PER; Pierce, Beverly, Mass.). GST
was isolated from the soluble fraction as previously described
(3), and three 0.5-ml fractions were stored at 4°C. Each
elution fraction was concentrated (10,000 MW cutoff; microconcentrator; Microcon, Rockford, Ill.), the final protein purity was estimated by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) to
be greater than 95%, and the concentrations of the protein fractions
were estimated spectrophotometrically to be as follows: 5 mg/ml from
B7-3 grown in W; 6 mg/ml from B7-3 grown in 4fW; 1.5 mg/ml from B7-4
grown in W; and 0.5 mg/ml from B7-4 grown in 4fW).
Mass spectrometry was carried out at the Mass Spectrometry Facility in
the Chemistry and Biochemistry Department at the University
of Texas at
Austin. The whole GST protein was analyzed by high-performance
liquid
chromatography-electrospray ionization mass spectrometry
(HPLC-ESI MS)
and by matrix-assisted laser desorption ionization-time
of flight (MS)
[MALDI-TOF (MS)]. For these experiments, trifluoroacetic
acid and
formic acid were used to eliminate acetylation. For peptide
analyses, 5 µg of GST from B7-3 cells grown on either W or 4fW
cultures was
lyophilized, resuspended in 0.1 M
NH
4HCO
3, and digested
with
immobilized
L-1-tosylamido-2-phenylethyl chloromethyl
ketone
(TPCK)-treated trypsin (Pierce) at 37°C for 10 h.
Trypsin was
removed by centrifugation, and the digest was lyophilized
and
resuspended in water to a concentration of 210 µM for HPLC-ESI
MS
analysis. GST was also isolated from both C600p and B7-3 cells
grown on
W, 95% 4fW, or 95% 4fW in which the culture was switched
to 4fW upon
induction. Purified protein was digested as described
above and
analyzed by HPLC-ESI.
Amino acid analysis.
Cultures of C600p and B7-3 were grown
in 25 ml of media containing W and 95% 4fW to saturation. These
cultures were pelleted by centrifugation and resuspended and lysed in
200 µl of B-PER. Then, 50 µl of this lysate was passed through a
CENTRI-SEP size-exclusion column (Princeton Separations, Adelphia,
N.J.) to remove unincorporated amino acids. The purified lysate was
hydrolyzed (with 10% thioglycolic acid to prevent tryptophan
degradation) and analyzed by the Protein Facility of the Institute for
Cellular and Molecular Biology at the University of Texas at Austin.
Gene sequencing.
Genes from the parental strain, B7-3, and
B7-4 were amplified and sequenced on an ABI377 sequencer. The genes
that were analyzed were those for aromatic amino acid permease
(aroP), tryptophanyl-tRNA synthetase (trpS),
tRNATrp (trpT), tryptophanase
(tnaA), single-stranded DNA binding protein (ssb), glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
(gapA), the pUC18 origin of replication (ColE1),
-lactamase (bla), tryptophan repressor (trpR),
tyrosine repressor (tyrR), and the tryptophan-specific transporter (mtr). The primers used for the amplification
and sequencing of the genes, as well as ~100 bp of flanking regions, are listed in Table 1.
Growth effects of C600p conferred by mutant
aroP and trpS genes.
Wild-type and
mutant aroP and trpS genes were amplified and
cloned into the TOPO-TA vector pCR2.1 (Invitrogen, Carlsbad, Calif.). The trpS insert was then subcloned into the
BamHI-XbaI sites of pACYC184 (18).
The vector with the wild-type trpS gene was designated pABXWSw, while the vector with the mutant trpS gene was
designated pABXWSm. The TOPO-TA vector
BamHI-XbaI fragments containing aroP were then subcloned into BamHI-SpeI-digested
pABXWSw and pABXWSm (XbaI and SpeI yield
compatible overhangs). These manipulations ultimately yielded either
pAPwWSw and pAPmWSm, plasmids that contained both trpS and
aroP wild-type or mutant genes, respectively. Parental C600p
was separately transformed with pAPwWSw and pAPmWSm. The p15A-derived
origin of replication of pACYC184 was compatible with the pUC18 plasmid
already present in C600p, and thus, both plasmids could be propagated
simultaneously. Single colonies were grown overnight in M9B1TL95% plus
Ap and Cm. Growth rates on various ratios of 4fW to W were determined
as described above.
Wild-type and mutant TrpRS overexpression, purification, and
charging.
The primers 40.WSB.NdeI
(5'-TCGACATATGACTAAGCCCATCGTTTTTAGTGGCGCACAG-3') and
40.WSA
(5'-CAGCACTCGAGAATTACGGCTTCGCCACAAAACCAATCGC-3') were
used to amplify wild-type and mutant trpS genes. These were ligated into the pCR2.1 TOPO vector and sequenced to confirm that there
were no mutations introduced by PCR. Isolated plasmids were digested
using NdeI and XbaI, and wild-type and mutant
trpS genes were introduced into appropriately digested
pET28b (Novagen, Madison, Wis.) (18), generating pETWSw
and pETWSm, respectively. These plasmids were electroporated into
BL21(DE3) cells. Log phase LB-plus-Kn cultures (35 ml) were induced
with 0.3 mM IPTG for 3 h.
Protein was purified essentially as described by the manufacturer. In
short, cultures were spun down, lysed in 1 ml of B-PER,
and incubated
with 10 mM MgCl
2 and 1 U of DNase I at room
temperature
for 5 min. The lysates were cleared by centrifugation at
10,000
rpm for 30 min at 4°C, and the supernatants were centrifuged
again
for 15 min. The supernatants were then loaded on 1-ml nickel
columns
at room temperature. The columns were washed with 10 ml of
binding
buffer (20 mM Tris-HCl, pH 7.9, 0.5 M NaCl, 50 mM
imidazole) and
6 ml of wash buffer (same as the binding buffer but with
60 mM
imidazole), and fractions were collected in elution buffer (20
mM
potassium phosphate, pH 7.0, 0.5 M NaCl, 1 M imidazole). Fractions
with protein were identified by SDS-PAGE, pooled, and dialyzed
overnight against TrpRS buffer (20 mM potassium phosphate, pH
7.0, 10 mM KCl, 5 mM MgCl
2, 4 mM dithiothreitol, 20%
glycerol)
at 4°C; the dialyzed proteins were stored at

20°C.
Protein was
quantitated by Bradford assay or by SDS-PAGE using known
standards.
tRNA for charging assays was produced using the AmpliScribe T7
transcription kit (Epicentre, Madison, Wis.) with the template
WtRNA.1
(5'-TGGCAG GGGCGGAGAGACTCGAACTCCCAACACCCGGTTTTGGAGACCGGT
GCTCTACCAATTGAACTACGCCCCTCTATAGTGAGTCGTATTAGAA- 3')
and the T7
promoter sequence 24T7.JB1
(5'-TTCTAATACGACTCACTATAG-3'). This
sequence adds an extra G
to the 5' end of the tRNA to enhance
transcription. tRNA was labeled
with [

-
32P]ATP and purified by
PAGE.
To determine the relative charging abilities of mutant and wild-type
enzymes, each was incubated with various amounts of 4fW
in the presence
of [
3H]W. Reactions were carried out with final
concentrations of 50
mM HEPES (pH 7.0), 10 mM
MgCl
2, 4 mM dithiothreitol, 2 mM ATP,
0.05%
bovine serum albumin, 2 µM
[

-
32P]tRNA
Trp, and 2 µM [
3H]W (
32). These solutions
were heated to 70°C for 3 min and
cooled to 37°C for 10 min prior
to the addition of enzyme to start
the reactions. Reactions were
carried out in triplicate. Four
minutes after the addition of enzymes,
samples (10 µl) were loaded
onto filter discs that had previously
been soaked with 5% trichloroacetic
acid and 10 mM W. Filter discs
were washed three times in 5% trichloroacetic
acid-10 mM W, twice in
70% ice-cold ethanol, and once in ether,
and the discs were then
air-dried and counted. Ratios of
3H counts to
32P counts were determined, normalized to a
no-4fW control, and
plotted against the concentration of the 4fW
competitor.
Incorporation assay.
Overnight cultures of C600p and B7-4
were grown on M9B1TL95% plus Ap and used to inoculate a 105-ml culture
of M9B1TL95% plus Ap by a 1:100 dilution. These cultures were grown to
an OD600 of ~0.35, spun down at room
temperature, and resuspended in 50 ml of M9B1L plus Ap. Four
milliliters of the resuspended cultures was aliquoted to fresh tubes
containing 50 nM [3H]W-500 nM
[14C]T. These cultures were incubated at 37°C
with shaking (250 rpm) for 10 min and then placed on ice. Triplicate
1-ml samples were aliquoted from each culture and centrifuged. Pellets
were resuspended and lysed in 50 µl of B-PER. Half of each lysate was
centrifuged to remove insoluble material and passed through CENTRI-SEP
columns to remove unincorporated label (these columns were shown to
remove detectable radioactivity when at least a ~100-fold-greater
number of counts were applied). Eluant (10 µl) was mixed with
scintillation fluid and counted. 3H and
14C counts were corrected for overlapping windows
based on known standards and were converted to femtomoles of W and
picomoles of T, and ratios were determined and plotted.
 |
RESULTS AND DISCUSSION |
Evolution of 4fW-tolerant bacteria.
E. coli
cells are remarkably tolerant of 4fW (Fig.
1) if tryptophan is also provided. We
found that the tryptophan auxotroph C600p was capable of stable,
continual growth in media where 95% of the available tryptophan was
4fW (for example, Fig. 2). However, while
E. coli tolerates 4fW, it cannot use 4fW as the sole
source of tryptophan (5, 29). Attempts to grow C600p in
higher proportions of 4fW (>99% 4fW) inevitably resulted in cell
death after one or two serial transfers. We reasoned that it might
be possible to select for bacteria with increasing tolerance to
(and possibly increased utilization of) higher proportions of 4fW.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1.
Tryptophan and 4-fluorotryptophan. The fluorine atom is
0.15 Å in diameter larger than the hydrogen atom it replaces but is
more electronegative. Numbers indicate positions of fluorine
substitutions for tryptophan analogues that have been examined.
|
|

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 2.
Evolution of 4fW-tolerant E. coli.
OD600 readings of a culture of C600p were made as a
function of time. Each culture was diluted into fresh media when it
entered stationary phase or reached an OD600 of >~0.5.
After stable and reproducible growth was demonstrated in each medium,
the culture was switched to a higher ratio of 4fW to W. The inset shows
an expanded view of growth during the early stages of adaptation.
Numbers in parentheses are the average time (in hours) between
dilutions. Arrows indicate unsuccessful attempts to transfer cultures
to media with much higher 4fW-to-W ratios: the parental strain was
unable to grow on 99% 4fW, while strains at 238.25 and 312.25 h were
unable grow on 99.97% 4fW. As the serial transfer was continued,
successively higher total amounts of total W were added to the media
(see Materials and Methods). For this reason, 2x- and 3x- followed by
percentages designate real ratios of 4fW to W but also indicate a
greater amount of 4fW plus W in the media. Furthermore, 100% 4fW is
not shown due to the contamination of commercial 4fW with 0.03% W;
hence, 99.97% 4fW is the highest possible ratio of 4fW to W.
|
|
Simple serial transfer techniques were used to evolve 4fW-tolerant
strains (Fig.
2). In order to prevent contamination of
the evolving
bacterial population with environmental prototrophs,
a plasmid bearing
an antibiotic resistance element was introduced
into the parental
strain. The presence of this plasmid was used
throughout serial
transfer experiments as a marker for the evolving
strain. After
250 h of continuous evolution and 14 serial transfers,
the
parental strain was gradually adapted to 97, 98, and finally
99% 4fW
(Fig.
2, inset). Growth at proportions with greater than
99% 4fW
proved difficult to achieve and required more discrete
steps.
Nonetheless, after 3,000 h of continuous evolution, the
strain could
grow, albeit slowly, with only 4fW added to the growth
media (Fig.
2).
The purity of the commercial 4fW sample was assayed by HPLC, and 0.03%
contaminating tryptophan was found. For this reason,
we never refer to
media as being 100% 4fW; instead, when only
commercially available 4fW
was added to the media, it is referred
to as 99.97% 4fW. It was also
possible that contaminating tryptophan
might have arisen from
defluorination of the original sample,
but MS revealed that no
additional tryptophan accumulated as a
breakdown product following
prolonged (8 days) incubation in media.
Therefore, the final, evolved
strain was capable of growth in
the presence of only 36 ng of
DL-tryptophan/ml, provided that
4fW was also present. For
the sake of comparison, tryptophan was
limiting for growth at
concentrations less than 2 µg/ml for wild-type
C600p (see below and
Fig.
4).
Two clones, B7-3 and B7-4, were isolated from the final population of
cells and were used in further characterizations. As
expected, the
evolved isolates still contained the original plasmid,
were tryptophan
auxotrophs, and could grow on 99.97% 4fW. The
growth rates of the
evolved strains were greater than that of
the parental strain at all
proportions of 4fW (Fig.
3). Moreover,
the evolved clones were more tolerant of other tryptophan analogues,
such as 5fW and 6fW, than the parental strain. However, both evolved
clones still preferred tryptophan for growth and grew as well
as the
parental strain in the presence of tryptophan. In fact,
the growth
rates of evolved and ancestral clones were equally
reliant upon W
concentration (Fig.
4). The lowest levels
of [W]
examined here are slightly greater (20 ng/ml compared with 18
ng/ml) than the residual tryptophan found in 99.97% 4fW, indicating
that there is likely no W production in the evolved cells.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 3.
Effect of various ratios of analogue to natural
tryptophan on the growth of parental and evolved clones. Clone B7-3
( ) and parental C600p ( ) were grown on various ratios of 4fW
(left), 5fW (center), and 6fW (right). Growth rates for clones were
determined by fitting the log portion of growth curves to the following
equation: y = a log x + b, where a was the growth rate (see
Materials and Methods). The evolved clone B7-3 had a growth advantage
for all ratios of 4fW to W, including a ~10-fold increase on 99.97%
4fW.
|
|

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 4.
Effect of tryptophan concentration on growth of
ancestral and evolved clones. Clone B7-4 ( ) and C600p ( ) were
grown on various ratios of W. Growth rates were determined as described
for Fig. 3 (also see Materials and Methods).
|
|
Confirmation of 4fW incorporation.
In order to determine
whether the evolved strain utilized or tolerated 4fW, it was important
to determine whether protein extracted from the wild-type parent and
the evolved variant in fact incorporated 4fW. Because tryptophan is
known to be labile during protein hydrolysis, it was possible that
significant amounts of residual tryptophan might be missed during amino
acid analysis. Indeed, even literature procedures optimized to
quantitate tryptophan content are seldom able to detect better than
95% of total tryptophan. Therefore, we attempted to use less invasive
methods to determine the extent of 4fW incorporation (9,
34). We reasoned that while genes present during the course of
the selection experiment might have mutated, a newly introduced gene
should accurately reflect the incorporation potential of the evolved
translation apparatus.
The parental strain (C600p) and the evolved strain (B7-3) were
transformed with a plasmid that overexpressed the protein GST.
It had
previously been demonstrated that GST retained function
(and thus could
be readily purified) when 5fW was widely incorporated
in place of
tryptophan (
27), and we anticipated that it might
also
retain function (and thus be amenable to purification) following
4fW
incorporation. After induction in media containing either
tryptophan or
4fW, GST was isolated and HPLC-ESI MS was performed
on samples. Protein
samples from cells of strain B7-3 grown on
W exhibited a mass peak
consistent with full-length GST (27 kDa),
while protein samples from
strain B7-3 grown on 4fW exhibited
a mass shift of 72 Da, the exact
amount predicted by replacement
of the four GST tryptophans with 4fW
(19 Da [F]

1 Da [H] for
each tryptophan replaced);
similar results were observed for MALDI-TOF
(MS). To further assess
whether this mass shift represented the
discrete incorporation of 4fW
residues, isolated proteins were
digested with trypsin and the
fragments were once again run on
an HPLC-ESI MS. Three of the resultant
fragments were expected
to contain the four tryptophan residues.
Although one of the peptides
was too small to be traced by MS (WR), the
two remaining fragments
contained mass shifts that were consistent with
4fW replacement.
For example, the fragment MSPILGYWK from strain B7-3
cells grown
on W was found to have the predicted mass of 1,094.3 Da,
while
the same fragment from strain B7-3 cells grown on 4fW was found
to have the predicted mass of 1,112.3 Da (Fig.
5).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 5.
Incorporation of 4fW by an evolved clone. GST purified
from B7-3 cells grown in the presence of tryptophan was digested with
trypsin, and peptides were separated and analyzed by HPLC-ESI MS. A
major peak eluted at 29 min and had a mass of 1,094.3 Da (top). The
mass of this peak corresponds to that of the predicted tryptic fragment
MISPLGYWK. The peak shifts to a mass of 1,112.3 Da when B7-3 cells are
grown on 99.97% 4fW rather than tryptophan (bottom).
|
|
Using these techniques, the relative degree of 4fW incorporation in
parental and evolved strains could be assessed. When the
wild-type
parent was grown on 95% 4fW, the signature peptides
described above
were found in roughly equal measure (Fig.
6A).
This indicates a roughly 19-fold
discrimination in favor of W
(19:1 in the media versus 1:1 incorporated
in protein). In contrast,
when clone B7-3 was grown on 95 or 99.97%
4fW, the 1,094-Da peak
could not be found in the digest, as shown in
Fig.
6B, indicating
that incorporation of 4fW was complete (at least at
the level
of our analysis; sensitivity to 1%). The other GST peptides
derived
from B7-3 cells grown on 4fW also appeared to contain only
modified
tryptophan.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 6.
Relative incorporation of 4fW by an evolved and
ancestral clone. GST was purified from clones B7-3 and C600p grown on
95% 4fW medium, as described above. HPLC-ESI MS was performed. Traces
for the masses of 1,094 and 1,112 Da are shown. (A) A peptide isolated
from C600p shows a roughly equal proportion of 1,094- and 1,112-Da
peptides at about 6.6 and 7 min. (B) HPLC-ESI MS of a peptide produced
by B7-3 shows an absence of any significant peak at ~6.6 min of a
mass of 1,094 Da.
|
|
These results were confirmed by more-conventional amino acid analyses.
Whole-protein extracts were hydrolyzed in thioglycolic
acid to avoid
extensive tryptophan degradation. When the parental
strain was grown in
95% 4fW, extracted proteins showed from 70
to 80% incorporation of
4fW. These results are consistent with
those reported by Pratt and Ho
(
29), who previously estimated
that no more than about
73% of the tryptophan residues in cellular
proteins could
be replaced with 4fW in an unevolved strain (
29).
In
contrast, when cells of the evolved clone B7-3 were grown on
95 or
99.97% 4fW, no natural tryptophan could be detected in extracted
proteins.
Genetic and biochemical characterizations of evolved
clones.
Given that the evolved strain could grow in the
presence of 99.97% 4fW while the starting strain could not, the
evolved strain had likely accumulated mutations that altered proteins
adversely affected by 4fW incorporation. For example, previous
experiments with proteins involved in lactose utilization revealed that
4fW had deleterious effects on a number of enzyme activities (5, 29). In order to identify what types of mutations contributed to
the ability to grow on 4fW, a number of genes from clones B7-3 and B7-4
were isolated and compared with the same genes from the parental
strain. For the most part, changes were not observed, neither in the
coding regions nor in the regions roughly 100 residues up- and
downstream of the coding regions. Genes that did not encode proteins
(tRNATrp, the pUC18 origin of replication)
contained no mutations. Furthermore, essential enzymes (GAPDH,
-lactamase) and proteins known to rely heavily on tryptophan for
function (single-stranded DNA binding protein) (35)
contained no mutations relative to the parental strain. The
functions of these proteins may very well have been impaired
by fluorotryptophan incorporation, especially given the poor
growth of the evolved strain, but the impairment was not significant
enough that mutational fixation was required in order for growth to occur.
Mutations may also have accumulated in enzymes involved in tryptophan
uptake and incorporation. Several enzymes involved in
tryptophan
metabolism (tryptophanase, tryptophan repressor, and
tryptophan-specific transporter [
mtr]) remained unchanged.
That
tryptophanase was found to be wild type eliminates as a
possibility
the most obvious mechanism by which the evolved strain
might have
developed a means for specifically degrading 4fW. However,
three
proteins that were directly involved in tryptophan
utilization,
tryptophanyl-tRNA synthetase (
trpS),
aromatic amino acid permease
(
aroP), and tyrosine repressor
(
tyrR), were mutated. The synthetase
and
repressor each contained a single mutation (Q109P and
R38Op,
respectively), while the permease contained three
substitutions
(T30S, I47V, V365G). The opal mutation in the
tyrosine repressor
should have led to the production of a
truncated, nonfunctional
protein and thus allowed the overexpression of
the AroP permease
and of other operons in the aromatic amino acid
regulon (
24,
28). Interestingly, wild-type
E. coli cells show a >15-fold
increase of
mtr mRNA under W starvation conditions (
17);
however,
tyrR actually acts to increase expression
levels of
mtr (EcoCyc
website [
http://ecocyc.org]
and reference therein [
30]), so
the level of
mtr mRNA may actually have decreased from this level.
In
fact, this makes sense from a resource allocation point of
view: the
evolved variants should preferentially express
aroP,
where
mutational substitution happened to have been
concentrated.
In order to determine when during the course of the experiment these
mutations may have arisen, genes from intermediary organisms
were also
examined. The Q109P mutation fortuitously introduced
a
BsaHI restriction site into the
trpS gene, and
the presence
or absence of this site was used to determine the
approximate
genesis of the
trpS mutation in evolutionary
history (Fig.
7A).
Similarly, individual
aroP and
tyrR genes were isolated and sequenced
(Fig.
7B). During the first 250 h of evolution, one
aroP mutation
(V365G) arose; this substitution was
apparently sufficient to
allow adaptation to growth on 99% 4fW. The
trpS mutation, the
remaining two
aroP mutations,
and the
tyrR mutation occurred in
succession. Interestingly,
the order of the
aroP mutations was
in rough agreement with
their degree of phylogenetic conservation:
the first substitution
occurred in the most variable residue,
the last in the least variable
residue (
2).

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 7.
Serial introduction of functional mutations. (A)
Evolutionary history of the trpS Q109P substitution. The
Q109P substitution introduces a unique BsaHI site into
the trpS gene. The trpS gene was
amplified from different cultures and partially digested with
BsaHI, and the fragments were separated on a 2% agarose
gel. Lanes 1 and 2, 1-kb ladder and 1-kb standard; lanes 3 and 5 through 9, samples taken from the evolving strain, as indicated in Fig.
7B; lanes 4 and 10, samples taken from a parallel, unsuccessful strain,
C600p-2, at time points identical to those shown in lanes 3 and 9, respectively. (B) Evolutionary history of the strain. The time spent at
each ratio of 4fW to W is shown; time is on a log scale to simplify
presentation. The white inserts represent the cultures in which
individual mutations arose in either trpS or
aroP. The timing of the sweep of the tyrR
opal mutation could not be definitively located, beyond generalizing it
to some time during the seven cultures grown at 99.97% 4fW. Arrows
indicate the points at which samples were taken for trpS
restriction analysis, and numbers refer to the gel lanes in Fig. 7A.
|
|
The mutations were likely necessary for growth in the presence of high
proportions of 4fW. A replicate experiment carried
out in parallel
yielded organisms that could not survive at 4fW
proportions above
99.92% (C600p-2; see Materials and Methods).
As was the case
with the eventually successful strain, an initial
substitution
arose in
aroP at approximately the same time. However,
its
identity was V365A rather than V365G. The failed line never
chanced to
acquire the remaining
trpS (Fig.
7A),
aroP, and
tyrR mutations, perhaps because the initial adaptive mutant
did not
adequately predispose the organism to selection pressure that
would have favored further 4fW
utilization.
However, it was unclear whether the mutations were, on their own,
sufficient for growth in the presence of high proportions
of 4fW.
Wild-type and mutant
trpS and
aroP genes were
introduced
into the parental C600p tryptophan auxotroph via a
low-copy-number
vector. A clone bearing the mutant
aroP and
trpS genes showed
an improved ability to grow at all
proportions of 4fW (Fig.
8).
While the
merodiploidy of these clones (which had genomic copies
of the wild-type
genes, but plasmid-borne wild-type or mutant
genes) may obscure the
full effects of the mutant genes, the effect
of growth on 4fW is
striking, and it clearly demonstrates that
these genes provide a growth
advantage in the presence of the
analogue. More remarkably, the clone
bearing mutant
aroP and
trpS genes showed a
generally improved ability to grow on the tryptophan
analogue 6fW.
However, the mutant genes proved to be a hindrance
to growth at higher
proportions of 5fW. It is interesting that
this analogue
preference (4fW > 6fW > 5fW) is similar to that
seen
with
Bacillus subtilis tryptophanyl-tRNA synthetase, which
has been shown to incorporate tryptophan analogues, albeit 6-
to
70-fold slower than it incorporates tryptophan (
38). These
results also coincide with those of Liu and Schultz (
23),
who
were able to substitute multiple, different amino acid analogues
into a protein via a single mutant synthetase.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 8.
Mutant trpS and aroP genes
provide a growth advantage on tryptophan analogues to parental C600p.
Parental C600p was transformed with plasmids pAPwWSw ( ) and pAPmWSm
( ), bearing wild-type and mutant trpS and
aroP genes, respectively. Clones were grown on 4fW
(left), 5fW (center), and 6fW (right), and growth rates were determined
as described for Fig. 3 and in Materials and Methods.
|
|
Nonetheless, while the mutant genes were necessary for growth in the
presence of high proportions of 4fW, they were not sufficient.
Just as
the parental strain could not initially grow on 99.97%
4fW, when the
cultures used to generate the data in Fig.
8 were
diluted into fresh
99.97% 4fW media, no further growth was observed.
The mutant genes may
make growth on 4fW possible, but additional,
as-yet-unidentified,
adaptive mutations spread throughout the
genome of the evolved strain
are almost certainly required. These
results underscore the idea that
drastic evolutionary changes
such as the large-scale introduction of
unnatural amino acids
may require the evolution of an entire organism,
rather than the
targeted engineering of only one or a few specific
genes.
The changes in tryptophan utilization could have been due to the
evolved permease, the evolved synthetase, or other mutant
enzymes not
yet identified. In particular, we suspected that tryptophanyl-tRNA
synthetase might be involved in discrimination against
fluorotryptophan.
The structure of a highly homologous
tryptophanyl-tRNA synthetase
(from
Bacillus
stearothermophilus) has been solved (
10). In
this
enzyme, a glutamine equivalent to Q109 lies near the end
of an

-helical domain and reaches down into the Trp-AMP binding
pocket. At its closest approach, the
B. stearothermophilus
glutamine
is only 3.8 Å from the Trp-AMP complex (Fig.
9A). Thus, it seemed
reasonable to assume
that the Q109P mutation may have altered
the specificity for
tryptophan. To assess this hypothesis, wild-type
and mutant
tryptophanyl-tRNA synthetases were overexpressed and
purified, and the
charging of radiolabeled tryptophan was monitored
as a function of
fluorotryptophan concentration (Fig.
9B). These
data can be most
readily analyzed using the following equation:
Vmax,W =
kcat,W [W]/[W] +
Km,W (1 + [4fW]/
Km,4fW).
This is the standard rate
equation for an enzyme that can utilize
one of two different
substrates. Fitting of the equation by nonlinear
regression allowed the
assessment of relative kinetic values (Table
2). As can be seen, this equation readily
fits the data we have
obtained (
r2 = 0.998 and 0.931 for the wild type and mutant, respectively).
These data
show that, relative to that of the wild type,
kcat,W/
Km,W of the mutant TrpRS increased roughly twofold, while the
Km for
4fW increased fourfold. This
indicates both improved turnover
for W and increased discrimination
against 4fW by the mutant enzyme.
To further assess whether the evolved
synthetase could more quickly
incorporate tryptophan and/or analogues
into the proteome, we
carried out an additional experiment in which
3H-labeled tryptophan and
14C-labeled threonine were both added to the
media, and the relative
3H-to-
14C ratios were
determined for both wild-type and evolved strains.
As can be seen in
Fig.
10, the evolved strains do indeed
have a
much greater ability to incorporate tryptophan. Indeed, since
there is only a twofold increase in
kcat/
Km
for W for the mutant
synthetase, the overall threefold increase in
W/T (the absolute
number of femtomoles of W and picomoles of T)
for the derived
strain could be the result of an altered or more highly
expressed
amino acid permease.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 9.
Effects of the Q109P mutation on the TrpRS.
(A) Ribbon model of tryptophanyl-tRNA synthetase of B.
stearothermophilus. Glutamine 107 (corresponding to Q109 of
E. coli) (blue) is less than 4 Å (white line) from
the Trp-AMP complex (W in green with position 4 in red; AMP in
yellow) (10). Q107 (109) is in an -helical domain near
the tRNA docking region. (B) Competition charging assay. Protein was
added to a charging assay solution (32) containing
constant concentrations of radiolabeled W and competing,
unlabeled 4fW. "Relative charging" for wild-type ( ) and mutant
( ) proteins is the following ratio:
([3H]W/32P-tRNA)4fW/([3H]W/32P-tRNA)No 4fW.
In other words, the charging of tryptophan at a given
concentration of 4fW normalized to the charging of tryptophan in
the absence of 4fW. Error bars represent the standard deviation of
triplicate experiments. Data were fit to the equation used to
calculate Vmax,W (see Results and
Discussion) by nonlinear regression.
|
|

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 10.
Relative incorporation of tryptophan by ancestral and
evolved clones. Cultures of C600p and B7-4 were grown in M9B1L plus Ap
plus limiting concentrations of [3H]W and
[14C]T. After a short pulse, cellular protein was
isolated and counted. Error bars represent the standard deviation of
triplicate readings.
|
|
The
tyrR mutation is likely to also be significant. This
repressor is responsible for the expression of genes in the aromatic
amino acid regulon, several of which are involved in the biosynthesis
of chorismate, the precursor of tyrosine, pheylalanine, and W.
Specifically, 3-deoxy-
D-arabino-heptulosonate-7-phosphate
(DAHP)
synthases (
aroF and
aroG, isoenzymes
which are repressed by Tyr
and Phe, respectively) as well as shikimate
kinase II (
aroL) are
now derepressed in the
tyrR mutant (information found at the EcoCyc
website [
http: //ecocyc.org] and references therein [
4,
7,
8]). These are major control points for chorismate
biosynthsis,
the other genes in the pathway being expressed
constitutively.
In addition to the derepression of
aroF and
aroG, expression of
aroH (encoding the
Trp-repressed DAHP synthase) has been shown
to increase as much as
sevenfold under conditions of tryptophan
starvation (
17).
While
aroL mRNA levels are shown to be unaffected
by
conditions of tryptophan starvation (
17), that may not be
true here, owing to the mutant genes being considered. This suggests
that there may now be a relatively large amount of chorismate
in the
cell. Although our data regarding the incorporation of
4fW clearly show
that the majority of 4fW is the major portion
of incorporated
tryptophan, the possibility exists that some of
this excess chorismate
may be converted to tryptophan. This would
supplement the efforts of
the cell to scrounge for extra tryptophan
by its presumptive opening of
the permease with the three mutations
in that gene, as well as the
derepression of
aroP by the
tyrR mutation. It
should be noted that
p-aminobenzoic acid (PABA) is
derived
from chorismate, as is anthranilate, and PABA and anthranilate
are very
similar structurally, differing in the amine that is
in the
para or
ortho position relative to the acetyl
group of
the benzene ring. However, the fact that the evolved strain
maintains
an absolute requirement for tryptophan (Fig.
4) indicates
that
even if there were a mutation in the PABA biosynthetic pathway
(or
any other pathway) which produces anthranilate for the use
in the
tryptophan biosynthetic pathway, this is still not sufficient
for the
cells to completely do without the 4fW supplied to
them.
Conclusion.
We have generated an organism that incorporates
the unnatural amino acid 4fW throughout its proteome, at least
within the limits of our analytical methods (Fig. 5 and 6). This
suggests that the evolved strain could not avoid the
analogue. Furthermore, the evolved strain has a definite growth
advantage on 4fW, as well as other tryptophan analogues (Fig. 3), and
the known mutations also confer a growth advantage when transferred to
ancestral cells (Fig. 8). The evolved strain could not specifically
degrade or defluorinate 4fW, neither via tryptophanase (which was found
to be wild type) nor through some other mechanism. More sensitive analytical techniques suggest that the mutant TrpRS has acquired some
capacity for discrimination between tryptophan and its analogue (Fig.
9B). However, it is clearly not enough of a discriminator to have a
significant level of tryptophan incorporation when the organism is
grown at 99.97% 4fW (Fig. 5). This suggests that the incorporated
level of W may be slightly higher than 0.03%, but not to a detectable
level, such as ~1% by MS or ~12.5% by amino acid analysis.
Similarly, the AroP mutations may be assisting the uptake of W,
possibly even preferentially, but not to a level that significantly
incorporates W into the proteome.
Taken together, these data suggest a model for the metabolic evolution
of the derived strain. First, the evolved strain is
accommodating 4fW,
as opposed to avoiding or eliminating 4fW,
and is clearly not well
adapted to the analogue. In support of
this conclusion, the derived
strain still grows slowly on 99.97%
4fW and enzyme mutations appear to
favor the incorporation of
tryptophan over fluorotryptophan. Second,
there must be relatively
few tryptophans that are still required for
growth. While the
evolved strain scrounges available tryptophan from
the media,
it apparently incorporates fewer than 1 in 100 tryptophans
into
its proteins. This conclusion is consonant with the data of Wong
(
37), from which we infer that a relatively small number
of
mutations were required to alter the amino acid specificity of
B. subtilis. Finally, it is likely that our evolved strain
is
in the process of acquiring such key mutations. While the genes
for
aroP and
trpS variants are necessary for the
accommodation
of 4fW, they are not on their own sufficient to allow the
wild-type
strain to incorporate 4fW at high levels. It is possible that
if additional mutations in the proteome are allowed to accumulate
that
the present strain may yet be taught to favor
4fW.
Directed incorporation of unnatural amino acids in vivo has generally
been restricted to specific sites, such as a single
azaleucine for
leucine substitution in a single protein (
20)
or to a
variety of amino acids at a single position in

-lactamase
(
23). A recent report described a mutant tRNA synthetase
that
allowed the general incorporation of aminobutyrate, reaching 24%
of the cellular protein (
9). However, a
B. subtilis strain
that could incorporate 4fW in preference to
tryptophan has also
been reported (
37), but specific
mutations in the evolved
B. subtilis strain were never
identified, and the mechanisms by which
the unnatural amino acid was
incorporated were not examined. Despite
the lack of characterization on
the molecular level, however,
the apparent ease with which the
selection was carried out suggested
that a very small number of genes
were targeted for mutation under
this selective regime. It is for this
reason that we had assumed
that the mutations found in our evolved
organism would mainly
be in housekeeping genes and genes encoding
proteins with critical
tryptophans.
The alteration of the genetic code may have several benefits, including
using unnatural amino acids to probe structure-function
relationships
or augment the capabilities of enzymes and organisms
(
11,
31). In vitro transcription and translation systems have
typically been used to incorporate unnatural amino acids into
specific
sites in proteins (
16,
25,
26). However, the requirement
for chemical acylation of a 5'-dCA-3' dinucleotide followed by
ligation
to a tRNA limits the in vivo application of these otherwise
effective
techniques. Various in vivo approaches have been attempted.
The most
successful of these thus far has been the engineering
of an orthogonal
tRNA-tRNA synthetase pair. The principle of the
orthogonal pair is that
the tRNA would not be recognized by any
other tRNA synthetase, while
the tRNA synthetase would not recognize
any tRNA other than the
engineered partner. In a first attempt
at this, tRNA was engineered to
be unrecognizable to its cognate
synthetase and variants of the
synthetase were selected to allow
recognition of the mutant tRNA
(
21). However, the tRNA synthetase
pair could not be used
for the directed, in vivo incorporation
of an unnatural amino acid
because the evolved synthetase recognized
both wild-type and mutant
tRNAs. More recently, a tRNA synthetase
pair was imported to
E. coli cells from yeast (
23) and from
Methanococcus jannaschii (
34). The yeast
tRNA synthetase pair
was completely orthogonal: while the charged
tRNA was recognized
by the host translational apparatus, the
foreign tRNA was not
charged by host synthetases and neither were host
tRNAs charged
by the foreign synthetase. Furthermore, the
M. jannaschii tRNA-tRNA
synthetase pair was later
evolved to be fully orthogonal in
E. coli, and it
showed perfect incorporation of
O-methyl-
L-tyrosine
at a stop codon in
dihydrofolate reductase (
33). Finally, a
human
tRNA-
E. coli tRNA synthetase was recently imported into
yeast, the first eukaryotic example of an orthogonal pair
(
19).
However, orthogonal tRNA-tRNA synthetase pairs are
typically engineered
to be extrememly noninvasive: the tRNA in the pair
is most often
a stop codon suppressor. This is an effective technique
for completely
substituting a specific site in a protein of
interest with an
amino acid
analogue.
These findings suggest that it may be possible to direct the
chemistries and biochemistries available to organisms. Since
only
enzymes involved in tryptophan uptake and incorporation have
so far
been found to be mutated, it appears as though the
E. coli proteome may be fairly tolerant of the
fluorine-for-hydrogen substitution.
Similarly, Ibba and Hennecke
have found that the incorporation
of
p-Cl-phenylalanine was at least partially permitted both in
vitro and in vivo by a phenylalanyl-tRNA synthetase with a relaxed
substrate specificity (
14). Furthermore, it was also found
that
a tRNA synthetase with a mutation that restricted editing function
allowed an increased level of incorporation of amino acid analogues
(
9). To the extent that organismal proteomes are
relatively
resilient to chemical modifications, extensive
incorporation of
other unnatural monomers may also be possible through
relatively
simple modifications of the transport and translation
machinery,
similar to those that have already been demonstrated by
Schultz
and coworkers (
21,
22,
33,
34). However,
the post facto
characterizations of our "unColi" indicate that
while organisms
can be adapted to exploit novel chemistries by simply
changing
the enzymes involved in the incorporation of monomers,
survival
and propagation of novel chemistries will likely require the
evolution
of the entire organismal genome. Just as the discovery of
noncanonical
triplet codons in mitochondria suggested that the genetic
code
might not be sacrosanct, the ability to introduce unnatural
amino
acids into organismal proteomes provides experimental validation
that the 20 natural amino acids may not be the only possible
biological
building blocks (
36).
 |
ACKNOWLEDGMENTS |
The NASA Astrobiology Institute was instrumental in initiating
and supporting this research.
Louise Wang assisted in the construction of the vectors pETWSw and
pETWSm. We thank R. Mursinna and S. Martinis of the University of
Houston for assistance with the tRNA charging assays.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: 2500 Speedway
A4800, University of Texas at Austin, Austin, TX 78712. Phone: (512) 232-3424. Fax: (512) 471-7014. E-mail:
andy.ellington{at}mail.utexas.edu.
 |
REFERENCES |
| 1.
|
Altamirano, M. M.,
J. M. Blackburn,
C. Aguayo, and A. R. Fersht.
2000.
Directed evolution of new catalytic activity using the / -barrel scaffold.
Nature
403:617-622[CrossRef][Medline].
|
| 2.
|
Altschul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402[Abstract/Free Full Text].
|
| 3.
|
Ausubel, F. M.
1997.
Short protocols in molecular biology: a compendium of methods from current protocols in molecular biology, 3rd ed.
Wiley, New York, N.Y.
|
| 4.
|
Baseggio, N.,
W. D. Davies, and B. E. Davidson.
1990.
Identification of the promoter, operator, and 5' and 3' ends of the mRNA of the Escherichia coli K-12 gene aroG.
J. Bacteriol.
172:2547-2557[Abstract/Free Full Text].
|
| 5.
|
Browne, D. R.,
G. L. Kenyon, and G. D. Hegeman.
1970.
Incorporation of monoflurotryptophans into protein during the growth of Escherichia coli.
Biochem. Biophys. Res. Commun.
39:13-19[CrossRef][Medline].
|
| 6.
|
Chow, K. C., and J. T. Wong.
1996.
Isolation and characterization of the Bacillus subtilis tryptophanyl-tRNA synthetase gene (trpS) conferring 5-fluorotryptophan resistance and temperature sensitivity.
Biochim. Biophys. Acta
1309:42-46[Medline].
|
| 7.
|
Cobbett, C. S.
1988.
Repression of the aroF promoter by the TyrR repressor in Escherichia coli K-12: role of the 'upstream' operator site.
Mol. Microbiol.
2:377-383[CrossRef][Medline].
|
| 8.
|
DeFeyter, R. C.,
B. E. Davidson, and J. Pittard.
1986.
Nucleotide sequence of the transcription unit containing the aroL and aroM genes from Escherichia coli K-12.
J. Bacteriol.
165:233-239[Abstract/Free Full Text].
|
| 9.
|
Döring, V.,
H. D. Mootz,
L. A. Nangle,
T. L. Hendrickson,
V. de Crécy-Lagard,
P. Schimmel, and P. Marlière.
2001.
Enlarging the amino acid set of Escherichia coli by infiltration of the valine coding pathway.
Science
292:501-504[Abstract/Free Full Text].
|
| 10.
|
Doublié, S.,
G. Bricogne,
C. Gilmore, and C. W. Carter, Jr.
1995.
Tryptophanyl-tRNA synthetase crystal structure reveals an unexpected homology to tyrosyl-tRNA synthetase.
Structure
3:17-31[Medline].
|
| 11.
|
Dougherty, D. A.
2000.
Unnatural amino acids as probes of protein structure and function.
Curr. Opin. Chem. Biol.
4:645-652[CrossRef][Medline].
|
| 12.
|
Guan, K. L., and J. E. Dixon.
1991.
Eukaryotic proteins expressed in Escherichia coli: an improved thrombin cleavage and purification procedure of fusion proteins with glutathione S-transferase.
Anal. Biochem.
192:262-267[CrossRef][Medline].
|
| 13.
|
Hamano-Takaku, F.,
T. Iwama,
S. Saito-Yano,
K. Takaku,
Y. Monden,
M. Kitabatake,
D. Söll, and S. Nishimura.
2000.
A mutant Escherichia coli tyrosyl-tRNA synthetase utilizes the unnatural amino acid azatyrosine more efficiently than tyrosine.
J. Biol. Chem.
275:40324-40328[Abstract/Free Full Text].
|
| 14.
|
Ibba, M., and H. Hennecke.
1995.
Relaxing the substrate specificity of an aminoacyl-tRNA synthetase allows in vitro and in vivo synthesis of proteins containing unnatural amino acids.
FEBS Lett.
364:272-275[CrossRef][Medline].
|
| 15.
|
Jürgens, C.,
A. Strom,
D. Wegener,
S. Hettwer,
M. Wilmanns, and R. Sterner.
2000.
Directed evolution of a ( / )8-barrel enzyme to catalyze related reactions in two different metabolic pathways.
Proc. Natl. Acad. Sci. USA
97:9925-9930[Abstract/Free Full Text].
|
| 16.
|
Kanda, T.,
K. Takai,
T. Hohsaka,
M. Sisido, and H. Takaku.
2000.
Sense codon-dependent introduction of unnatural amino acids into multiple sites of a protein.
Biochem. Biophys. Res. Commun.
270:1136-1139[CrossRef][Medline].
|
| 17.
|
Khodursky, A. B.,
B. J. Peter,
N. R. Cozzarelli,
D. Botstein,
P. O. Brown, and C. Yanofsky.
2000.
DNA microarray analysis of gene expression in response to physiological and genetic changes that affect tryptophan metabolism in Escherichia coli.
Proc. Natl. Acad. Sci. USA
97:12170-12175[Abstract/Free Full Text].
|
| 18.
|
King, P. V., and R. W. Blakesly.
1986.
Optimizing DNA ligations for transformations.
Focus
8:30-32.
|
| 19.
|
Kowal, A. K.,
C. Köhrer, and U. L. RajBhandary.
2001.
Twenty-first aminoacyl-tRNA synthetase-suppressor tRNA pairs for possible use in site-specific incorporation of amino acid analogues into proteins in eukaryotes and in eubacteria.
Proc. Natl. Acad. Sci. USA
98:2268-2273[Abstract/Free Full Text].
|
| 20.
|
Lemeignan, B.,
P. Sonigo, and P. Marlière.
1993.
Phenotypic suppression by incorporation of an alien amino acid.
J. Mol. Biol.
231:161-166[CrossRef][Medline].
|
| 21.
|
Liu, D. R.,
T. J. Magliery,
M. Pastrnak, and P. G. Schultz.
1997.
Engineering a tRNA and aminoacyl-tRNA synthetase for the site-specific incorporation of unnatural amino acids into proteins in vivo.
Proc. Natl. Acad. Sci. USA
94:10092-10097[Abstract/Free Full Text].
|
| 22.
|
Liu, D. R.,
T. J. Magliery, and P. G. Schultz.
1997.
Characterization of an 'orthogonal' suppressor tRNA derived from E. coli tRNA2Gln.
Chem. Biol.
4:685-691[CrossRef][Medline].
|
| 23.
|
Liu, D. R., and P. G. Schultz.
1999.
Progress toward the evolution of an organism with an expanded genetic code.
Proc. Natl. Acad. Sci. USA
96:4780-4785[Abstract/Free Full Text].
|
| 24.
|
Mironov, A. A.,
E. V. Koonin,
M. A. Roytberg, and M. S. Gelfand.
1999.
Computer analysis of transcription regulatory patterns in completely sequenced bacterial genomes.
Nucleic Acids Res.
27:2981-2989[Abstract/Free Full Text].
|
| 25.
|
Noren, C. J.,
S. J. Anthony-Cahill,
M. C. Griffith, and P. G. Schultz.
1989.
A general method for site-specific incorporation of unnatural amino acids into proteins.
Science
244:182-188[Abstract/Free Full Text].
|
| 26.
|
Normanly, J.,
J. M. Masson,
L. G. Kleina,
J. Abelson, and J. H. Miller.
1986.
Construction of two Escherichia coli amber suppressor genes: tRNAPheCUA and tRNACysCUA.
Proc. Natl. Acad. Sci. USA
83:6548-6552[Abstract/Free Full Text].
|
| 27.
|
Parsons, J. F.,
G. Xiao,
G. L. Gilliland, and R. N. Armstrong.
1998.
Enzymes harboring unnatural amino acids: mechanistic and structural analysis of the enhanced catalytic activity of a glutathione transferase containing 5-fluorotryptophan.
Biochemistry
37:6286-6294[CrossRef][Medline].
|
| 28.
|
Pittard, A. J.
1996.
Biosynthesis of the aromatic amino acids, p. 458-484.
In
F. C. Neidhardt, R. I. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, A. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 1. American Society for Microbiology, Washington, D.C.
|
| 29.
|
Pratt, E. A., and C. Ho.
1975.
Incorporation of fluorotryptophans into proteins of Escherichia coli.
Biochemistry
14:3035-3040[CrossRef][Medline].
|
| 30.
|
Sarsero, J. P.,
P. J. Wookey, and A. J. Pittard.
1991.
Regulation of expression of the Escherichia coli K-12 mtr gene by TyrR protein and Trp repressor.
J. Bacteriol.
173:4133-4143[Abstract/Free Full Text].
|
| 31.
|
Schimmel, P., and D. Söll.
1997.
When protein engineering confronts the tRNA world.
Proc. Natl. Acad. Sci. USA
94:10007-10009[Free Full Text].
|
| 32.
|
Sever, S.,
K. Rogers,
M. J. Rogers,
C. Carter, Jr., and D. Söll.
1996.
Escherichia coli tryptophanyl-tRNA synthetase mutants selected for tryptophan auxotrophy implicate the dimer interface in optimizing amino acid binding.
Biochemistry
35:32-40[CrossRef][Medline].
|
| 33.
|
Wang, L.,
A. Brock,
B. Herberich, and P. G. Schultz.
2001.
Expanding the genetic code of Escherichia coli.
Science
292:498-500[Abstract/Free Full Text].
|
| 34.
|
Wang, L.,
T. J. Magliery,
D. R. Liu, and P. G. Schultz.
2000.
A new functional suppressor tRNA/aminoacyl-tRNA synthetase pair for the in vivo incorporation of unnatural amino acids into proteins.
J. Am. Chem. Soc.
122:5010-5011[CrossRef].
|
| 35.
|
Webster, G.,
J. Genschel,
U. Curth,
C. Urbanke,
C. Kang, and R. Hilgenfeld.
1997.
A common core for binding single-stranded DNA: structural comparison of the single-stranded DNA-binding proteins (SSB) from E. coli and human mitochondria.
FEBS Lett.
411:313-316[CrossRef][Medline].
|
| 36.
|
Wong, J. T.
1988.
Evolution of the genetic code.
Microbiol. Sci.
5:174-181[Medline].
|
| 37.
|
Wong, J. T.
1983.
Membership mutation of the genetic code: loss of fitness by tryptophan.
Proc. Natl. Acad. Sci. USA
80:6303-6306[Abstract/Free Full Text].
|
| 38.
|
Xu, Z. J.,
M. L. Love,
L. Y. Ma,
M. Blum,
P. M. Bronskill,
J. Bernstein,
A. A. Grey,
T. Hofmann,
N. Camerman, and J. T. Wong.
1989.
Tryptophanyl-tRNA synthetase from Bacillus subtilis. Characterization and role of hydrophobicity in substrate recognition.
J. Biol. Chem.
264:4304-4311[Abstract/Free Full Text].
|
Journal of Bacteriology, September 2001, p. 5414-5425, Vol. 183, No. 18
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.18.5414-5425.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Bacher, J. M., Waas, W. F., Metzgar, D., de Crecy-Lagard, V., Schimmel, P.
(2007). Genetic Code Ambiguity Confers a Selective Advantage on Acinetobacter baylyi. J. Bacteriol.
189: 6494-6496
[Abstract]
[Full Text]
-
Hughes, R. A., Ellington, A. D.
(2005). Mistakes in translation don't translate into termination. Proc. Natl. Acad. Sci. USA
102: 1273-1274
[Full Text]
-
Bacher, J. M., de Crecy-Lagard, V., Schimmel, P. R.
(2005). Inhibited cell growth and protein functional changes from an editing-defective tRNA synthetase. Proc. Natl. Acad. Sci. USA
102: 1697-1701
[Abstract]
[Full Text]