INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Sodium proton antiporters are ubiquitous membrane proteins found in the cytoplasmic and organelle membranes of cells of many different origins, including plants, animals, and microorganisms. They are involved in cell energetics, playing primary roles in signal transduction and in regulation of intracellular pH, cell Na⁺ content, and cell volume (24, 26).

Escherichia coli has two antiporters, NhaA (11, 17) and NhaB (27), which specifically exchange Na⁺ or Li⁺ for H⁺ (25). nhaA is indispensable for adaptation to high salinity, for resistance to Li⁺ toxicity, and for growth at alkaline pH (in the presence of Na⁺ [23]). nhaB by itself confers a limited sodium tolerance to the cells but becomes essential when the lack of NhaA activity limits growth (28).

The pattern of regulation of nhaA during exponential growth, studied in a strain carrying an nhaA'-'lacZ fusion (16) and in the wild-type strain (10), reflects the importance of nhaA in salt adaptation. This system is specifically induced by intracellular Na⁺, and neither osmolarity nor ionic strength affect nhaA transcription (10). Only one additional regulatory system that is induced specifically by Na⁺ is known but has not been studied intensively yet (20).

The transcription of nhaA, which is positively regulated by NhaR (29), a member of the LysR-OxyR family (7, 14, 30, 34), is specifically induced by intracellular Na⁺. The regulation of nhaA is also affected by H-NS (10), a major DNA binding protein and a global regulator involved in salt stress in bacteria (8, 9, 15, 22, 35). An interplay between NhaR and H-NS in the regulation of nhaA has been suggested. Deleting hns causes derepression of nhaA, and both repression and Na⁺ inducibility are restored upon transformation with plasmidic nhaR (10).

Two promoters, P1 and P2, were previously identified for nhaA. They were located 30 and 172 bp upstream of the initiation codon, respectively (16). DNA gel retardation assay and DNase I footprinting analysis showed that NhaR binds a region of 92 bp located 18 to 119 bp upstream of the nhaA initiation codon (6). Dimethylsulfate methylation protection footprinting both in vivo and in vitro identified four bases in this region which form direct contact with NhaR. Furthermore, two of these bases were located around P1, and their binding to NhaR was found to be affected specifically by Na⁺.

These results suggest that P1 but not P2 is the Na⁺-specific promoter of nhaA and raises the question as to what the role of P2 is. We therefore studied the roles of P1 and P2 in nhaA transcription and found the following. (i) P1 but not P2 is the Na⁺- and NhaR-responsive promoter of nhaA. It is activated by ⁷⁰ and affected by H-NS. It is the major nhaA promoter in the exponential phase of growth but a minor promoter in the stationary phase. (ii) P2 has a very low constitutive activity in exponentially growing bacteria and is not affected by factors which affect P1 (Na⁺, NhaR, and H-NS). (iii) When the bacteria enter the stationary phase, P2 becomes the main promoter for nhaA and is activated by ^S in an Na⁺-independent fashion. (iv) In the stationary phase, P2 is responsible for survival of the cells under the stressful conditions of high Na⁺, alkaline pH, and alkaline pH in the presence of Na⁺, the most stressful combination.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Bacterial strains and culture conditions. The bacterial strains used in this study are the E. coli K-12 derivatives described in Table 1. Cells were grown at 37°C in modified L broth (LBK) in which NaCl was replaced by KCl (87 mM [pH 7.5]). This medium was supplemented with 60 mM BTP {1,3-bis[tris(hydroxymethyl)-methylamino]propane}, and the pH was titrated to 7.5 with HCl. For plates, 1.6% agar was used. Antibiotic concentrations were 100 µg of ampicillin/ml, 50 µg of kanamycin/ml, and 12.5 µg of tetracycline/ml.

Plasmids. All plasmids were derived from pBR322. pKRZ2 is a plasmid bearing an nhaA'-'lacZ fusion containing the upstream regulatory sequence of nhaA (16). pKRZ1 is a derivative of pKRZ2 which contains only P1, the proximal nhaA promoter (16). pGM42 is a derivative of pBR322 bearing nhaA and nhaR (17). pGM42T is a derivative of pGM42 with nhaA inactivated (29). pGM36 is a derivative of pBR322 bearing nhaA (17). To construct pKRZ3, an NgoMI-Kpn2I fragment (2,138 bp) containing nhaR was obtained from pGM42 and ligated with Kpn2I-digested pKRZ2 (7,572-bp fragment). To construct pKRZ3tac, a BamHI-BamHI fragment (280 bp) containing the tac promoter was obtained from pKK223-3 (Pharmacia) and ligated with BglII-digested pKRZ3 (9,954 bp). To construct pKRZ4 and pKRZ1tac, the AatII-AatII fragment (2,076 bp) of pKRZ3 and pKRZ3tac, respectively, was replaced with the AatII-AatII fragment (1,270 bp) of PKRZ1, containing P1 only. To construct pKRZ2*, a plasmid carrying nhaA with a mutation in the 10 box of P1 (Fig. 1C, 10 P1) was mutated by PCR site-directed mutagenesis with the following mutagenic primers: Nir946-973, 5'-TGATTCGTGCGGGGCCCAAGAGTAAAAACGATCT-3'; Nir973-946, 5'-AGATCGTTTTTACTCTTGGGCCCCGCACGAATCA-3'. The mutated bases are underlined. The downstream end primer was P27 (5'-GGGAATAAGGGCGACACGGAAATGTTG-3'), and the upstream end primer was ARP1342 (5'-GCCAGTACACCAAGTGCAAAAGCAATGTCAGTAGCCG-3'). The PCR 1,558-bp fragment carrying the mutation was digested with NheI and BsmI, and the 1,052-bp fragment was ligated with pKRZ2 digested with the same enzymes (6,520-bp fragment).

View larger version (61K): [in this window] [in a new window]   FIG. 1.   P1 is the Na+-sensitive promoter of nhaA. (A) Primer extension assay of nhaA transcription was conducted, as described in Materials and Methods, with total RNA (15 µg) isolated from cells grown exponentially for 2 h in LBK-BTP broth at pH 7.5, either in the presence or absence of 300 mM NaCl for induction. The same primer was used for the sequencing ladder, and the reaction mixtures were run on an 8% DNA sequencing gel. The cells used were TA15 (wild type) grown without addition of sodium (lane 1); TA15, sodium induced (lane 2); W3313-2S (nhaR1) cells grown without sodium (lane 3); RK20 (nhaA), sodium added (lane 4); and OR100 (nhaR), sodium added (lane 5). (B) Primer extension assay conducted as for panel A with RNA isolated from OR200 (nhaA nhaR) transformed with plasmid pGM42 (lane1) or pGM433 (lane 2). (C) Promoter elements of nhaA. Start sites (arrows), 10 and 35 sequences (underlined) are marked on the DNA sequence of nhaA. The putative third promoter elements of nhaA are indicated with question marks. Boxed area, binding site of NhaR (6). Shaded areas, nhaA sequences protected by NhaR from DNase I digestion (6).

RNA isolation. Total RNA was isolated by using the PUREscript RNA Isolation Kit of Gentra Systems, Inc., according to the manufacturer's instructions.

Primer extension. An antisense primer, complementary to the region of DNA 138 to 161 bp downstream of the P1 start site (TCTCCAGAAAGTCGTGATACCATC) was ³²P end labeled with T4 polynucleotide kinase (Amersham Pharmacia). Primer extension was conducted as described in reference 33. The RNA (15 µg of total cell RNA or 7 µl of in vitro-transcribed RNA) was mixed with the radioactively labeled primer (15,000 to 30,000 cpm) in water in a total volume of 9 µl. This mixture was heated at 75°C for 5 min and then cooled on ice for 10 min for annealing. Then, 3 µl of 5× buffer (0.25 M Tris-Cl [pH 8.3], 0.375 M KCl, 15 mM MgCl₂), 1.5 µl of 0.1 M dithiothreitol, 0.5 µl of 25 mM deoxynucleoside triphosphates, and 0.5 µl of water were added and the mixture was warmed to 48°C for 5 min. Reverse transcriptase (0.5 µl of Superscript II [200 U/ml; Gibco]) was added, and the reaction mixture was incubated at 48°C for 60 min, dried, resuspended in 4 µl of formamide dye-1.5 µl of 0.1 M NaOH, heated at 90°C for 3 min, and loaded on an 8% DNA sequencing gel.

RPA. For the RNase protection assay (RPA), the Ambion RPA II kit was used according to the instructions of the manufacturer. The cRNA probe was transcribed in vitro with the Riboprobe System kit (Promega). In order to create the template DNA, pROB was cut with Bsu36I and PvuII and the 596-bp fragment was purified. In vitro transcription from this fragment using T3 RNA polymerase (Promega) yielded, as expected, 394-base radiolabeled cRNA probe.

Na^+.induction of nhaA transcription and nhaA'-'lacZ expression. An overnight culture was grown in LBK-BTP broth (pH 7.5) for 16 to 20 h. For stationary-phase induction, the overnight culture was divided in two and incubation was continued for 2 h in the presence (induced) or absence (control) of 300 mM NaCl. For exponential-phase induction the overnight culture was diluted 1:300 and grown up to an optical density at 300 nm of 0.1 to 0.2. The culture was divided in two, and incubation was continued for 2 h in the presence (induced) or absence (control) of 300 mM NaCl. These conditions were found to cause maximal induction of nhaA transcription in the wild-type strain (10). At the end of each experiment total RNA was isolated. For nhaA'-'lacZ expression the procedure was done as above but the cells, containing the chromosomal nhaA'-'lacZ or transformed with various plasmids harboring nhaA'-'lacZ, were induced with 100 mM NaCl for 1 h. These conditions were found to cause maximal induction in the chromosomal fusion strain (RK33Z, NhaA phenotype). -Galactosidase activity was determined as previously described (16).

In vitro transcription. For the protein-DNA binding reaction, 100 ng of supercoiled pGM42 plasmid and the indicated proteins were mixed in 50 ml of reaction buffer (40 mM Tris [pH 7.9], 100 mM KCl, 10 mM MgCl₂, 1 mM dithiothreitol, 5% [vol/vol] glycerol, 0.1% [vol/vol] Nonidet P-40) and incubated for 20 min at room temperature. Then, 1 U of E. coli ⁷⁰-RNA polymerase holoenzyme (Boehringer) was added and the reaction mixture was incubated for 10 min at 37°C. For the transcription reaction, 3.5 µl of a mixture of the four nucleoside triphosphates (2.5 mM each) and 40 U of RNase inhibitor (RNasin; Promega) were added and the reaction mixture was incubated for 30 min at 37°C. The reaction was terminated by incubation with 5 U of RQ1 DNase (Promega) for 10 min, the mixture was extracted twice with phenol-chloroform-isoamylalcohol (25:24:1) and once with chloroform and ethanol precipitated, and the precipitate was resuspended in 15 µl of double-distilled water (DDW). Purified H-NS was kindly provided by C. F. Higgins (Oxford, United Kingdom), and His-tagged NhaR was purified as previously described (6).

Nucleotide sequence accession numbers. The nhaA and nhaR sequence data have been submitted to the GenBank database under accession numbers J03879 and L24072, respectively.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Analysis of nhaA transcripts by primer extension. Primer extension was used to analyze transcription from each promoter (P1 or P2) of nhaA. The reaction was conducted with total RNA isolated from wild-type (TA15) cells grown exponentially for 2 h at pH 7.5 in the absence (Fig. 1A, lane 1) or presence (Fig. 1A, lane 2) of 300 mM NaCl. For a negative control both a nhaA strain (RK20, Fig. 1A, lane 4) and a nhaR strain (OR100, Fig. 1A, lane 5) were used, and for a positive control a strain overexpressing nhaA (W3313-2S [29], Fig. 1A, lane 3) was used. In samples derived from all reaction mixtures expressing nhaA, two major bands representing Na⁺-induced transcripts were observed (Fig. 1A, lanes 1 to 3 and Fig. 6A, lanes a and b). The most prominent band corresponds to a previously observed transcript (16; Fig. 1C) of a size expected for a start site of P1. A second band, less intense than that of P1 and not observed before, appeared 8 bases below P1. This short band still appeared when another primer was used for primer extension (data not shown).

P1 is the Na⁺-sensitive promoter. While the activity of P1 was increased at least three- to fivefold after Na⁺ induction (compare lanes 1 and 2 of Fig. 1A), P2 activity was not increased by the ion (compare lanes a and b of Fig. 6). These results strongly suggest that P1 is the Na⁺-inducible promoter of nhaA.

View larger version (32K): [in this window] [in a new window]   FIG. 2.   Na+ induction of plasmidic nhaA'-'lacZ fusion. (A) nhaA nhaR cells (OR200) transformed with the indicated plasmids were used. All plasmids carried an nhaA'-'lacZ fusion but differ in either the level of the encoded NhaR (, none; +, moderate expression; ++, strong expression) and/or the nhaA promoters as indicated. Cells were grown exponentially for 1 h in LBK-BTP broth at pH 7.5 in the presence or absence of 100 mM NaCl. Expression was monitored as -galactosidase activity in Miller units as described previously (16). (B) The plasmids and experimental procedure were as for panel A, but the host was OR200D1, a nhaA nhaR hns strain. The data from one representative experiment of five very similar independent repetitions are shown.

13

12

11

8

13

12

11

8

hns derepression is mediated by P1. We have previously reported that the expression of an nhaA'-'lacZ chromosomal fusion is derepressed in strains bearing hns mutations and that the degree of hns derepression is a function of the level of NhaR (10). NhaR in an hns⁺ strain is an Na⁺-dependent positive regulator, but in an hns mutant strain it (in multicopy) acts as a repressor which restores Na⁺ induction.

View larger version (44K): [in this window] [in a new window]   FIG. 3.   P1, the Na+-sensitive promoter of nhaA is NhaR dependent and affected by H-NS. Cell growth and primer extension assays were conducted as described in the legend to Fig. 1. The relevant genotype and the NaCl concentrations are indicated.

Analysis of nhaA transcription in vitro In vitro transcription was conducted with a supercoiled plasmid (pGM42) carrying nhaA and its regulatory sequences and the purified transcripts were analyzed by primer extension (Fig. 4). In a system containing both ⁷⁰-RNA polymerase holoenzyme and purified NhaR two prominent transcripts were formed. As in the in vivo primer extension study, a major transcript corresponding to the P1 promoter identified in vivo (Fig. 1A, lanes 1 to 3; Fig. 6A, lanes a and b) was observed (Fig. 4A, compare lanes a and b). However, note that the shorter transcript, which accompanies the P1 transcript in the in vivo primer extension studies (Fig. 1A, lanes 1 to 3; Fig. 6A, lanes a and b), did not form in the in vitro transcription system (Fig. 4A, lane b). The other transcript, which corresponds to P2, although less pronounced, was also identified in the in vitro system. When only RNA polymerase was added without NhaR the two transcripts were still detected but the transcription was much less specific and many additional bands appeared (Fig. 4B, lane a). As indicated above and in reference 10 we have previously shown that in vivo in an H-NS⁺ background NhaR acts as a positive regulator but in an H-NS background it acts as a repressor. In the in vitro system only positive regulation by NhaR was detected. Thus, when only H-NS was added in addition to RNA polymerase the overall transcription was reduced (Fig. 4B, lane c). Remarkably, the combination of H-NS, NhaR, and RNA polymerase gave the most specific transcription, with only one major band corresponding to P1 (Fig. 4B, lane d). These results indicate that transcription from P1 occurs via ⁷⁰ and is positively regulated by NhaR in a fashion that is modulated by the level of H-NS. Addition of Na⁺ (up to 100 mM) did not have any consistent effect on the in vitro transcription (data not shown).

View larger version (56K): [in this window] [in a new window]   FIG. 4.   In vitro transcription of nhaA. The reactions were preformed using pGM42 (0.1 µg) as a template and E. coli 70-RNA polymerase holoenzyme (1 U) alone or in the presence of either purified NhaR (6), H-NS, or both. Equal aliquots were removed and used as templates for a primer extension assay as for Fig. 1. (A) Comparison between in vivo (wild-type) and in vitro transcription. (B) In vitro transcription in the absence or presence of His-tagged NhaR (400 ng), H-NS (40 ng), or both as indicated.

P2 is induced in stationary phase. It is well established that while entering stationary phase, bacteria become more resistant to various stress conditions (18) including high levels of Na⁺ (13). We therefore studied the pattern of nhaA transcription in stationary phase. A comparison of the -galactosidase activities of the nhaA'-'lacZ chromosomal fusion strain (RK33Z) and its nhaR derivative (NDZ1) during exponential and stationary phases is shown in Fig. 5. As shown before (10), during exponential growth the -galactosidase activity of RK33Z was low in the absence of added Na⁺ and was induced by the addition of the ion and no Na⁺ induction was observed in the nhaR strain NDZ1. In the stationary phase, RK33Z bacteria showed an increase in the basal level (without addition of Na⁺) relative to the exponentially growing bacteria but this increased activity was not Na⁺ induced (Fig. 5). Surprisingly, in contrast to the very low basal level of -galactosidase activity in the nhaR strain observed during exponential growth, a dramatic increase was observed in the stationary phase. The maximal level of activity reached by the nhaR strain in stationary phase was even higher than the maximal Na⁺-induced level reached by RK33Z in the exponential culture (Fig. 5). These results demonstrate that the pattern of regulation of nhaA expression in stationary phase differs from that in exponential phase; this pattern is dependent neither on Na⁺ nor on nhaR.

View larger version (55K): [in this window] [in a new window]   FIG. 5.   Expression of nhaA is dependent on growth phase. The cells, harboring the nhaA'-'lacZ fusion on the chromosome in a wild-type (RK33Z) or nhaR (NDZ1) background, were grown and Na+ induced for 1 h as described in Materials and Methods. The nhaA'-'lacZ expression of the exponential and stationary-phase cultures was monitored as -galactosidase activity in Miller units as described in the legend to Fig. 2. The data from one representative experiment of five very similar independent repetitions are shown.

View larger version (76K): [in this window] [in a new window]   FIG. 6.   P2 is a stationary phase-induced RpoS-dependent promoter of nhaA, as evidenced by primer extension study. Cells were grown and Na+ induced in the exponential phase (expo) or stationary phase (stat) as described in Materials and Methods. RNA was isolated after 2 h of induction. Primer extension assay was conducted as described for Fig. 1. The relevant genotypes and NaCl concentrations are indicated. For the upper portion in panel A the gel was exposed 10-fold longer than the lower panel.

P2 stationary-phase induction is dependent on RpoS (^S). Since it is now well established that the ^S subunit of RNA polymerase is a global regulator of many stationary-phase-inducible genes in E. coli (13), the possible involvement of ^S in the transcription of nhaA was tested. A TA15 rpoS mutant strain was constructed (Table 1), total RNA was isolated from exponential and stationary phases of Na⁺-induced and uninduced cultures, and primer extension analysis was conducted (Fig. 6A, lanes c, d, g, and h). rpoS had no effect on Na⁺-dependent transcription from P1 either in the exponential-phase (Fig. 6A, compare lanes c and d to a and b) or in the stationary-phase rpoS mutant cultures (Fig. 6A, compare lanes e and f to g and h). These results indicate that ^S does not seem to have any significant effect on the P1 promoter. rpoS also had no effect on the very low Na⁺-independent P2 transcription in the exponential phase (Fig. 6A, compare lanes c and d to a and b). On the other hand, in the stationary culture the strong P2-dependent transcription completely disappeared in the rpoS mutant strain (Fig. 6A, compare lanes e and f to g and h). These results show that ^S is involved in the transcription from the P2 promoter of nhaA only in the stationary phase.

View larger version (45K): [in this window] [in a new window]   FIG. 7.   P2 is an RpoS-dependent promoter of nhaA, as evidenced by plasmidic nhaA'-'lacZ fusion. Cells were grown to the stationary phase and treated as in Fig. 2. The plasmids, bearing the nhaA'-'lacZ fusion, differ in nhaA promoters as indicated. The host was OR200 (nhaA nhaR) or OR200 rpoS as indicated. Expression was monitored as -galactosidase activity in Miller units. The data from one representative experiment of five very similar independent repetitions are shown.

NhaR is not involved in ^S-dependent transcription of nhaA. To study the involvement of NhaR in the stationary-phase transcription of nhaA, total RNA was isolated from exponential and stationary phases of Na⁺-induced and uninduced cultures of OR100, a nhaR strain, and of the OR100 rpoS strain and primer extension was conducted. Figure 6B shows that while nhaR totally eliminated P1 Na⁺ induction in both growth phases (compare lanes a, b, e, and f in Fig. 6A to those of Fig. 6B), it did not affect exponential-phase P2 transcription (compare lanes a and b in Fig. 6A to those in Fig. 6B) or the stationary-phase P2 transcription in the absence of Na⁺ addition (compare lane e in Fig. 5A to lane e Fig. 6B). In the presence of Na⁺, albeit somewhat reduced, there was still significant stationary-phase induction in the nhaR strain (compare lane f in Fig. 6A to lane f in Fig. 6B). Taken together these results show that, in contrast to Na⁺ induction of P1, which is mediated by NhaR, stationary-phase induction of P2 is not dependent on NhaR.

H-NS is not involved in ^S-dependent transcription of nhaA. Since it was demonstrated that H-NS is an inhibitory component of the ^S stationary-phase induction network and also inhibits the expression of ^S itself (3) and since we now know that ^S also takes part in nhaA regulation, we examined the possible involvement of H-NS in rpoS-dependent stationary-phase induction of nhaA. Transcription from the nhaA promoters in various hns mutant strains (hns [TA15D2], hns rpoS [TA15D2 rpoS], and hns nhaR [OR100D2]) in the presence or absence of Na⁺ induction and either during the exponential or stationary phase of growth was determined. hns had no effect on the pattern of expression from P2 either in the exponential or stationary phase of growth (data not shown).

Physiological role of P2. Stationary-phase, ^S-dependent transcription via P2 revealed in this study raised the question as to the physiological significance of P2. To answer this question, we constructed a plasmid, pGM36*, which carries nhaA mutated in P1 but containing P2. As shown above, the same mutation in plasmid pKRZ3* totally inhibited induction of nhaA'-'lacZ in the logarithmic phase (Fig. 2) but did not affect the stationary-phase induction (Fig. 7). pGM36* was transformed into OR200, a strain devoid of nhaA and nhaR. OR200/pBR322 and OR200/pGM42 (wild-type nhaA) served as negative and positive controls, respectively. These strains were grown overnight to stationary phase in LBK, at which time they attained an OD at 600 nm of 3 to 4 and the medium pH was 8. Then the cells were exposed to various stress conditions with respect to salt and pH and the survival of the cells was determined (Table 2). It is apparent that an alkaline shift to pH 9.5 for 3 h reduced the survival of the cells lacking nhaA (OR200/pBR322) to 0.13%. The pH stress was drastically increased in the presence of increasing Na⁺ concentration. The survival was 0.014, 5 × 10⁵, or 0% when the shift to pH 9.5 was conducted in the presence of 200, 400, or 600 mM NaCl, respectively. To assess whether the effect is specific to Na⁺, the pH shift was conducted in the presence of 400 mM KCl rather than NaCl. Table 2 shows that the stress effect of 400 mM Na⁺ was 1,300-fold stronger than that of 400 mM KCl.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Using a chromosomal nhaA'-'lacZ fusion, we have previously shown that Na⁺ induction of nhaA is dependent on NhaR (29). Study of the NhaR-nhaA interaction with purified components identified the long binding site for NhaR on nhaA and showed that Na⁺ modifies the binding site (6). Hence, most puzzling were the findings that only P1 of the two promoters (P1 and P2) of nhaA (16) maps within the binding site for NhaR on nhaA (6). Therefore, in the present work two complementary approaches were undertaken to establish which is the Na⁺-dependent promoter of nhaA: (i) a study of the effect of Na⁺ on in vivo transcription of nhaA both by primer extension and RPA; (ii) mutagenic inactivation of each of the nhaA promoters to identify the role of each promoter in Na⁺ induction. The results show that in exponentially growing cells P1 is both the dominant promoter and the one which is NhaR dependent and Na⁺ induced.

The appearance of a third nhaA transcript 8 bp downstream of P1 (Fig. 1A) was a surprise, since for unknown reasons it was not detected before (16). We first considered it to reflect a secondary structure in the P1 transcript causing an interruption of the primer extension reaction. This was based on the observations that similar to the P1 transcript the short transcript is sodium induced (Fig. 1A), NhaR dependent (Fig. 1A), and derepressed in the hns mutant strain (Fig. 3). In addition, when the mutation deleting the 10 box of P1 was introduced, neither transcript could observed (data not shown). However, conducting the primer extension reaction at a high temperature (51°C) that is supposed to melt secondary structures of RNA had no effect on the results (data not shown). Furthermore, 8 bp downstream of the 10 box (TAAAAT) of the P1 promoter exists a DNA sequence which can be a 10 box (TAAAAA) of another promoter (Fig. 1C). These observations suggested that nhaA may have a second Na⁺-induced promoter. However, mutagenesis of this putative promoter within its putative 10 box eliminated the short transcript but caused only a slight shortening of the P1 transcript, an effect easily ascribed to the location of the mutation relative to P1 (Fig. 1B and C). Accordingly, this mutation only slightly reduced the Na⁺-induced level of the plasmidic nhaA'-'lacZ (data not shown).

The in vitro transcription study with the ⁷⁰-RNA polymerase holoenzyme (Fig. 4) clearly shows that the P1 promoter of nhaA operates with ⁷⁰. Most interestingly, the shortest transcript accompanying P1 transcription did not appear in the in vitro assay (Fig. 4A). These results suggest that a factor(s) and/or process occurring in vivo, such as RNA processing, may be responsible for the production of the short transcript. A factor(s) missing in the in vitro assay most probably also accounts for the lack of Na⁺ inducibility in the in vitro system.

As for many environment-responsive genes (2), nhaA transcription is derepressed in a hns mutant strain (10). In the case of nhaA this derepression is a function of the level of NhaR (10; this study). Most importantly, the present work shows that transcription from P1 but not P2 is affected by H-NS in an NhaR- and Na⁺-independent fashion (Fig. 3). The interplay between H-NS and NhaR in P1 transcription was further demonstrated in the in vitro transcription conducted with the purified components nhaA ⁷⁰-RNA polymerase, H-NS, and NhaR (Fig. 4B). In the assay containing only the RNA polymerase, the major transcript was from P1 but many other transcripts including one corresponding to that of P2 appeared. Addition of NhaR increased transcription from P1 and reduced that from P2 and nonspecific transcription. H-NS further increased the specificity to P1, but the most pronounced specific transcription from P1 was obtained by adding both H-NS and NhaR.

It is now well established that many genes that confer resistance to various stresses are induced at the stationary phase of E. coli (18). This stationary-phase induction involves a complex regulatory network controlled by the product of rpoS, the ^S subunit of RNA polymerase (13, 19). ^S also acts as a global regulator in various stress responses in the exponential phase. This includes the osmotic control of gene expression (13). Na⁺ stress cannot be separated from osmotic stress, yet our results show that in the exponential phase nhaA does not belong to the ^S osmotically regulated genes. In the exponential phase of growth, P2-mediated transcription was very low and constitutive (Fig. 1A and Fig. 2A, pKRZ3*) but was twofold above the background level observed when both P1 and P2 were inactivated by mutations (data not shown). However, 300 mM Na⁺ had no effect on the activity of P2. Furthermore, the activity of P2 remains very low in the exponential phase even in an hns mutant background, which is supposed to increase the level of RpoS (13). Therefore, the present work shows that the response of nhaA to Na⁺ stress in the exponential phase involves only the Na⁺-specific NhaR-dependent response via P1.

Interestingly, markedly reduced transcription of nhaA from the P1 promoter, which is dependent on NhaR and Na⁺ but not on rpoS, occurs in the stationary phase (Fig. 6A). The reduction in P1 transcription can be ascribed to a general reduction in transcription and mRNA content characteristic of the stationary phase (21).

We have previously shown that the level of expression of nhaA'-'lacZ is maintained in an Na⁺-independent fashion in stationary phase (10). However, for unknown reasons we could not show an effect of rpoS on this expression. The present work revealed that the P2 promoter of nhaA is a stationary phase-induced promoter which is activated by ^S and neither NhaR nor Na⁺ or H-NS is involved in this induction; in the stationary phase, transcription from P2 increased dramatically, and this increase was eliminated in an rpoS mutant strain (Fig. 6A) but not in a nhaR strain (Fig. 6B). Mutation inactivation of P1 had no effect on the stationary-phase induction of the plasmidic nhaA'-'lacZ, and this induction was totally abolished in an rpoS mutant strain (Fig. 7). hns had an insignificant effect on the stationary-phase induction of P2.

Note that the P2 transcript in stationary phase is weaker than that of P1 in the presence of Na⁺ in the logarithmic phase (Fig. 6A, lanes b, e, and f); however, the -galactosidase activity originating from P2 is equal to the activity of the P1 promoter when it is fully induced by Na⁺ (Fig. 7). This suggests that there might be posttranslational control; the two RNAs may differ in their secondary structure, lifetime, or processing mechanism and may have different translation abilities.

It should also be pointed out that in the stationary phase in the absence of NhaR, a new rpoS-dependent transcript (shorter than that observed in the presence of NhaR) appeared (Fig. 6, lanes e and f). A perfect Pribnow box located 46 bp upstream of P1 and within the binding site of NhaR might be responsible for this new start site (Fig. 1C).

Bimodal control mechanisms, similar to the one described above for nhaA, were found in other environment-responsive genes. For example, the proU operon is transcribed from two promoters. As for nhaA, one promoter is stationary phase induced and ^S-dependent while the other is ⁷⁰ dependent. In contrast to nhaA, both proU promoters are induced by the operon's specific inducer (osmotic shock) and no specific trans-acting regulator was found (12). Like proU, the osmC gene is transcribed from two promoters (osmC_p1 and osmC_p2), but only osmC_p2 is stationary phase induced and ^S dependent (4). A control mechanism, even more similar to that for nhaA, was described for the ftsQAZ gene cluster (31). In this system, one promoter is controlled by the specific activator SdiA, while the other promoter is stationary phase induced and ^S dependent but not SdiA dependent.

The dps gene, which is transcribed from a single promoter, is controlled by OxyR, which similar to NhaR, is a member of the LysR-OxyR family of positive activators. Interestingly, dps is controlled by OxyR and is ⁷⁰ dependent only during the exponential phase, while it becomes ^S dependent and OxyR independent in the stationary phase (1). These findings show that the same promoter can be recognized by more than one sigma factor. Indeed, according to our results the nhaA P2 promoter is transcribed by ⁷⁰-RNA polymerase during the exponential phase but it becomes totally dependent on ^S in the stationary phase (Fig. 6A).

Studying the effect of pH and Na⁺ on logarithmic-phase cells, we have previously shown that in addition to osmotic stress Na⁺ exerts a specific toxic effect on cells that is markedly increased with pH (24). This stressful combination of Na⁺ and alkaline pH was also documented with stationary-phase cells (32). We have also shown that the NhaA-Na⁺/H⁺ antiporter is essential for the adaptation of logarithmic-phase cells to the specific stress of Na⁺ and alkaline pH in the presence of Na⁺ (23). Most importantly, we show here that in the stationary phase nhaA via its P2 promoter becomes rpoS dependent and increases dramatically the survival of stationary cells in the presence of Na⁺, alkaline pH, and alkaline pH in the presence of Na⁺ (Table 2). It is suggested that this property of NhaA is of paramount importance for the survival of E. coli in its natural habitats such as the sea or the pylorus, where the combination of alkaline pH and sodium prevails.