Previous Article | Next Article ![]()
Journal of Bacteriology, January 2001, p. 644-653, Vol. 183, No. 2
Division of Microbial and Molecular Ecology,
Institute of Life Sciences, The Hebrew University of Jerusalem,
91904 Jerusalem, Israel
Received 7 August 2000/Accepted 19 October 2000
The transcription of nhaA, encoding the main
Na+/H+ antiporter of Escherichia
coli, is induced by Na+, regulated by NhaR, and
affected by H-NS. In this work the roles of the two nhaA
promoters (P1 and P2) were studied by analysis of transcription both in
vivo and in vitro and promoter mutations. We found that P1 is an
NhaR-dependent, Na+-induced, and H-NS-affected promoter
both in the exponential and stationary phases. An in vitro
transcription assay demonstrated that P1 is activated by
Sodium proton antiporters are
ubiquitous membrane proteins found in the cytoplasmic and organelle
membranes of cells of many different origins, including plants,
animals, and microorganisms. They are involved in cell energetics,
playing primary roles in signal transduction and in regulation of
intracellular pH, cell Na+ content, and cell
volume (24, 26).
Escherichia coli has two antiporters, NhaA (11,
17) and NhaB (27), which specifically exchange
Na+ or Li+ for
H+ (25). nhaA is
indispensable for adaptation to high salinity, for resistance to
Li+ toxicity, and for growth at alkaline pH (in
the presence of Na+ [23]).
nhaB by itself confers a limited sodium tolerance to the
cells but becomes essential when the lack of NhaA activity limits
growth (28).
The pattern of regulation of nhaA during exponential growth,
studied in a strain carrying an
nhaA'-'lacZ fusion (16) and in the wild-type strain (10), reflects the importance of
nhaA in salt adaptation. This system is specifically induced
by intracellular Na+, and neither osmolarity nor
ionic strength affect nhaA transcription (10).
Only one additional regulatory system that is induced specifically by
Na+ is known but has not been studied intensively
yet (20).
The transcription of nhaA, which is positively regulated by
NhaR (29), a member of the LysR-OxyR family (7, 14,
30, 34), is specifically induced by intracellular
Na+. The regulation of nhaA is also
affected by H-NS (10), a major DNA binding protein and a
global regulator involved in salt stress in bacteria (8, 9, 15,
22, 35). An interplay between NhaR and H-NS in the regulation of
nhaA has been suggested. Deleting hns causes
derepression of nhaA, and both repression and
Na+ inducibility are restored upon transformation
with plasmidic nhaR (10).
Two promoters, P1 and P2, were previously identified for
nhaA. They were located 30 and 172 bp upstream of the
initiation codon, respectively (16). DNA gel retardation
assay and DNase I footprinting analysis showed that NhaR binds a region
of 92 bp located 18 to 119 bp upstream of the nhaA
initiation codon (6). Dimethylsulfate methylation
protection footprinting both in vivo and in vitro identified four bases
in this region which form direct contact with NhaR. Furthermore, two of
these bases were located around P1, and their binding to NhaR was found
to be affected specifically by Na+.
These results suggest that P1 but not P2 is the
Na+-specific promoter of nhaA and
raises the question as to what the role of P2 is. We therefore studied
the roles of P1 and P2 in nhaA transcription and found the
following. (i) P1 but not P2 is the Na+- and
NhaR-responsive promoter of nhaA. It is activated by
Bacterial strains and culture conditions.
The bacterial
strains used in this study are the E. coli K-12 derivatives
described in Table 1. Cells were grown at
37°C in modified L broth (LBK) in which NaCl was replaced by KCl (87 mM [pH 7.5]). This medium was supplemented with 60 mM BTP
{1,3-bis[tris(hydroxymethyl)-methylamino]propane}, and the pH
was titrated to 7.5 with HCl. For plates, 1.6% agar was used.
Antibiotic concentrations were 100 µg of ampicillin/ml, 50 µg of
kanamycin/ml, and 12.5 µg of tetracycline/ml.
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.2.644-653.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Transcription of nhaA, the Main
Na+/H+ Antiporter of Escherichia
coli, Is Regulated by Na+ and Growth
Phase
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
70-RNA polymerase and both NhaR and H-NS increase the
specificity of P1. Remarkably, in marked contrast to P1, P2 exhibits
very low activity during the exponential phase but is induced in the stationary phase to become the major promoter. Furthermore, P2 is
activated by
S and is neither induced by Na+
nor dependent on NhaR or affected by H-NS. Hence, this work establishes that nhaA has a dual mode of regulation, each involving
a different promoter, and reveals that P2 and
S together
are responsible for the survival of stationary-phase cells in the
presence of high Na+, alkaline pH, and the combination of
high Na+ and alkaline pH, the most stressful condition.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
70 and affected by H-NS. It is the major
nhaA promoter in the exponential phase of growth but a minor
promoter in the stationary phase. (ii) P2 has a very low constitutive
activity in exponentially growing bacteria and is not affected by
factors which affect P1 (Na+, NhaR, and H-NS).
(iii) When the bacteria enter the stationary phase, P2 becomes the main
promoter for nhaA and is activated by
S in an Na+-independent
fashion. (iv) In the stationary phase, P2 is responsible for survival
of the cells under the stressful conditions of high Na+, alkaline pH, and alkaline pH in the presence
of Na+, the most stressful combination.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Characteristics of bacterial strains used in
this study
Plasmids.
All plasmids were derived from pBR322.
pKRZ2 is a plasmid bearing an nhaA'-'lacZ fusion
containing the upstream regulatory sequence of nhaA
(16). pKRZ1 is a derivative of pKRZ2 which contains only
P1, the proximal nhaA promoter (16). pGM42 is a
derivative of pBR322 bearing nhaA and nhaR
(17). pGM42T is a derivative of pGM42 with nhaA
inactivated (29). pGM36 is a derivative of pBR322 bearing
nhaA (17). To construct pKRZ3, an
NgoMI-Kpn2I fragment (2,138 bp) containing
nhaR was obtained from pGM42 and ligated with
Kpn2I-digested pKRZ2 (7,572-bp fragment). To construct
pKRZ3tac, a BamHI-BamHI fragment (280 bp) containing the tac promoter was obtained from pKK223-3
(Pharmacia) and ligated with BglII-digested pKRZ3 (9,954 bp). To construct pKRZ4 and pKRZ1tac, the
AatII-AatII fragment (2,076 bp) of pKRZ3 and
pKRZ3tac, respectively, was replaced with the
AatII-AatII fragment (1,270 bp) of PKRZ1, containing P1 only. To construct pKRZ2*, a plasmid carrying
nhaA with a mutation in the
10 box of P1 (Fig.
1C,
10 P1) was mutated by PCR
site-directed mutagenesis with the following mutagenic primers: Nir946-973,
5'-TGATTCGTGCGGGGCCCAAGAGTAAAAACGATCT-3'; Nir973-946,
5'-AGATCGTTTTTACTCTTGGGCCCCGCACGAATCA-3'.
The mutated bases are underlined. The downstream end primer was
P27 (5'-GGGAATAAGGGCGACACGGAAATGTTG-3'), and the upstream
end primer was ARP1342
(5'-GCCAGTACACCAAGTGCAAAAGCAATGTCAGTAGCCG-3'). The PCR
1,558-bp fragment carrying the mutation was digested with NheI and BsmI, and the 1,052-bp fragment
was ligated with pKRZ2 digested with the same enzymes (6,520-bp
fragment).
|
10 box of the putative third promoter (Fig. 1C,
10?) was mutated by PCR site-directed mutagenesis with the following
mutagenic primers: PETI1,
5'-GCGGGGTAAAATAGGACCAACGATCTATTCACC-3'; PETI2,
5'-GGTGAATAGATCGTTGGTCCTATTTTACCCCGC-3'.
The mutated bases are underlined. The downstream end primer was P27 and
the upstream end primer was ARP1342 (see sequences above). The PCR
1,558-bp fragment carrying the mutation was digested with
NheI and BsmI, and the 1,052-bp fragment was
ligated with pKRZ3 digested with the same enzymes (8,902-bp fragment).
To construct pGM433, the NheI-BsmI fragment
(7,757 bp) obtained from pGM42 was ligated with the
NheI-BsmI (1,052 bp) fragment obtained from
pKRZ33. To construct pROB, fragment PflMI-PflMI (1,970 bp) obtained
from pGM42, containing the upstream region of
nhaA, was ligated with EcoRV-digested
pBluescript KS+ (Stratagene) in the direction allowing transcription of
a cRNA of nhaA from the T3 promoter. To construct pGM36*,
the NheI-BsmI fragment (1,052 bp) obtained from
pKRZ2*, containing the P1 mutation, was ligated with the
NheI-BsmI fragment (4,696 bp) obtained from pGM36.
RNA isolation. Total RNA was isolated by using the PUREscript RNA Isolation Kit of Gentra Systems, Inc., according to the manufacturer's instructions.
Primer extension. An antisense primer, complementary to the region of DNA 138 to 161 bp downstream of the P1 start site (TCTCCAGAAAGTCGTGATACCATC) was 32P end labeled with T4 polynucleotide kinase (Amersham Pharmacia). Primer extension was conducted as described in reference 33. The RNA (15 µg of total cell RNA or 7 µl of in vitro-transcribed RNA) was mixed with the radioactively labeled primer (15,000 to 30,000 cpm) in water in a total volume of 9 µl. This mixture was heated at 75°C for 5 min and then cooled on ice for 10 min for annealing. Then, 3 µl of 5× buffer (0.25 M Tris-Cl [pH 8.3], 0.375 M KCl, 15 mM MgCl2), 1.5 µl of 0.1 M dithiothreitol, 0.5 µl of 25 mM deoxynucleoside triphosphates, and 0.5 µl of water were added and the mixture was warmed to 48°C for 5 min. Reverse transcriptase (0.5 µl of Superscript II [200 U/ml; Gibco]) was added, and the reaction mixture was incubated at 48°C for 60 min, dried, resuspended in 4 µl of formamide dye-1.5 µl of 0.1 M NaOH, heated at 90°C for 3 min, and loaded on an 8% DNA sequencing gel.
RPA. For the RNase protection assay (RPA), the Ambion RPA II kit was used according to the instructions of the manufacturer. The cRNA probe was transcribed in vitro with the Riboprobe System kit (Promega). In order to create the template DNA, pROB was cut with Bsu36I and PvuII and the 596-bp fragment was purified. In vitro transcription from this fragment using T3 RNA polymerase (Promega) yielded, as expected, 394-base radiolabeled cRNA probe.
Na+.induction of nhaA transcription
and nhaA'-'lacZ expression.
An
overnight culture was grown in LBK-BTP broth (pH 7.5) for 16 to
20 h. For stationary-phase induction, the overnight culture was
divided in two and incubation was continued for 2 h in the presence (induced) or absence (control) of 300 mM NaCl. For
exponential-phase induction the overnight culture was diluted 1:300 and
grown up to an optical density at 300 nm of 0.1 to 0.2. The culture was divided in two, and incubation was continued for 2 h in the
presence (induced) or absence (control) of 300 mM NaCl. These
conditions were found to cause maximal induction of nhaA
transcription in the wild-type strain (10). At the end of
each experiment total RNA was isolated. For
nhaA'-'lacZ expression the procedure was done as
above but the cells, containing the chromosomal
nhaA'-'lacZ or transformed with various plasmids
harboring nhaA'-'lacZ, were induced with 100 mM
NaCl for 1 h. These conditions were found to cause maximal
induction in the chromosomal fusion strain (RK33Z, NhaA
phenotype).
-Galactosidase activity was
determined as previously described (16).
In vitro transcription.
For the protein-DNA binding
reaction, 100 ng of supercoiled pGM42 plasmid and the indicated
proteins were mixed in 50 ml of reaction buffer (40 mM Tris [pH 7.9],
100 mM KCl, 10 mM MgCl2, 1 mM dithiothreitol, 5%
[vol/vol] glycerol, 0.1% [vol/vol] Nonidet P-40) and incubated for
20 min at room temperature. Then, 1 U of E. coli
70-RNA polymerase holoenzyme (Boehringer) was
added and the reaction mixture was incubated for 10 min at 37°C. For
the transcription reaction, 3.5 µl of a mixture of the four
nucleoside triphosphates (2.5 mM each) and 40 U of RNase inhibitor
(RNasin; Promega) were added and the reaction mixture was incubated for
30 min at 37°C. The reaction was terminated by incubation with 5 U of
RQ1 DNase (Promega) for 10 min, the mixture was extracted twice with
phenol-chloroform-isoamylalcohol (25:24:1) and once with chloroform and
ethanol precipitated, and the precipitate was resuspended in 15 µl of
double-distilled water (DDW). Purified H-NS was kindly provided
by C. F. Higgins (Oxford, United Kingdom), and His-tagged NhaR was
purified as previously described (6).
Nucleotide sequence accession numbers. The nhaA and nhaR sequence data have been submitted to the GenBank database under accession numbers J03879 and L24072, respectively.
| |
RESULTS |
|---|
|
|
|---|
Analysis of nhaA transcripts by primer
extension.
Primer extension was used to analyze transcription from
each promoter (P1 or P2) of nhaA. The reaction was conducted
with total RNA isolated from wild-type (TA15) cells grown exponentially for 2 h at pH 7.5 in the absence (Fig. 1A, lane 1) or presence (Fig. 1A, lane 2) of 300 mM NaCl. For a negative control both a
nhaA strain (RK20, Fig. 1A, lane 4) and a
nhaR strain (OR100, Fig. 1A, lane 5) were used, and for a
positive control a strain overexpressing nhaA (W3313-2S
[29], Fig. 1A, lane 3) was used. In samples derived from
all reaction mixtures expressing nhaA, two major bands
representing Na+-induced transcripts were
observed (Fig. 1A, lanes 1 to 3 and Fig. 6A, lanes a and b). The most
prominent band corresponds to a previously observed transcript
(16; Fig. 1C) of a size expected for a start site of P1. A
second band, less intense than that of P1 and not observed before,
appeared 8 bases below P1. This short band still appeared when another
primer was used for primer extension (data not shown).
P1 is the Na+-sensitive promoter. While the activity of P1 was increased at least three- to fivefold after Na+ induction (compare lanes 1 and 2 of Fig. 1A), P2 activity was not increased by the ion (compare lanes a and b of Fig. 6). These results strongly suggest that P1 is the Na+-inducible promoter of nhaA.
To further study the role of nhaA promoters in the Na+ induction of nhaA, it was important to mutagenize each of the promoters and study the effects of the mutations on Na+-dependent transcription. For this purpose, we have constructed two multicopy isogenic plasmids each carrying both nhaA'-'lacZ and nhaR, either with its native promoter (pKRZ3) or fused to the strong tac promoter (pKRZ3tac). Western blot analysis indicated that NhaR is expressed from pKRZ3 and overexpressed from pKRZ3tac (data not shown). The plasmids were transformed into OR200, a
nhaA
nhaR
double mutant, and the
-galactosidase activity of the exponentially
growing cultures was monitored under various growth conditions (Fig.
2A). As shown previously with a
single-copy chromosomal nhaR (TA15/pKRZ2 [16]),
Na+ did not induce the plasmidic
nhaA'-'lacZ when no nhaR was present on the plasmid (Fig. 2A, pKRZ2). In marked contrast, plasmidic fusion in the presence of plasmidic nhaR (multicopy or both
multicopy and strongly overexpressed) showed Na+
induction of the fusion (Fig. 2A, pKRZ3 and pKRZ3tac,
respectively). The plasmidic induction ratio (the level of
-galactosidase activity observed in the presence of
Na+ divided by that obtained in the absence of
the ion) of 3 to 10 was very similar to the chromosomal induction ratio
(16). These results confirmed the previous suggestion that
the lack of Na+ induction of
nhaA'-'lacZ on pKRZ2 was due to the very low
concentration of NhaR in cells that contain a single chromosomal copy
of nhaR (5); the low level of NhaR was readily
titrated by binding to the regulatory sequences of nhaA when
introduced into the cells on a multicopy plasmid like pKRZ2. Hence the
new plasmidic system has become suitable to apply a genetic approach to
study Na+-dependent expression of
nhaA.
|
13,
A
12, A
11, and
T
8 with C
13,
C
12, C
11, and
G
8 at the
10 sequence of P1 (Fig. 1C) was
then introduced into pKRZ3 to obtain pKRZ3*. Na+
inducibility and most of the
-galactosidase activity were lost by
this mutation in P1 (Fig. 2A). Similar results were obtained when the
mutation was introduced into pKRZ2 and pKRZ3tac (data not
shown). Taken together these results indicate that in exponentially growing cells, P1 is the only NhaR-dependent and
Na+-specific promoter of nhaA and P2
is responsible for a very low constitutive level of nhaA
expression (Fig. 2A, pKRZ3*). Indeed, when both P1 and P2 promoters
were inactivated, the level of
-galactosidase activity was further
decreased (twofold) to the background level (data not shown).
In line with this conclusion, only the P1 activity was increased in
W3313-2S, a strain that was shown to overexpress nhaA because of a point mutation in nhaR causing a change in the
Na+ affinity of NhaR (5) (Fig. 1A,
lane 3).
It is possible that the short transcript accompanying
Na+ induction of P1 represents a second
Na+-dependent promoter of nhaA. In
line with this suggestion, at the
10 and
35 positions of the
putative start site of the short transcript, a sequence resembling a
promoter can be found (Fig. 1C,
35? and
10?). We therefore
introduced a mutation at this
10 sequence of pGM42 or pKRZ3 and
obtained plasmid pGM433 or pKRZ33, respectively. The mutation had no
effect on the expression of nhaA whether tested by primer
extension analysis with RNA isolated from OR200/pGM433 (compare lanes 1 and 2 of Fig. 1B) or by the Na+-induced
expression of the reporter gene in OR200/pKRZ33, which showed
Na+ induction very similar to that of pKRZ3 (data
not shown).
hns derepression is mediated by P1. We have previously reported that the expression of an nhaA'-'lacZ chromosomal fusion is derepressed in strains bearing hns mutations and that the degree of hns derepression is a function of the level of NhaR (10). NhaR in an hns+ strain is an Na+-dependent positive regulator, but in an hns mutant strain it (in multicopy) acts as a repressor which restores Na+ induction.
Since we now have a series of plasmids carrying nhaA'-'lacZ with different levels of expression of nhaR (pKRZ2, no nhaR; pKRZ3, multicopy nhaR; pKRZ3tac, overexpressed multicopy nhaR), we tested the expression of the plasmidic nhaA'-'lacZ fusion in an hns mutant strain with different amounts of NhaR. Figure 2B shows that, as shown before for the chromosomal fusion (10), the expression of the plasmidic nhaA'-'lacZ fusion is derepressed in an Na+-independent fashion in the hns mutant strain when no NhaR is present in the cells (pKRZ2). While the addition of nhaR to the plasmid (pKRZ3) increases the expression and the Na+ induction in the hns+ strain, it results in a decrease in the overall expression from the hns mutant strain but also restores part of the induction. This effect was more pronounced when nhaR was placed under the strong tac promoter (pKRZ3tac). The repressing capacity of NhaR can be seen, even in the hns+ strain, by manipulating its expression level (Fig. 2A); while increasing nhaR expression in a moderate way increases nhaA expression and Na+ induction (pKRZ3), a strong overexpression of nhaR results in a decrease in the extent of nhaA expression accompanied by a further increase in the induction ratio (pKRZ3tac). Figure 2B also clearly shows that both the hns derepression (pKRZ1) and the nhaR repression and Na+ induction (pKRZ4 and pKRZ1tac) of nhaA in an hns mutant strain are mediated by P1. When P1 is destroyed (pKRZ3*) there is no effect of H-NS on nhaA expression. We also used primer extension to confirm that P1 is the promoter involved in hns derepression of nhaA during exponential growth (Fig. 3). Thus, whereas nhaA transcription from P2 remains very low, transcription from P1 is derepressed in an hns mutant strain (compare lanes a and b of Fig. 3). While in hns+ strains P1 transcription is dependent on nhaR (compare lanes a and f of Fig. 3) and Na+ (compare lanes a and c of Fig. 3), in an hns mutant strain it is nhaR independent (Fig. 3, lane g) and Na+ is not required (compare lanes a and b of Fig. 3). The hns derepression is increased in the
nhaR background (compare lanes b and g
of Fig. 3). Taken together these results confirm that an interplay exists between NhaR and H-NS in the regulation of nhaA
expression mediated by the P1 promoter.
|
Analysis of nhaA transcription in
vitro
In vitro transcription was conducted with a
supercoiled plasmid (pGM42) carrying nhaA and its
regulatory sequences and the purified transcripts were analyzed by
primer extension (Fig. 4). In a system
containing both
70-RNA polymerase holoenzyme and
purified NhaR two prominent transcripts were formed. As in the in vivo
primer extension study, a major transcript corresponding to the P1
promoter identified in vivo (Fig. 1A, lanes 1 to 3; Fig. 6A, lanes a
and b) was observed (Fig. 4A, compare lanes a and b). However, note
that the shorter transcript, which accompanies the P1 transcript in the
in vivo primer extension studies (Fig. 1A, lanes 1 to 3; Fig. 6A, lanes
a and b), did not form in the in vitro transcription system (Fig. 4A,
lane b). The other transcript, which corresponds to P2, although less
pronounced, was also identified in the in vitro system. When only RNA
polymerase was added without NhaR the two transcripts were still
detected but the transcription was much less specific and many
additional bands appeared (Fig. 4B, lane a). As indicated above and in
reference 10 we have previously shown that in vivo in an
H-NS+ background NhaR acts as a positive regulator but in
an H-NS
background it acts as a repressor. In the in
vitro system only positive regulation by NhaR was detected. Thus, when
only H-NS was added in addition to RNA polymerase the overall
transcription was reduced (Fig. 4B, lane c). Remarkably, the
combination of H-NS, NhaR, and RNA polymerase gave the most specific
transcription, with only one major band corresponding to P1 (Fig. 4B,
lane d). These results indicate that transcription from P1 occurs
via
70 and is positively regulated by NhaR in a
fashion that is modulated by the level of H-NS. Addition of
Na+ (up to 100 mM) did not have any consistent effect on
the in vitro transcription (data not shown).
|
P2 is induced in stationary phase.
It is well established that
while entering stationary phase, bacteria become more resistant to
various stress conditions (18) including high levels of
Na+ (13). We therefore studied the
pattern of nhaA transcription in stationary phase. A
comparison of the
-galactosidase activities of the
nhaA'-'lacZ chromosomal fusion strain
(RK33Z) and its
nhaR derivative (NDZ1) during exponential
and stationary phases is shown in Fig. 5.
As shown before (10), during exponential growth the
-galactosidase activity of RK33Z was low in the absence of added
Na+ and was induced by the addition of the ion
and no Na+ induction was observed in the
nhaR strain NDZ1. In the stationary phase, RK33Z bacteria
showed an increase in the basal level (without addition of
Na+) relative to the exponentially growing
bacteria but this increased activity was not Na+
induced (Fig. 5). Surprisingly, in contrast to the very low basal level
of
-galactosidase activity in the
nhaR strain observed during exponential growth, a dramatic increase was observed in the
stationary phase. The maximal level of activity reached by the
nhaR strain in stationary phase was even higher than the maximal Na+-induced level reached by RK33Z in the
exponential culture (Fig. 5). These results demonstrate that the
pattern of regulation of nhaA expression in stationary phase
differs from that in exponential phase; this pattern is dependent
neither on Na+ nor on nhaR.
|
|
P2 stationary-phase induction is dependent on RpoS
(
S).
Since it is now well established that the
S subunit of RNA polymerase is a global
regulator of many stationary-phase-inducible genes in E. coli (13), the possible involvement of
S in the transcription of nhaA was
tested. A TA15 rpoS mutant strain was
constructed (Table 1), total RNA was isolated from exponential and
stationary phases of Na+-induced and uninduced
cultures, and primer extension analysis was conducted (Fig. 6A, lanes
c, d, g, and h). rpoS had no effect on
Na+-dependent transcription from P1 either in the
exponential-phase (Fig. 6A, compare lanes c and d to a and b) or in the
stationary-phase rpoS mutant cultures (Fig. 6A, compare
lanes e and f to g and h). These results indicate that
S does not seem to have any significant effect
on the P1 promoter. rpoS also had no effect on the very low
Na+-independent P2 transcription in the
exponential phase (Fig. 6A, compare lanes c and d to a and b). On the
other hand, in the stationary culture the strong P2-dependent
transcription completely disappeared in the rpoS
mutant strain (Fig. 6A, compare lanes e and f to
g and h). These results show that
S is
involved in the transcription from the P2 promoter of nhaA only in the stationary phase.
|
NhaR is not involved in
S-dependent transcription of
nhaA.
To study the involvement of NhaR in the
stationary-phase transcription of nhaA, total RNA was
isolated from exponential and stationary phases of
Na+-induced and uninduced cultures of OR100, a
nhaR strain, and of the OR100 rpoS
strain and primer extension was conducted. Figure 6B shows that
while
nhaR totally eliminated P1
Na+ induction in both growth phases (compare
lanes a, b, e, and f in Fig. 6A to those of Fig. 6B), it did not affect
exponential-phase P2 transcription (compare lanes a and b in Fig. 6A to
those in Fig. 6B) or the stationary-phase P2 transcription in the
absence of Na+ addition (compare lane e in Fig.
5A to lane e Fig. 6B). In the presence of
Na+, albeit somewhat reduced, there was still
significant stationary-phase induction in the
nhaR strain
(compare lane f in Fig. 6A to lane f in Fig. 6B). Taken together
these results show that, in contrast to Na+
induction of P1, which is mediated by NhaR, stationary-phase induction
of P2 is not dependent on NhaR.
nhaR bacteria grown to the stationary phase (Fig. 6B, lanes e and f). This
extra band, reflecting P2 activity, is
S dependent (compare lanes e and f to g and h
in Fig. 6B). This transcript could have been produced by cleavage of
the P2 transcript. However, we cannot exclude the possibility that it
represents another start site of transcription which appears only in
the
nhaR strain in stationary phase.
H-NS is not involved in
S-dependent transcription of
nhaA.
Since it was demonstrated that H-NS is an
inhibitory component of the
S stationary-phase
induction network and also inhibits the expression of
S itself (3) and since we now
know that
S also takes part in nhaA
regulation, we examined the possible involvement of H-NS in
rpoS-dependent stationary-phase induction of
nhaA. Transcription from the nhaA promoters in
various hns mutant strains (hns
[TA15D2], hns
rpoS [TA15D2
rpoS], and hns
nhaR
[OR100D2]) in the presence or absence of Na+
induction and either during the exponential or stationary phase of
growth was determined. hns had no effect on the pattern of expression from P2 either in the exponential or stationary phase of
growth (data not shown).
Physiological role of P2.
Stationary-phase,
S-dependent transcription via P2 revealed in
this study raised the question as to the physiological significance of
P2. To answer this question, we constructed a plasmid, pGM36*, which
carries nhaA mutated in P1 but containing P2. As
shown above, the same mutation in plasmid pKRZ3* totally inhibited
induction of nhaA'-'lacZ in the logarithmic phase
(Fig. 2) but did not affect the stationary-phase induction (Fig. 7).
pGM36* was transformed into OR200, a strain devoid of nhaA
and nhaR. OR200/pBR322 and OR200/pGM42 (wild-type
nhaA) served as negative and positive controls, respectively. These strains were grown overnight to stationary phase in
LBK, at which time they attained an OD at 600 nm of 3 to 4 and the
medium pH was 8. Then the cells were exposed to various stress
conditions with respect to salt and pH and the survival of the cells
was determined (Table 2). It is apparent
that an alkaline shift to pH 9.5 for 3 h reduced the survival of
the cells lacking nhaA (OR200/pBR322) to 0.13%. The pH
stress was drastically increased in the presence of increasing
Na+ concentration. The survival was 0.014, 5 × 10
5, or 0% when the shift to pH 9.5 was
conducted in the presence of 200, 400, or 600 mM NaCl, respectively. To
assess whether the effect is specific to Na+, the
pH shift was conducted in the presence of 400 mM KCl rather than NaCl.
Table 2 shows that the stress effect of 400 mM
Na+ was 1,300-fold stronger than that of 400 mM
KCl.
|
| |
DISCUSSION |
|---|
|
|
|---|
Using a chromosomal nhaA'-'lacZ fusion, we have previously shown that Na+ induction of nhaA is dependent on NhaR (29). Study of the NhaR-nhaA interaction with purified components identified the long binding site for NhaR on nhaA and showed that Na+ modifies the binding site (6). Hence, most puzzling were the findings that only P1 of the two promoters (P1 and P2) of nhaA (16) maps within the binding site for NhaR on nhaA (6). Therefore, in the present work two complementary approaches were undertaken to establish which is the Na+-dependent promoter of nhaA: (i) a study of the effect of Na+ on in vivo transcription of nhaA both by primer extension and RPA; (ii) mutagenic inactivation of each of the nhaA promoters to identify the role of each promoter in Na+ induction. The results show that in exponentially growing cells P1 is both the dominant promoter and the one which is NhaR dependent and Na+ induced.
The appearance of a third nhaA transcript 8 bp downstream of
P1 (Fig. 1A) was a surprise, since for unknown reasons it was not
detected before (16). We first considered it to reflect a
secondary structure in the P1 transcript causing an interruption of the
primer extension reaction. This was based on the observations that
similar to the P1 transcript the short transcript is sodium induced
(Fig. 1A), NhaR dependent (Fig. 1A), and derepressed in the hns
mutant strain (Fig. 3). In addition, when the
mutation deleting the
10 box of P1 was introduced, neither transcript could observed (data not shown). However, conducting the primer extension reaction at a high temperature (51°C) that is supposed to
melt secondary structures of RNA had no effect on the results (data not
shown). Furthermore, 8 bp downstream of the
10 box (TAAAAT) of the P1
promoter exists a DNA sequence which can be a
10 box (TAAAAA) of
another promoter (Fig. 1C). These observations suggested that
nhaA may have a second Na+-induced
promoter. However, mutagenesis of this putative promoter within its
putative
10 box eliminated the short transcript but caused only a
slight shortening of the P1 transcript, an effect easily ascribed to
the location of the mutation relative to P1 (Fig. 1B and C).
Accordingly, this mutation only slightly reduced the
Na+-induced level of the plasmidic
nhaA'-'lacZ (data not shown).
The in vitro transcription study with the
70-RNA polymerase holoenzyme (Fig. 4) clearly
shows that the P1 promoter of nhaA operates with
70. Most interestingly, the shortest
transcript accompanying P1 transcription did not appear in the in vitro
assay (Fig. 4A). These results suggest that a factor(s) and/or process
occurring in vivo, such as RNA processing, may be responsible for the
production of the short transcript. A factor(s) missing in the in vitro
assay most probably also accounts for the lack of
Na+ inducibility in the in vitro system.
As for many environment-responsive genes (2),
nhaA transcription is derepressed in a hns
mutant strain (10). In the case of
nhaA this derepression is a function of the level of NhaR
(10; this study). Most importantly, the present work shows
that transcription from P1 but not P2 is affected by H-NS in an NhaR-
and Na+-independent fashion (Fig. 3). The
interplay between H-NS and NhaR in P1 transcription was further
demonstrated in the in vitro transcription conducted with the purified
components nhaA
70-RNA polymerase,
H-NS, and NhaR (Fig. 4B). In the assay containing only the RNA
polymerase, the major transcript was from P1 but many other transcripts
including one corresponding to that of P2 appeared. Addition of NhaR
increased transcription from P1 and reduced that from P2 and
nonspecific transcription. H-NS further increased the specificity to
P1, but the most pronounced specific transcription from P1 was obtained
by adding both H-NS and NhaR.
It is now well established that many genes that confer resistance to
various stresses are induced at the stationary phase of E. coli (18). This stationary-phase induction involves a complex regulatory network controlled by the product of
rpoS, the
S subunit of RNA
polymerase (13, 19).
S also acts
as a global regulator in various stress responses in the exponential
phase. This includes the osmotic control of gene expression
(13). Na+ stress cannot be separated
from osmotic stress, yet our results show that in the exponential phase
nhaA does not belong to the
S
osmotically regulated genes. In the exponential phase of growth, P2-mediated transcription was very low and constitutive (Fig. 1A and
Fig. 2A, pKRZ3*) but was twofold above the background level observed
when both P1 and P2 were inactivated by mutations (data not shown).
However, 300 mM Na+ had no effect on the activity
of P2. Furthermore, the activity of P2 remains very low in the
exponential phase even in an hns mutant
background, which is supposed to increase the level of RpoS
(13). Therefore, the present work shows that the response of nhaA to Na+ stress in the
exponential phase involves only the Na+-specific
NhaR-dependent response via P1.
Interestingly, markedly reduced transcription of nhaA from the P1 promoter, which is dependent on NhaR and Na+ but not on rpoS, occurs in the stationary phase (Fig. 6A). The reduction in P1 transcription can be ascribed to a general reduction in transcription and mRNA content characteristic of the stationary phase (21).
We have previously shown that the level of expression of
nhaA'-'lacZ is maintained in an
Na+-independent fashion in stationary phase
(10). However, for unknown reasons we could not show an
effect of rpoS on this expression. The present work revealed
that the P2 promoter of nhaA is a stationary phase-induced
promoter which is activated by
S and neither
NhaR nor Na+ or H-NS is involved in this
induction; in the stationary phase, transcription from P2 increased
dramatically, and this increase was eliminated in an rpoS
mutant strain (Fig. 6A) but not in a
nhaR strain (Fig. 6B). Mutation inactivation of P1 had no
effect on the stationary-phase induction of the plasmidic
nhaA'-'lacZ, and this induction was totally
abolished in an rpoS mutant strain (Fig.
7). hns had an insignificant effect on the
stationary-phase induction of P2.
Note that the P2 transcript in stationary phase is weaker than that of
P1 in the presence of Na+ in the logarithmic
phase (Fig. 6A, lanes b, e, and f); however, the
-galactosidase
activity originating from P2 is equal to the activity of the P1
promoter when it is fully induced by Na+ (Fig.
7). This suggests that there might be posttranslational control; the
two RNAs may differ in their secondary structure, lifetime, or
processing mechanism and may have different translation abilities.
It should also be pointed out that in the stationary phase in the absence of NhaR, a new rpoS-dependent transcript (shorter than that observed in the presence of NhaR) appeared (Fig. 6, lanes e and f). A perfect Pribnow box located 46 bp upstream of P1 and within the binding site of NhaR might be responsible for this new start site (Fig. 1C).
Bimodal control mechanisms, similar to the one described above for
nhaA, were found in other environment-responsive genes. For
example, the proU operon is transcribed from two promoters. As for nhaA, one promoter is stationary phase induced and
S-dependent while the other is
70 dependent. In contrast to nhaA,
both proU promoters are induced by the operon's specific
inducer (osmotic shock) and no specific trans-acting
regulator was found (12). Like proU, the
osmC gene is transcribed from two promoters
(osmCp1 and
osmCp2), but only osmCp2 is stationary phase induced and
S dependent (4). A control
mechanism, even more similar to that for nhaA, was described
for the ftsQAZ gene cluster (31). In this
system, one promoter is controlled by the specific activator SdiA,
while the other promoter is stationary phase induced and
S dependent but not SdiA dependent.
The dps gene, which is transcribed from a single promoter,
is controlled by OxyR, which similar to NhaR, is a member of the LysR-OxyR family of positive activators. Interestingly, dps
is controlled by OxyR and is
70 dependent only
during the exponential phase, while it becomes
S dependent and OxyR independent in the
stationary phase (1). These findings show that the same
promoter can be recognized by more than one sigma factor. Indeed,
according to our results the nhaA P2 promoter is transcribed
by
70-RNA polymerase during the exponential
phase but it becomes totally dependent on
S in
the stationary phase (Fig. 6A).
Studying the effect of pH and Na+ on logarithmic-phase cells, we have previously shown that in addition to osmotic stress Na+ exerts a specific toxic effect on cells that is markedly increased with pH (24). This stressful combination of Na+ and alkaline pH was also documented with stationary-phase cells (32). We have also shown that the NhaA-Na+/H+ antiporter is essential for the adaptation of logarithmic-phase cells to the specific stress of Na+ and alkaline pH in the presence of Na+ (23). Most importantly, we show here that in the stationary phase nhaA via its P2 promoter becomes rpoS dependent and increases dramatically the survival of stationary cells in the presence of Na+, alkaline pH, and alkaline pH in the presence of Na+ (Table 2). It is suggested that this property of NhaA is of paramount importance for the survival of E. coli in its natural habitats such as the sea or the pylorus, where the combination of alkaline pH and sodium prevails.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by grants from the Israel Science Foundation, administered by the Israel Academy of Sciences and Humanities, and the BMBF and BMBF's International Bureau at the DLR (German-Israeli Project Cooperation on Future-Oriented Topics [DIP]). Thanks are also due to the Moshe Shilo Minerva Center for Marine Biogeochemistry and the Massimo and Adelina Della Pergolla Chair in Life Sciences.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Division of Microbial and Molecular Ecology, Institute of Life Sciences, The Hebrew University of Jerusalem, 91904 Jerusalem, Israel. Phone: 972-2-6585094. Fax: 972-2-6586947. E-mail: etana{at}vms.huji.ac.il.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Altuvia, S., M. Almiron, G. Huisman, R. Kolter, and G. Storz. 1994. The dps promoter is activated by OxyR during growth and by IHF and sigma S in stationary phase. Mol. Microbiol. 13:265-272[Medline]. |
| 2. | Atlung, T., and H. Ingmer. 1997. H-NS: a modulator of environmentally regulated gene expression. Mol. Microbiol. 24:7-17[CrossRef][Medline]. |
| 3. |
Barth, M.,
C. Marschall,
A. Muffler,
D. Fischer, and R. Hengge-Aronis.
1995.
Role for the histone-like protein H-NS in growth phase-dependent and osmotic regulation of S and many S-dependent genes in Escherichia coli.
J. Bacteriol.
177:3455-3464 |
| 4. | Bouvier, J., S. Gordia, G. Kampmann, R. Lange, R. Hengge-Aronis, and C. Gutierrez. 1998. Interplay between global regulators of Escherichia coli: effect of RpoS, Lrp and H-NS on transcription of the gene osmC. Mol Microbiol. 28:971-980[CrossRef][Medline]. |
| 5. | Carmel, O., N. Dover, O. Rahav-Manor, P. Dibrov, D. Kirsch, S. Schuldiner, and E. Padan. 1994. A single amino acid substitution (G134-Ala) in NhaR1 increases the inducibility by Na+ of the product of nhaA, a Na+/H+ antiporter gene in Escherichia coli. EMBO J. 13:1981-1989[Medline]. |
| 6. | Carmel, O., O. Rahav-Manor, N. Dover, B. Shaanan, and E. Padan. 1997. The Na+ specific interaction between the LysR-type regulator, NhaR and the nhaA gene, encoding the Na+/H+ antiporter of Escherichia coli. EMBO J. 16:5922-5929[CrossRef][Medline]. |
| 7. |
Christman, M.,
G. Storz, and B. N. Ames.
1989.
OxyR, a positive regulator of hydrogen peroxide-inducible genes in Escherichia coli and Salmonella typhimurium is homologous to a family of bacterial regulatory proteins.
Proc. Natl. Acad. Sci. USA
86:3484-3488 |
| 8. | Dersch, P., K. Schmidt, and E. Bremer. 1993. Synthesis of the Escherichia coli K-12 nucleoid-associated DNA-binding protein H-NS is subjected to growth-phase control and autoregulation. Mol. Microbiol. 8:875-889[Medline]. |
| 9. | Dorman, C. J. 1995. DNA topology and the global control of bacterial gene expression: implications for the regulation of virulence gene expression. Microbiology 141:1271-1280[Medline]. |
| 10. |
Dover, N.,
C. F. Higgins,
O. Carmel,
A. Rimon,
E. Pinner, and E. Padan.
1996.
Na+-induced transcription of nhaA, which encodes an Na+/H+ antiporter in Escherichia coli, is positively regulated by nhaR and affected by hns.
J. Bacteriol.
178:6508-6517 |
| 11. |
Goldberg, B. G.,
T. Arbel,
J. Chen,
R. Karpel,
G. A. Mackie,
S. Schuldiner, and E. Padan.
1987.
Characterization of Na+/H+ antiporter gene of E. coli.
Proc. Natl. Acad. Sci. USA
84:2615-2619 |
| 12. | Gowrishankar, J., and D. Manna. 1996. How is osmotic regulation of transcription of the Escherichia coli proU operon achieved? A review and a model. Genetica 97:363-378[CrossRef][Medline]. |
| 13. | Hengge-Aronis, R. 1996. Back to log phase: sigma S as a global regulator in the osmotic control of gene expression in Escherichia coli. Mol. Microbiol. 21:887-893[CrossRef][Medline]. |
| 14. |
Henikoff, S.,
G. Haughn,
J. Calvo, and J. Wallace.
1988.
A large family of bacterial activator proteins.
Proc. Natl. Acad. Sci. USA
85:6602-6606 |
| 15. | Higgins, C. F., C. J. Dorman, D. A. Stirling, L. Waddell, I. R. Booth, G. May, and E. A. Bremer. 1988. Physiological role for DNA supercoiling in the osmotic regulation of gene expression in S. typhimurium and E. coli. Cell 52:569-584[CrossRef][Medline]. |
| 16. |
Karpel, R.,
T. Alon,
G. Glaser,
S. Schuldiner, and E. Padan.
1991.
Expression of a sodium proton antiporter (NhaA) in Escherichia coli is induced by Na+ and Li+ ions.
J. Biol. Chem.
266:21753-21759 |
| 17. |
Karpel, R.,
Y. Olami,
D. Taglicht,
S. Schuldiner, and E. Padan.
1988.
Sequencing of the gene ant which affects the Na+/H+ antiporter activity of Escherichia coli.
J. Biol. Chem.
263:10408-10414 |
| 18. | Kolter, R., D. A. Siegele, and A. Tormo. 1993. The stationary phase of the bacterial life cycle. Annu. Rev. Microbiol. 47:855-874[CrossRef][Medline]. |
| 19. | Loewen, P. C., B. Hu, J. Strutinsky, and R. Sparling. 1998. Regulation in the rpoS regulon of Escherichia coli. Can. J. Microbiol. 44:707-717[CrossRef][Medline]. |
| 20. | Murata, T., I. Yamato, K. Igarashi, and Y. Kakinuma. 1996. Intracellular Na+ regulates transcription of the ntp operon encoding a vacuolar-type Na+-translocating ATPase in Enterococcus hirae. J. Biol. Chem. 27:23661-23666. |
| 21. | Neidhardt, F. C., J. L. Ingraham, and M. Schaechter. 1990. Growth rate and variable, p. 418-441. In F. C. Neidhardt (ed.), Physiology of the bacterial cell, a molecular approach. Sinauer Associates, Inc., Sunderland, Mass. |
| 22. | Owen-Hughes, T. A., G. D. Pavitt, D. S. Santos, J. M. Sidebotham, C. S. Hulton, J. C. Hinton, and C. F. Higgins. 1992. The chromatin-associated protein H-NS interacts with curved DNA to influence DNA topology and gene expression. Cell 71:255-265[CrossRef][Medline]. |
| 23. |
Padan, E.,
N. Maisler,
D. Taglicht,
R. Karpel, and S. Schuldiner.
1989.
Deletion of ant in E. coli reveals its function in adaptation to high salinity and an alternative Na+/H+ antiporter system(s).
J. Biol. Chem.
264:20297-20302 |
| 24. | Padan, E., and T. A. Krulwich. 2000. Sodium stress, p. 117-130. In G. Storz, and R. Hengge-Aronis (ed.), Bacterial stress responses. ASM Press, Washington, D.C. |
| 25. | Padan, E., and S. Schuldiner. 1993. Na+/H+ antiporters, molecular devices that couple the Na+ and H+ circulation in cells. J. Bioenerg. Biomembr. 25:647-669[Medline]. |
| 26. |
Padan, E., and S. Schuldiner.
1996.
Bacterial Na+/H+ antiporters molecular biology, biochemistry, and physiology, p. 501-531.
In
W. N. Konings, H. R. Kaback, and J. Lolkema (ed.), The handbook of biological physics, vol. II. Transport processes in membranes. Elsevier Science, Amsterdam, The Netherlands.
|
| 27. |
Pinner, E.,
E. Padan, and S. Schuldiner.
1992.
Cloning, sequencing and expression of the nhaB gene, encoding a Na+/H+ antiport in E. coli.
J. Biol. Chem.
267:11064-11068 |
| 28. |
Pinner, E.,
E. Padan, and S. Schuldiner.
1994.
Kinetic properties of NhaB, a Na+/H+ antiporter from E. coli.
J. Biol. Chem.
269:26274-26279 |
| 29. |
Rahav-Manor, O.,
O. Carmel,
R. Karpel,
D. Taglicht,
G. Glaser,
S. Schuldiner, and E. Padan.
1992.
NhaR, a protein homologous to a family of bacterial regulatory proteins (LysR), regulates nhaA, the sodium proton antiporter gene in Escherichia coli.
J. Biol. Chem.
267:10433-10438 |
| 30. | Schell, M. 1993. Molecular biology of the LysR family of transcriptional regulators. Annu. Rev. Microbiol. 47:597-626[CrossRef][Medline]. |
| 31. |
Sitnikov, D. M.,
J. B. Schineller, and T. O. Baldwin.
1996.
Control of cell division in Escherichia coli: regulation of transcription of ftsQA involves both rpoS and SdiA-mediated autoinduction.
Proc. Natl. Acad. Sci. USA
93:336-341 |
| 32. |
Small, P.,
D. Blankenhorn,
D. Welty,
E. Zinser, and J. L. Slonczewski.
1994.
Acid and base resistance in Escherichia coli and Shigella flexneri: role of rpoS and growth pH.
J. Bacteriol.
176:1729-1737 |
| 33. | Storz, G., and S. Altuvia. 1994. OxyR regulon. Methods Enzymol. 234:217-223[Medline]. |
| 34. |
Storz, G.,
L. A. Tartaglia, and B. N. Ames.
1990.
Transcriptional regulator of oxidative stress-inducible genes: direct activation by oxidation.
Science
248:189-194 |
| 35. | Ussery, D. W., J. C. D. Hinton, B. J. A. M. Jordi, P. E. Granum, A. Scirafi, R. J. Stephen, A. E. Tupper, G. Berridge, J. M. Sidebotham, and C. F. Higgins. 1994. The chromatin-associated protein H-NS. Biochimie 76:968-980[Medline]. |
This article has been cited by other articles:
| ||||||||||||||||||||||