INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Paracoccus denitrificans is a nutritionally versatile bacterium found in soil, sewage, and sludge. The ability of the organism to adapt its metabolism to a variety of carbon and free energy sources may reflect the nature of its natural environment. P. denitrificans can grow heterotrophically on a variety of carbon sources and lithoautotrophically using hydrogen, thiosulfate, or reduced C₁ compounds (methanol, methylamine, or formate) as free energy source. Expression of the genes encoding enzymes involved in C₁ metabolism is tightly regulated. The synthesis of methanol dehydrogenase (MDH) and methylamine dehydrogenase (MADH), the enzymes that catalyze the oxidation of methanol and methylamine to formaldehyde, respectively, is induced when the cells grow on methanol or methylamine as the sole free energy source but is repressed in cells grown on energetically more favorable substrates (7). The synthesis of glutathione-dependent formaldehyde dehydrogenase (GD-FALDH) and S-formylglutathione hydrolase (FGH), the enzymes that catalyze the oxidation of formaldehyde to formate, however, is not fully repressed under these conditions, since low but significant levels of both enzymes can be found in succinate-grown cells (14, 29). These low levels may help ensure a rapid response to small amounts of adventitiously formed formaldehyde or to the formaldehyde first generated during growth with methylotrophic substrates. Low levels of MDH were found in cultures grown on a variety of carbon sources during carbon limitation in a chemostat (7). Under these conditions, the genes involved in methanol oxidation are expressed at basal levels. Maximal expression was observed in cells grown on methanol, methylamine, and choline. Oxidation of all these compounds yields formaldehyde, so it has been postulated that formaldehyde is an important trigger in the regulation of expression of gene clusters involved in C₁ metabolism (7). GD-FALDH, FGH, and cytochrome c_553i are also synthesized to high levels in cultures grown on methanol, methylamine, and choline, so the expression of several gene clusters may respond to formaldehyde (14, 20, 21).

Genes involved in methanol oxidation are located in the mxa gene cluster of P. denitrificans (12, 30). The structural genes mxaF and mxaI encoding the subunits of MDH are located in the mxaFJGIR operon. Expression of these mxa genes is controlled by a specific two-component regulatory system, MxaYX, encoded in the mxaZYX operon (15). It has been hypothesized that the histidine kinase MxaY autophosphorylates in response to formaldehyde. The phosphoryl group is, presumably, then transferred to the cognate response regulator MxaX. Once phosphorylated, MxaX binds to the promoter region of mxaF and activates transcription. Surprisingly, however, a deletion of mxaY resulted in a wild-type phenotype with respect to methanol oxidation, suggesting the presence of a second regulatory system that is able to cross talk with MxaX (35). The MxaYX regulatory system appears to be specifically dedicated to the regulation of expression of the mxa genes since expression of the genes encoding MADH, GD-FALDH, FGH, and cytochrome c_553i was unaffected by mxaYX mutations.

Genes involved in formaldehyde oxidation are located in the flh cluster of P. denitrificans (14, 21). GD-FALDH is encoded by flhA, while FGH is encoded by fghA. The cycB gene encoding cytochrome c_553i is linked to the flhA and fghA genes. The expression of these three genes is up-regulated by formaldehyde, but this regulation is independent of the MxaYX proteins (35). Regulatory genes controlling the expression of the flh gene cluster have yet to be identified.

Thus, it is postulated that expression of genes involved in C₁ metabolism in P. denitrificans involves at least two regulatory systems, both of which are activated by formaldehyde: (i) the MxaYX sensor regulator pair, which controls expression of the mxa locus, and (ii) an unidentified regulator of the flhA, fghA, and cycB genes. To investigate this hypothesis, we constructed an unmarked mxaY mutant, in which the activation of mxaX is dependent on another regulatory circuit. By introducing a cycB promoter-lacZ fusion into this new background, we were able to screen for mutants defective in activation of the cycB gene. Here we report the isolation of a gene cluster that encodes a two-component regulatory system, which controls the expression of that gene as well as the mxa, flhA, and fghA genes.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Bacterial strains, plasmids, and growth conditions. Strains and plasmids used are listed in Table 1. P. denitrificans and Escherichia coli were routinely grown aerobically either in brain heart infusion broth (GIBCO, Life Technologies Ltd., Paisley, United Kingdom) or mineral salt medium at 35°C (3). Carbon sources and their concentrations were as follows: 25 mM methanol (50 mM for solid media), 50 mM methylamine, 25 mM succinate, 50 mM formate, and 15 mM choline chloride. Autotrophic growth was on solid minimal medium without a carbon source, and plates were incubated in 4% carbon dioxide, 8% hydrogen, 3% oxygen, and 85% dinitrogen. Antibiotics were used at final concentrations of 40 µg ml¹ (rifampin), 25 µg ml¹ (kanamycin, streptomycin, and gentamicin), and 100 µg ml¹ (ampicillin).

Plasmid construction. Plasmid pUT.hf was constructed by ligation of the 6.4-kbp NotI fragment of pLOF.hf into the NotI vector fragment of pUT.Km. Plasmid pPr611 was constructed by ligation of an EcoRI-BspHI fragment, containing the promoter region of cycB, from pJR62.1 into the EcoRI-SmaI sites of pBK16. pPr071 was constructed by ligation of a 1.7-kbp EcoRI-SmaI fragment, harboring the mxaZ promoter of pNH15, into the EcoRI-SmaI site of pBK11. pPr501 was constructed by ligation of a PCR fragment harboring the flhR promoter into the EcoRI-BamHI sites of pBK11. The forward primer was CGGGGATCCCGGTCTTGCGACTGCATTTCG, and the reverse primer was CGGGAATTCCGATGCCGATCCTTTTGCCGC; cloning sites, indicated in bold, were introduced via the primers. To obtain pSK4, a SalI-EcoRI fragment containing the cycA promoter was cloned into pGEM7. The resulting plasmid was digested with SmaI, and a 1.6-kbp NruI-FspI fragment containing the flhA gene was inserted. The pcycA-flhA construct was subsequently transferred into the XbaI and HindIII sites of the broad-host-range vector pEG400Gm, a gentamicin-resistant derivative of pEG400, yielding pSK4. To obtain pRTd5021, a HincII-SphI fragment harboring flhR was inserted into the SmaI-SphI sites of pGRPd1. The resulting clone was subsequently digested with SmaI, and a HincII fragment of pUC4K containing the kanamycin resistance gene was inserted. To obtain pRTd5121, a BamHI-EcoRV fragment containing flhS was inserted into pGEM7. The resulting clone was digested with PstI, and a 1-kbp PstI fragment of flhS was replaced by the Pst fragment of pUC4K. The inactivated flhS gene was subsequently inserted into the BamHI-SphI sites of pGRPd1. The P. denitrificans gene library was obtained from Stephen Spiro (5).

DNA manipulations and analyses. Routine methods for DNA manipulation were as previously described (2). Southern hybridizations employed positively charged nylon membranes as specified by the manufacturer (Boehringer GmbH, Mannheim, Germany). The nucleotide sequence was determined using the dideoxy chain termination method described by Sanger et al. (23) combined with the M13 cloning system, using an Automatic Sequenator (Applied Biosystems, Foster City, Calif.). For analysis of the sequences, we used the DNA-Strider and GeneWorks 2.3 programs. For homology studies on amino acid sequences, the international protein and DNA data banks were screened on-line by using GenBank (1, 11).

Gene transfer and mini-Tn5 transposition. Wild-type chromosomal genes were replaced by homologous recombination as described previously (31). Fusions of lacZ to the mxaZ and flhR promoters were obtained by homologous recombination with a single crossover, leading to insertion of a complete plasmid in the chromosome (6). Transposon mutagenesis was carried out by triparental mating of a recipient P. denitrificans strain and two E. coli strains, one carrying the donor plasmid and the second carrying the helper plasmid pRK2020. The three strains were mixed on a brain heart infusion agar plate and incubated at 37°C for 24 h. The mating mixture was subsequently plated on minimal medium supplemented with choline and X-Gal (5-bromo-4-chloro-3-indolyl--D-galactopyranoside).

Insertion of a target for recombination. This procedure was described by Kessler et al. (16) and allows the insertion into the chromosome of P. denitrificans of a recombinant transposon (the homology fragment) that carries DNA sequences homologous to the regions flanking the pcycB-lacZ fusion present on a multicopy promoter-probe-vector. Double recombination between the promoter-probe vector and the chromosomal homology region of the transposon is genetically selected by reconstitution and expression of wild-type sequences from truncated lacZ and aadA (streptomycin) resistance genes in the homology fragment. The double recombination event is confirmed by screening for loss of the transposon-encoded kanamycin resistance marker.

6

Protein analysis. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis was performed in 13% (wt/vol) polyacrylamide, 1.5-mm-thick slab gels prepared by the method described by Laemmli (17). Samples were prepared for electrophoresis as described previously (20). Western blottings were performed essentially as described previously (13). For immunological detection of MDH, antibodies were used that had been raised against the holoenzyme. Proteins with covalently bound heme were stained with 3,3',5,5'-tetramethylbenzidine by the method described by Thomas et al. (28).

Nucleotide sequence accession number. The nucleotide sequences have been deposited with the EMBL Nucleotide Sequence Database under accession no. AJ223460.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Isolation of a regulatory mutant with a pleiotropic defect in C₁ metabolism. Our aim was to isolate a genetic locus involved in the regulation of flhA, fghA, and cycB expression and in activation of MxaX in an mxaY mutant. For this, we constructed a genomic reporter of cycB promoter activity by using a method that leaves the wild-type cycB gene intact (16). A DNA fragment containing the promoter region of cycB was cloned in the promoter-probe vector pBK16. The resulting plasmid, pPR611, was then integrated into the genome of the mxaY mutant Pd0841.hf at the site of the homology fragment (see Materials and Methods). Hybridization analysis confirmed the integration of the cycB promoter upstream of the lacZ gene in the homology fragment. The strain thus obtained, Pd0841hf611, expressed lacZ during growth on choline, but not on succinate, as judged by the appearance of blue and white colonies, respectively, on plates containing X-Gal.

Characterization of the regulatory mutant. Pd13(pSK4) is unable to grow on methanol and methylamine, while growth on choline, succinate, and formate and autotrophic growth are normal (Table 2). Curing of plasmid pSK4 resulted in a strain (Pd13) that is unable to grow on methanol, methylamine, or choline. A similar phenotype was also found for Pd6721, a mutant with an insertion in the flhA gene (21). Pd13 is able to express GD-FALDH in succinate grown cells to low levels, similar to those found in the wild-type strain (28 nmol of NADH min¹ mg of protein¹). Activities under inducing conditions (i.e., after growth on methanol, methylamine, or choline) could not be determined because the mutant does not grow on these substrates. The data indicate that the chromosomal flhA gene in Pd13 was not induced under C₁ growth conditions above the basal level.

View larger version (38K): [in this window] [in a new window]   FIG. 1.   (A) Western blot analysis of  and  subunits of MDH from P. denitrificans wild type (lane 1) and mutant Pd13(pSK4) (lane 2). (B) Heme stain analysis of the cycB mutant Pd6121 (lane 1), wild type (lane 2), and mutant Pd13(pSK4) (lane 3). Molecular mass markers are indicated in kilodaltons. Ccp, cytochrome c peroxidase; cytc553i, cycB gene product.

Cloning and sequencing of the flhRS region from P. denitrificans. Isolation and analysis of the region in which the mini-Tn5 transposon had integrated revealed that the plasmid carrying the transposon had formed a cointegrate with plasmid pSK4 as a consequence of a single recombination event that had taken place at the oriT locus of both plasmids. Apparently, the mutation in Pd13 causing the defects in C₁ metabolism was not caused by a transposon insertion but rather by a spontaneous mutation. In order to isolate the corresponding gene, we transformed Pd13 with chromosomal fragments present in a genomic library of P. denitrificans. After conjugation of the gene library, colonies that were able to grow on choline were selected. One of these clones was found to contain a plasmid with a 23-kbp chromosomal DNA fragment. This plasmid, pR11.1, was subcloned, and a 5.9-kbp PstI fragment that was able to complement the mutation of Pd13 with respect to growth on choline, methanol, and methylamine was isolated. In addition, the plasmid restored activity of the cycB promoter to wild-type levels, as Pd13(pR11.1P8) formed dark blue colonies on choline-X-Gal plates. This result confirmed that a single locus was mutated in Pd13. The physical map of this region is shown in Fig. 2.

View larger version (7K): [in this window] [in a new window]   FIG. 2.   Physical map of the FlhRS region of P. denitrificans. Open arrows indicate ORFs. The 5.9-kbp fragment that is able to complement the mutation in Pd13 is indicated by a P. The positions of the kanamycin boxes in Pd5021 (flhR::Km) and Pd5121 (flhS::Km) are indicated.

Sequence analysis of the mutation in PD13. Since the 5.9-kbp DNA fragment that complements the mutation in Pd13 contains the complete flhR gene and only the 5' end of flhS, we assumed that flhR was mutated in Pd13. In order to test that hypothesis, we cloned the flhRS locus of Pd13 by using a PCR-based approach and determined the sequence over its entire length. Comparison of this sequence with that of the wild type revealed a single base pair change at position 633 of the flhR gene, which converted the wild-type ATG methionine codon into a GTG valine codon. The methionine residue is located in the predicted DNA binding helix-turn-helix motif of FlhR, suggesting that this residue is important for the DNA binding properties of the regulator.

Isolation and characterization of FlhR- and FlhS-deficient mutants. To analyze the function of the gene products of flhR and flhS, the genes were mutated by insertion of a kanamycin resistance marker gene. Mutations were introduced into the wild-type Pd1222 (generating Pd5021 and Pd5121, respectively) and into the MxaY mutant Pd0841 (generating Pd9234 and Pd9235, respectively), after which the strains were tested for their ability to grow on various carbon sources. Strains Pd5021, Pd5121, Pd9234, and Pd9235 were all unable to grow on methanol, methylamine, or choline, like Pd13 (Table 2). This phenotype was apparently not the consequence of an inability to oxidize formaldehyde, since introduction of pSK4 (which directs the constitutive synthesis of GD-FALDH) into these strains restored their potential to grow on choline, but not on methanol or methylamine (Table 2). Hence, the pleiotropic effects of the mutations in these strains are best explained by assuming that the FlhRS proteins regulate metabolism of the latter two substrates. Indeed, we could demonstrate by Western analyses that the mutant strains were unable to synthesize MDH, just like Pd13 (results not shown).

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Here we report on the isolation and sequencing of the flhRS genes of P. denitrificans that are involved in regulation of C₁ metabolism. FlhS and FlhR show strong similarity with sensor-regulator proteins from the family of two-component regulatory systems. Since FlhS is apparently located in the cytoplasm, its cognate signal is likely to be sensed intracellularly. The FlhRS proteins are required for methanol and for formaldehyde oxidation. We base this conclusion on the fact that expression of the mxa, flhA-fghA, and cycB genes was abolished in the corresponding mutants, while they were also unable to grow on methanol, methylamine, and choline.

Expression of the mxa operon encoding methanol dehydrogenase in P. denitrificans is also regulated by a two-component regulatory system composed of the transcriptional activator MxaX and the sensor MxaY (15). It has been hypothesized that periplasmically formed formaldehyde is the signaling molecule for the latter protein. Surprisingly, however, an mxaY-deficient mutant had a wild-type phenotype with respect to methanol oxidation, suggesting the presence of another sensor able to activate MxaX (35). It is not known how the two sensor-regulator pairs, MxaZYX and FlhRS, which are both necessary for expression of the mxa genes, interact. In M. extorquens AM1 and in Methylobacterium organophilum XX, mxa gene expression is controlled by more than one sensor-regulator pair (26, 33, 34). In M. extorquens AM1, a regulatory hierarchy was found in which the sensor-regulator pair MxcQE controls expression of the sensor-regulator pair MxbDM (26). The latter in turn controls expression of a number of other genes involved in methanol oxidation (25), but not that of genes involved in formaldehyde oxidation. The situation in P. denitrificans is different in that the promoter upstream of mxaZ is constitutive and not regulated by FlhRS. Further, a mutation in mxaX did not affect growth on methylamine and choline (15), indicating that MxaX is not required for the expression of the flhR promoter. Thus, it may be that both MxaYX and FlhRS regulate mxa expression in concert. The most reasonable explanation is that FlhS is able to phosphorylate MxaX in response to intracellular formaldehyde. This would also explain why MDH is synthesized in cells grown on methanol and methylamine (which are oxidized to formaldehyde in the periplasm) as well as on choline (which yields cytoplasmic formaldehyde upon its oxidation). In this scenario, FlhS and MxaY might be cytoplasmic and periplasmic formaldehyde sensors, respectively.

Since an FlhS-deficient mutant is unable to grow on C₁ compounds and since the expression of the mxaZYX operon is not controlled by the FlhRS system, it can be concluded that MxaY is unable to complement the FlhS-deficient mutant and to activate FlhR. Whether cross-regulation between FlhS and MxaX occurs, however, could not be demonstrated by in vivo experiments carried out in this study. The reason for this is that an FlhS MxaY double mutant is unable to grow on methanol, since activation of both FlhR (by FlhS) and MxaX (by MxaY or FlhS) is necessary for growth on that substrate (Table 2).

Apart from the role of FlhRS in the regulation of formaldehyde formation, the FlhRS system is also necessary for expression of the formaldehyde oxidation system. A mutant lacking a functional FlhRS system, Pd13(pSK4) grown on choline, was able to express basal levels of FGH and GD-FALDH, but activation to wild-type levels was not found. The presence of basal levels of these enzymes in Pd13(pSK4) growing on succinate may be the result of the basal activity of the promoter that is only activated by FlhR~P upon sensing of formaldehyde by FlhS.

The FlhRS two-component regulatory system as described in this paper seems to have a key role in controlling the concentration of the toxic compound formaldehyde. For the type of pathways described here, and as shown in Fig. 3, one expects a regulatory system that can switch the pathways from "off" to "on" and in addition can control the activity of the formaldehyde producer (MDH) relative to that of the formaldehyde consumers (GD-FALDH, FGH). The latter regulation is necessary to avoid the accumulation of toxic amounts of formaldehyde. Indeed, the sensor-regulator pair FlhRS fulfills these roles and, consequently, mutations in this system have a pleiotropic effect. In contrast to this global regulation, MxaX has a specific role in regulation of the mxa gene cluster.

View larger version (18K): [in this window] [in a new window]   FIG. 3.   Model of the regulatory network controlling the expression of the structural genes encoding MDH, GD-FALDH, FGH, and cytochrome c553i. Possible protein-protein interactions are indicated by solid lines, protein-DNA interactions are indicated by dashed lines, and DNA expression is indicated by dotted lines. p, promoter; +, positive interactions; ?, possible cross talk between the two two-component regulatory systems.