Previous Article | Next Article 
Journal of Bacteriology, January 2001, p. 745-751, Vol. 183, No. 2
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.2.745-751.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
O2R, a Novel Regulatory Element Mediating Rox1p-Independent
O2 and Unsaturated Fatty Acid Repression of OLE1
in Saccharomyces cerevisiae
Youji
Nakagawa,
Shigemi
Sugioka,
Yoshinobu
Kaneko, and
Satoshi
Harashima*
Department of Biotechnology, Graduate School
of Engineering, Osaka University, Suita, Osaka 565-0871, Japan
Received 17 July 2000/Accepted 13 October 2000
 |
ABSTRACT |
Fatty acid desaturation catalyzed by fatty acid desaturases
requires molecular oxygen (O2). Saccharomyces
cerevisiae cells derepress expression of OLE1
encoding
9 fatty acid desaturase under hypoxic conditions to allow
more-efficient use of limited O2. It has been proposed that
aerobic conditions lead to repression of OLE1 by
well-established O2-responsive repressor Rox1p, since putative binding sequences for Rox1p are present in the promoter of
OLE1. However, we revealed in this study that disruption of ROX1 unexpectedly did not affect the O2
repression of OLE1, indicating that a Rox1p-independent
novel mechanism operates for this repression. We identified by promoter
deletion analysis the 50-bp O2-regulated (O2R) element in
the OLE1 promoter approximately 360 bp upstream of the
start codon. Site-directed mutagenesis of the O2R element showed that
the putative binding motif (5'-GATAA-3') for the GATA family of
transcriptional factors is important for O2 repression. Anaerobic derepression of OLE1 transcription was repressed
by unsaturated fatty acids (UFAs), and interestingly the O2R element was responsible for this UFA repression despite not being included within the fatty acid-regulated (FAR) element previously reported. The
fact that such a short 50-bp O2R element responds to both O2 and UFA signals implies that O2 and UFA
signals merge in the ultimate step of the pathways. We discuss the
differential roles of FAR and O2R elements in the transcriptional
regulation of OLE1.
 |
INTRODUCTION |
The lipid composition of cellular
membranes is regulated to maintain membrane fluidity (22).
A key enzyme involved in this process is the membrane-bound
9 fatty
acid desaturase, which catalyzes the introduction of the initial double
bond between the 9th and 10th carbons of palmitoyl-coenzyme A (CoA) and
stearoyl-CoA (35). The correct ratio of saturated to
monounsaturated fatty acids contributes to membrane fluidity.
Alterations of this ratio have been implicated in various diseases
including cardiovascular diseases, obesity, non-insulin-dependent
diabetes mellitus, hypertension, neurological diseases, immune
disorders, and cancer in mammals (35). In yeast, this
ratio has been suggested to be related to the heat shock response,
ethanol tolerance, and mitochondrial movement and inheritance (1,
8, 45). The regulation of the expression of
9 fatty acid
desaturase is, therefore, of considerable physiological importance.
In Saccharomyces cerevisiae,
9 fatty acid desaturase is
encoded by OLE1 (46). The steady-state level of
OLE1 mRNA is regulated at the level of transcription and by
mRNA stability, and both regulatory processes are affected by the
presence of unsaturated fatty acids (UFAs) in the growth medium
(6, 10, 20). Addition of exogenous UFA represses the
transcription of OLE1 and promotes the decay of
OLE1 mRNA. A fatty acid-regulated (FAR) element which is
essential for UFA repression of OLE1 transcription under
aerobic conditions has been identified by promoter deletion analysis
(10). Simultaneous disruption of the two long-chain
(C14 to C18) fatty acyl-CoA synthetase genes,
FAA1 and FAA4, blocks incorporation of long-chain
saturated fatty acids and UFAs such as oleic acid into cells and does
not cause UFA repression of OLE1 transcription (9,
10). A putative fatty acid transport protein (FATP) with 33%
homology to an adipocyte FATP (42) was identified
(15). However, more-recent reports indicate that this
protein is an acyl-CoA synthetase specific for very-long-chain fatty
acids rather than a plasma membrane fatty acid transporter (9,
52). Therefore, a fatty acid transport protein and UFA signal
transducers and responding transcriptional regulators have not yet been identified.
Since the desaturation reaction requires molecular oxygen
(O2) as an electron acceptor (35), it has been
proposed that cells derepress expression of OLE1 under
hypoxic conditions to allow more-efficient use of limiting
O2 (53). Well-established
O2-responsive repressor Rox1p is believed to repress
OLE1 transcription under aerobic conditions because putative
Rox1p-binding sequences are present in the OLE1 promoter
(53). However, there had been no conclusive evidence that
OLE1 transcription is indeed repressed by O2
until the recent report by Kwast et al. (26), who showed that OLE1 transcription was induced when cells were shifted
to anaerobic conditions.
In this report, we show that O2 repression of
OLE1 is mediated by a Rox1p-independent novel mechanism.
Furthermore, we newly identified a 50-bp region essential for
O2 repression, designated the O2R element, and this element
was also responsible for UFA repression of anaerobically derepressed
OLE1 transcription despite not being included within the FAR
element. Therefore, there appears to be a close connection between
O2 and UFA signals that act on the short 50-bp element in
the OLE1 promoter.
 |
MATERIALS AND METHODS |
Microorganisms and media.
The S. cerevisiae
strains used in this work are listed in Table
1. Escherichia coli strains
TG1 (40) and DH5
(40) were used as hosts
for the propagation and manipulation of plasmid DNA. Yeast cells were
grown in nutrient medium (YPDA; i.e., nutrient high-Pi
medium) (38) or YPDA supplemented with 1 mM oleic acid (Wako Chemicals, Osaka, Japan) and 1% (vol/vol) Triton X-100 (Wako Chemicals) (16). The Luria-Bertani medium for
E. coli was as described previously (40).
Disruption of ROX1.
A 1,109-bp fragment of
ROX1 (nucleotides [nt]
2 to +1107) was amplified by PCR
using chromosomal DNA of S. cerevisiae strain S288C
(33) as a template and oligonucleotides
5'-GCGGATCCCAATGAATCCTAAATCCTCTACAC-3' and
5'-CGCTCGAGTCATTTCGGAGAAACTAGGC-3', corresponding to the nt
2 to +22 and +1107 to +1088 of ROX1, as forward and
reverse primers, respectively. The PCR product was doubly digested with
BamHI and XhoI and cloned into the
BamHI-XhoI gap of pRS305 (44) to
obtain plasmid p1513. A 1,148-bp fragment of ROX1 (nt
1121
to +27) was amplified by PCR using chromosomal DNA of S288C as a
template and oligonucleotides 5'-CCAAGCTTCCATTGAGAAGGACAACATT-3'
and 5'-CTGGATCCTTAGGTGTAGAGGATTTAGG-3', corresponding
to the nt
1121 to
1102 and +27 to +7 of ROX1, as forward
and reverse primers, respectively. The PCR product was doubly digested
with HindIII and BamHI and cloned into the HindIII-BamHI gap of pUC18 (40)
to obtain plasmid p1514. A 2.9-kb BamHI-ScaI
fragment from p1513 and a 2.1-kb BamHI-ScaI
fragment from p1514 were ligated to obtain plasmid p1515. A 525-bp
BamHI-BglII fragment of p1515 containing the
ROX1 open reading frame (ORF), corresponding to nt +28 to
+523, was replaced with a 1.7-kb BamHI fragment containing
LEU2 from YDp-L (4) to obtain plasmid p1516. The rox1::LEU2 disruptant, SH5128, was constructed
by transformation of SH4041 with HindIII- and
XhoI-digested plasmid p1516. The
rox1::LEU2 disruption was verified by Southern analysis.
OLE1p-PHO5 fusions.
Construction of
plasmid p1166, which contains a 935-bp fragment upstream of
OLE1 fused with the structural region of PHO5 encoding repressible acid phosphatase (rAPase; EC 3.1.3.2), was
described previously (16). The activation and repression assay vector pRAV, containing the
UASPHO84E-PHO84p-PHO5 reporter gene, was constructed previously (31). The
UASPHO84E-PHO84p-PHO5 reporter gene consists of a 272-bp fragment upstream of
PHO84 containing Pho4p binding site E fused with the
PHO5 ORF. Plasmid p1785 (see Fig. 2), which has the
934 to
586 region of OLE1 (taking base A of the ATG start codon
as +1) upstream of the
UASPHO84E-PHO84p-PHO5 reporter gene was constructed as follows. A 349-bp region of
OLE1 was amplified by PCR using p1166 as a template and
oligonucleotides 5'-CTCGAATTCAGCTTTTCGTTTGCAGGTTT-3' and
5'-CTCAAGCTTAGTTAGTTTTTGGGCCACCG-3', corresponding to the nt
934 to
915 and
586 to
605 of OLE1, as the forward
and reverse primers, respectively. The PCR product was doubly digested
with EcoRI and HindIII and cloned into the EcoRI-HindIII gap of pRAV to obtain plasmid
p1785. Plasmids p1787, p1781, p1783, p1860, p1862, and p1864, which
each contain nt
585 to
456 (the FAR element),
455 to
307,
306
to
159,
455 to
406,
405 to
357, and
356 to
307 of
OLE1, respectively, were constructed in a similar way to
plasmid p1785 by inserting EcoRI-HindIII fragments containing each region amplified by PCR into the
EcoRI-HindIII gap of pRAV. Plasmid p1872,
which carries OLE1p lacking the O2R element
(OLE1p
O2R) fused with the structural region of
PHO5 was constructed as follows. The
306 to
1 region of
OLE1 was amplified by PCR using p1166 as a template and
oligonucleotides 5'-CTCAAGCTTTTCTACGAGTCTTGCTCACT-3' and
5'-GCGGATCCTTTGTTGTAATGTTTTAG-3', corresponding to the nt
306 to
287 and
1 to
19 of OLE1, as the forward and
reverse primers, respectively. The PCR product was doubly digested with HindIII and BamHI and cloned into the
HindIII-BamHI gap of pSH39 (34)
to obtain plasmid p1870. The
934 to
357 region of OLE1 was amplified by PCR using p1166 as a template and oligonucleotides 5'-CTCGAATTCAGCTTTTCGTTTGCAGGTTT-3' and
5'-CTCAAGCTTAAAGAAAGCTGCCGACTATG-3', corresponding to nt
934 to
915 and
357 to
376 of OLE1, as the forward
and reverse primers, respectively. The PCR product was doubly digested
with EcoRI and HindIII and cloned into the EcoRI-HindIII gap of p1870 to obtain plasmid
p1872. Plasmid p1904, in which the 5'-GATAA-3' sequence in the O2R
element is changed to 5'-ACGCC-3' by site-directed mutagenesis, was
constructed as follows. Oligonucleotides
5'-AATTCCGGACGTTGAAACACTCAACAAACCGGCGTTAGTGCCCAACCAGGTGTGCA-3' and
5'-AGCTT GCACACCTGGTTGGGCACTAACGCCGGTTTGTTGAGTGTTTCAACG TCCGG-3', corresponding to nt
356 to
307 and
307 to
356 of
OLE1, respectively, in which the 5'-GATAA-3' sequence (
331
to
327) is changed to 5'-ACGCC-3' (underlined) were annealed and
cloned into the EcoRI-HindIII gap of pRAV to
obtain plasmid p1904. Plasmid p1858, which contains a 567-bp fragment
upstream of ANB1 (27) fused with the
PHO5 ORF, was constructed as follows. A 567-bp fragment of
ANB1 (nt
567 to
1) was amplified by PCR using
chromosomal DNA of S288C as a template and oligonucleotides
5'-CTCAAGCTTCCGGGAATTTTAGATTCAGG-3' and
5'-CTCGGATCCGTTTTAGTGTGTGAATGAAA-3', corresponding to nt
567 to
548 and
1 to
20 of ANB1, as the forward and
reverse primers, respectively. The PCR product was doubly digested with
HindIII and BamHI and cloned into the
HindIII-BamHI gap of pSH39 to obtain plasmid
p1858. All constructs were analyzed by sequencing the respective
promoter regions. The resulting plasmids were digested with
StuI and integrated into the URA3 locus of
SH5143, SH4041, or SH5128 by transformation. Single-copy integration
was confirmed by Southern analysis of genomic DNA digested with
HindIII from the respective transformants.
Northern blot analysis.
The preparation of RNA and Northern
blot hybridization were performed as described previously
(38). Cells were cultivated in 10 ml of YPDA medium to
stationary phase at 30°C with vigorous shaking. The stationary-phase
culture was inoculated into 30 ml of YPDA or YPDA containing oleic acid
in a 100-ml Erlenmeyer flask to give an optical density at 660 nm
(OD660) of 0.1. The cultures were shaken at 30°C for
aerobic growth. For anaerobic growth, the cultures were sealed with
rubber stoppers and bubbled with pure nitrogen gas for 2 min to purge
O2 after inoculation or sampling, and shaken at 30°C.
Anaerobic conditions were verified based on confirming the
transcription of ANB1 (28), a well-known
hypoxic gene. Total RNAs were prepared from the cells harvested in the logarithmic growth phase (OD660 = 0.7 to 1.6). DNA
fragments containing the OLE1 ORF (nt
9 to +1905 relative
to ATG), the PHO5 ORF (nt
18 to +2116), and the
ANB1 ORF (nt +1 to +455), amplified by PCR, and the 1.0-kb
HindIII-XhoI fragment carrying
ACT1 prepared from pYA301 (19) were labeled
with 32P as described previously (39) to
generate DNA probes.
rAPase assay.
Cells were cultivated in 10 ml of YPDA medium
to stationary phase at 30°C with vigorous shaking. The
stationary-phase culture (0.2 ml) was inoculated into 10 ml of YPDA
medium or YPDA medium containing oleic acid. The cultures were shaken
for 5 h at 30°C for aerobic growth or left to stand for 24 h at 30°C in a sealed Anaero Pack (Mitsubishi Gas Chemical Co.,
Tokyo, Japan) for anaerobic growth, and then rAPase activities were
measured as described previously (48). The rAPase
activities presented are the averages of at least three independent experiments.
Genetic and biochemical methods.
S. cerevisiae and
E. coli cells were transformed as described by Ito et al.
(24) and Sambrook et al. (40), respectively. Yeast chromosomal DNA was prepared as described previously
(23). Southern blot analysis and other DNA manipulations
were performed using standard methods (40). Bacterial
plasmid DNA was isolated by the alkaline lysis method
(40). Nucleotide sequences were determined by the dideoxy
chain termination method (41).
 |
RESULTS AND DISCUSSION |
Transcription of OLE1 is repressed by O2 in
a Rox1p-independent manner.
To clarify whether OLE1
transcription is indeed repressed by O2, we investigated
OLE1 transcription in cells cultivated aerobically or
anaerobically. Northern blot analysis (Fig.
1A) showed that the levels of transcripts
of OLE1 and OLE1p-PHO5 fusion gene are significantly increased under anaerobic conditions, compared to the
levels under aerobic conditions, in the wild-type strain (Fig. 1A,
lanes 1 and 3), indicating that OLE1 transcription is
repressed by O2. The same observation that OLE1
transcription is induced when cells are shifted to anaerobic conditions
has been reported recently (26). In S. cerevisiae, a Rox1p-dependent mechanism is known to mediate
transcriptional repression of various hypoxic genes by O2
(53). Since the biosynthesis of heme requires
O2, heme accumulates under aerobic conditions and binds to
Hap1p. Hap1p with bound heme acts as a transcriptional activator to
activate ROX1 transcription. Rox1p binds to its recognition
sites, 5'-YYYATTGTTCTC-3' (where Y represents pyrimidine)
(3), upstream of anaerobically expressed genes such as
ANB1 and forms a complex with the general repressors Tup1p
and Ssn6p to repress target genes under aerobic conditions
(53). As three putative binding sites for Rox1p are present in the OLE1 promoter (Fig. 1B), we disrupted
ROX1 to determine whether OLE1 repression
requires Rox1p. In the rox1 disruptant, ANB1
transcription was, as reported previously (53),
derepressed under aerobic conditions (Fig. 1A, lane 2). However,
OLE1 transcription was unexpectedly not derepressed (Fig.
1A, lane 2), indicating that Rox1p is not involved in the
O2 repression of OLE1. Although there are many
hypoxic genes which have consensus binding sequences for Rox1p in
their promoters (53), for some of them the function of
these sequences has not been experimentally determined by, for
example, deletion or mutation analysis of the consensus
sequence or disruption of ROX1. Our results for
OLE1 demonstrate that one must not decide on the operating
mechanism only by the presence of a consensus sequence. What is the
mechanism of O2 repression of OLE1? Recently,
another group has shown that the respiratory chain is involved in the
anaerobic induction of OLE1 transcription and that
cytochrome c oxidase is likely the hemoprotein sensor for
O2 (26). However, nothing is known about the
signal transduction pathway downstream of the O2 sensor.
Identification of O2-responsive transcriptional factors
involved in Rox1p-independent O2 repression should make it
possible to elucidate the repression mechanism.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 1.
Transcription of OLE1 is repressed by
O2 in a Rox1p-independent manner. (A) Northern analysis of
the OLE1, OLE1p-PHO5, and
ANB1 transcripts in rox1 disruptants. Total RNA
samples were prepared from cells of the wild-type strain (SH5420) and
rox1 disruptant (SH5421) cultivated aerobically (lanes 1 and
2) or anaerobically (lanes 3 and 4) in YPDA medium. Equal amounts of
RNA (5 µg) were electrophoresed in a 1.5% agarose gel in the
presence of formaldehyde, transferred to a nylon filter, blotted, and
hybridized with probes consisting of 32P-labeled DNA
fragments containing OLE1, ANB1, and
PHO5 for detection of the transcripts of
OLE1p-PHO5 or ACT1 as an internal
control. The ANB1 probe also hybridized to the
TIF51A transcript, which is not repressed by Rox1p
(53). (B) Putative Rox1p binding sites in the
OLE1 promoter. Numbers indicate positions relative to the
first nucleotide of the initiation codon (+1). Lowercase letters,
nucleotides that differ from the consensus Rox1p-binding sequence
(3).
|
|
The 50-bp O2R element is sufficient and essential for
O2 repression of OLE1 transcription.
To
elucidate the Rox1p-independent O2 repression mechanism of
OLE1, we first identified the O2
signal-responsive region in the OLE1 promoter. The
OLE1 promoter was divided into three subregions, i.e., the
region harboring the FAR element and the regions upstream and
downstream of this region, and these regions were inserted into the
region upstream of the PHO84p-PHO5 reporter gene
in the activation and repression assay vector pRAV (31).
The transcription of the PHO84p-PHO5 reporter
gene is repressed when cells are cultivated under conditions whereby a
sufficient amount of Pi is used, such as YPDA medium
(31). The levels of expression of these reporter genes
were measured as rAPase activities under aerobic and anaerobic conditions (Fig. 2). Control experiments
with the ANB1p-PHO5 reporter gene (p1858)
validated this reporter assay system to monitor O2-mediated transcriptional repression. The rAPase activity from p1166 was derepressed 4.4-fold under anaerobic conditions compared with aerobic
conditions. Although p1787, which contains a FAR element, was not as
responsive to anaerobic conditions (rAPase activity was derepressed
1.4-fold), p1781, containing the downstream region of the FAR element,
responded significantly (rAPase activity was derepressed 9.7-fold). In
order to delineate the O2-regulated element in the 149-bp
OLE1p region of p1781, we further divided this region into
three subregions and determined which region responds to anaerobic
conditions. Only p1864 showed significant derepression of rAPase
activity (7.3-fold) under anaerobic conditions, indicating that the
50-bp OLE1p region (nt
356 to
307) is sufficient for
anaerobic derepression. Deletion of the 50-bp region from OLE1p (p1872) decreased the level of anaerobic derepression
from 4.4- to 1.4-fold, indicating that the 50-bp region is essential for anaerobic derepression of OLE1 transcription. We
therefore designated the 50-bp region as an O2-regulated
element (O2R). That the O2R element does not contain consensus
Rox1p-binding sites is consistent with a Rox1p-independent mechanism
for O2 repression of OLE1 transcription (Fig.
2). These results indicate that the O2R element is an anaerobic
upstream activation site and further imply that some anaerobically
responsive activators acting on the element exist. Thus, the system for
O2 repression of OLE1 transcription appears to
be similar to the mammalian HIF-1 hypoxia-sensing system, whose
regulation is mediated by transcriptional activator HIF-1
(51). On the other hand, the Rox1p-dependent O2 repression system is not parallel to the HIF-1
hypoxia-sensing system because it is mediated by transcriptional
repressor Rox1p, which binds to the upstream repression site of
O2-repressed genes (53). It is noted that a
homologue of HIF-1 is not found in S. cerevisiae
(21) and that the O2R element does not contain the
consensus core sequence, 5'-RCGTG-3', of HIF-1 binding sites (43).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 2.
The O2R element is present in the 356 to 307 region
of the OLE1 promoter. rAPase activity in cells of the
wild-type strain (SH5143) harboring the respective reporter genes
cultivated aerobically (+O2) or anaerobically
( O2) in YPDA medium was measured as described previously
(48). Numbers indicate the position relative to the first
nucleotide of the initiation codon (+1) of OLE1.
PHO84 promoter sequences (nt 272 to 1) contain binding
site E (nt 262 to 257) for the transactivator Pho4p and two
putative TATA boxes (nt 122 and 99). Shaded boxes, structural
regions of PHO5. The ANB1p-PHO5
reporter gene was used to verify anaerobic conditions. Error bars,
standard deviations determined from a minimum of three independent
measurements. The actual values of rAPase activity with their standard
deviations are indicated. Other symbols are the same as those described
for Fig. 1B.
|
|
5'-GATAA-3' sequence in the O2R element is important for
O2 repression.
What is the transcriptional activator
acting on the O2R element? We searched for binding motifs of
already-known transcriptional regulators on the O2R element and found
the 5'-GATAA-3' sequence, which is the binding site for GATA family
transcriptional activation factors Gln3p and probably Gat1p (Fig.
3A) (5, 13). Although the
5'-GATAA-3' sequence is on the complementary strand of the O2R element,
it is known that the 5'-GATAA-3' sequence functions in an
orientation-independent manner (12). The GATA family of DNA-binding proteins are present in organisms from S. cerevisiae to humans (29, 30). These binding
proteins contain one or more characteristic C4 zinc finger
motifs and bind to DNA sequences with sequence GATA at their
cores (11). In vertebrates, six GATA factors, GATA-1,
GATA-2, GATA-3, GATA-GT1, GATA-GT2, and GATA-5, have been
identified and are involved in regulation of various genes such as
those encoding globins, erythropoietin receptors, preproendothelin-1,
T-cell receptors, and the gastric proton pump (29). To
determine whether the 5'-GATAA-3' sequence on the O2R element functions
in O2 repression, we mutated the 5'-GATAA-3' sequence
to 5'-ACGCC-3'. As shown in Fig. 3B, this mutation resulted in a
decrease in the level of anaerobic derepression from 7.3- to 3.3-fold,
indicating that the 5'-GATAA-3' sequence is important in
O2 repression. Since it is known that there are only four
GATA factors, i.e., transcriptional activators Gln3p and Gat1p and transcriptional repressors Dal80p and Deh1p, in S. cerevisiae (11), Gln3p and Gat1p could be candidates
for the transcriptional activator acting on the O2R element. These four
proteins respond to the nitrogen source signal to regulate nitrogen
catabolite-repressed genes (11) but have not been reported
to be involved in transcriptional regulation by O2 or UFAs.
However, in vertebrates, GATA-1 has been demonstrated to play a major
role in the regulation of various specific erythroid genes, for
example, genes encoding globins and heme biosynthetic enzymes involved
in terminal erythroid differentiation in vivo (14, 36, 37, 47,
49, 50). This finding appears to imply a relationship between
GATA factors and O2 signals.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 3.
(A) The O2R element contains a 5'-GATAA-3' sequence
(arrow) on the complementary strand. (B) The 5'-GATAA-3' sequence plays
an important role in O2 repression. Dotted box, O2R element
(nt 356 to 307); solid box, O2R in which the 5'-GATAA-3' sequence
is changed to 5'-ACGCC-3' by site-directed mutagenesis. The conditions
used for measurement of rAPase activity in cells of the wild-type
strain (SH5143) harboring the respective reporter genes and the symbols
employed are as described in the legend to Fig. 2.
|
|
In
S. cerevisiae, transcription of
ATF1, encoding
alcohol acetyltransferase, is also repressed by O
2 and UFA
(
18). Fujiwara
et al. identified a 51-bp region (nt

150
to

100) responsible
for O
2 repression and an 18-bp region
(nt

85 to

68) responsible
for UFA repression of
ATF1
(
17). The O
2-responsive 51-bp region
contains
a Rox1p binding site, and O
2 repression was partially
abolished in the
rox1 null mutant (
17). There
is no homology
between the O2R element and the 51-bp region of
ATF1, and the
51-bp region does not contain the 5'-GATAA-3'
sequence. From these
facts, we conclude that the O
2
repression mechanism of
OLE1 transcription
is different from
that of
ATF1 transcription.
O2 and UFA signals act on the O2R element.
To
further clarify the relationship between O2 and UFA
repression mechanisms, we investigated the effect of UFAs on anaerobic derepression of OLE1 transcription. Northern blot analysis
showed that anaerobic derepression of OLE1 transcription
(Fig. 4A, lanes 1 and 2) did not occur in
the presence of UFA (Fig. 4A, lanes 3 and 4). This suggests that UFA
repression is epistatic to anaerobic derepression. From a physiological
viewpoint, this result is reasonable because, if there is a sufficient
amount of UFA in the medium, cells do not have to produce UFA even
under anaerobic conditions.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 4.
(A) Anaerobic derepression of OLE1
transcription is repressed by oleic acid. Cells of the wild-type strain
(SH5141) were inoculated into YPDA medium (lanes 1 and 2) or YPDA
medium containing 1 mM oleic acid (lanes 3 and 4) and cultivated at
30°C aerobically (lanes 1 and 3) or anaerobically (lanes 2 and 4).
Total RNA was prepared from cells in the logarithmic growth phase. The
RNA samples (each 10 µg of RNA) were subjected to Northern blot
hybridization as described in the legend to Fig. 1A. (B) The O2R
element is responsible for repression by UFA. Cells of SH5143 (wild
type) harboring one copy of the respective reporter genes integrated at
the ura3 locus were cultivated aerobically without oleic
acid (dotted bars), anaerobically without oleic acid (solid bars),
aerobically with oleic acid (open bars), or anaerobically with oleic
acid (hatched bars) and subjected to an rAPase assay as described in
the legend to Fig. 2.
|
|
However, these results are different from those of Kwast et al.
(
26). They reported that
OLE1 transcription is
derepressed
when cells are shifted to anaerobic conditions even in the
presence
of UFAs. We think that this difference may be due to the
source
or concentration of UFA because we used free oleic acid at a
concentration
of 1 mM while they used Tween 80, which is an oleic acid
ester,
at a concentration of 0.1% (vol/vol) (approximately 0.6 mM).
Our
experimental conditions might be more highly repressive than
theirs.
If an excess amount of UFA is incorporated by cells under their
experimental conditions, the anaerobic derepression may not occur,
as
was the case in our
study.
As UFA repression of
OLE1 transcription depends on the FAR
element under aerobic conditions, the FAR element has been considered
to be the sole element which responds to UFA signals in the
OLE1 promoter (
10). To determine whether
UFA repression of
OLE1 transcription
under anaerobic
conditions also depends on the FAR element, we
examined the effect of
UFAs on the O2R element only. Unexpectedly,
despite not being included
within the FAR element, the O2R element
was responsible for this UFA
repression (Fig.
4B). The fact that
the short 50-bp O2R element
responds to both O
2 and UFA signals
implies that the signal
transduction pathways of O
2 and UFA merge
in the ultimate
step of the
pathways.
Our data together with those of other researchers (
10)
suggest that the FAR element plays a major role in the production
of
UFAs under aerobic conditions (Fig.
2; p1787), while the O2R
element
plays a major role under anaerobic conditions (Fig.
2;
p1864) because
it has a higher potential for transcriptional activation
than the FAR
element. Based on these findings we propose a model
for
OLE1
transcriptional regulation by O
2 and UFA signals (Fig.
5). According to our model, under aerobic
conditions in the absence
of UFAs,
OLE1 transcription is
derepressed mainly by unknown transcriptional
activators acting on the
FAR element. Under anaerobic conditions
in the absence of UFAs, a
different transcriptional activator
which acts on the newly identified
O2R element plays a major role
in further derepression of
OLE1 transcription for the efficient
use of limiting
O
2 by cells. The GATA factors Gln3p and Gat1p
are
candidates for the unknown activator. The anaerobic signal
is
transmitted in a Rox1p-independent manner. The mitochondrial
respiratory chain is involved in the anaerobic induction of
OLE1 transcription, and cytochrome
c oxidase is
likely the hemoprotein
sensor for O
2 (
26). On
the other hand, under aerobic conditions
in the presence of UFAs, the
UFAs are transported into cells by
an unidentified transporter located
at the cellular membrane and
repress
OLE1 transcription by
inhibiting activators acting on
the FAR element. Under anaerobic
conditions in the presence of
UFAs, the UFAs repress
OLE1
transcription by inhibiting both FAR-
and O2R-dependent transcriptional
activators.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 5.
A model for signal transduction pathways of
O2 and UFA regulating OLE1 transcription. X,
unknown transcriptional activators acting on the FAR element; M and C,
mitochondrial respiratory chain and cytochrome c oxidase,
respectively; T, unknown fatty acid transporter located at the cellular
membrane. Arrows and blunt arrows, positive and negative interactions,
respectively. UFA repression is epistatic to anaerobic derepression
(thick line). See Discussion for details.
|
|
In
S. cerevisiae, the hypoxic genes fall into at least two
classes (
53). One class comprises single-copy genes and
includes
OLE1,
ERG11,
CPR1,
HEM13, and
SUT1. These genes encode enzymes
expressed at low levels under aerobic conditions, but expression
levels
increase as oxygen becomes limiting. The second class represents
gene
pairs, where one gene is expressed under aerobic conditions
while the
other gene is expressed under hypoxic conditions. These
gene pairs
include
COX5a/COX5b,
CYC1/CYC7,
AAC2/AAC3, and
TIF51a/ANB1 (
25,
53).
The products of gene pairs
COX5a/COX5b and
CYC1/CYC7 have been shown to influence the maximal turnover
number of holocytochrome
c oxidase, with the hypoxic
isoforms increasing this rate (
2,
7). On the basis of
these facts, we argue that cells regulate
the expression of single-copy
hypoxic genes by switching on regulatory
elements of the genes, such as
the FAR and O2R elements in the
case of
OLE1, instead of
switching on the expression of the gene
pairs responding to
environmental O
2 signals.
 |
ACKNOWLEDGMENTS |
We thank Y. Mukai of our laboratory for valuable comments.
This work was partially supported by a Grant-in-Aid for Scientific
Research (no. 08456054) to S.H. from the Ministry of Education, Science, Sports and Culture of Japan.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biotechnology, Graduate School of Engineering, Osaka University, 2-1 Yamadaoka, Suita, Osaka 565-0871, Japan. Phone: 81-6-6879-7420. Fax:
81-6-6879-7421. E-mail:
harashima{at}gen.bio.eng.osaka-u.ac.jp.
 |
REFERENCES |
| 1.
|
Alexandre, H.,
I. Rousseaux, and C. Charpentier.
1994.
Relationship between ethanol tolerance, lipid composition and plasma membrane fluidity in Saccharomyces cerevisiae and Kloeckera apiculata.
FEMS Microbiol. Lett.
124:17-22[CrossRef][Medline].
|
| 2.
|
Allen, L. A.,
X. J. Zhao,
W. Caughey, and R. O. Poyton.
1995.
Isoforms of yeast cytochrome c oxidase subunit V affect the binuclear reaction center and alter the kinetics of interaction with the isoforms of yeast cytochrome c.
J. Biol. Chem.
270:110-118[Abstract/Free Full Text].
|
| 3.
|
Balasubramanian, B.,
C. V. Lowry, and R. S. Zitomer.
1993.
The Rox1 repressor of the Saccharomyces cerevisiae hypoxic genes is a specific DNA-binding protein with a high-mobility-group motif.
Mol. Cell. Biol.
13:6071-6078[Abstract/Free Full Text].
|
| 4.
|
Berben, G.,
J. Dumont,
V. Gilliquet,
P. A. Bolle, and F. Hilger.
1991.
The YDp plasmids: a uniform set of vectors bearing versatile gene disruption cassettes for Saccharomyces cerevisiae.
Yeast
7:475-477[CrossRef][Medline].
|
| 5.
|
Blinder, D., and B. Magasanik.
1995.
Recognition of nitrogen-responsive upstream activation sequences of Saccharomyces cerevisiae by the product of the GLN3 gene.
J. Bacteriol.
177:4190-4193[Abstract/Free Full Text].
|
| 6.
|
Bossie, M. A., and C. E. Martin.
1989.
Nutritional regulation of yeast -9 fatty acid desaturase activity.
J. Bacteriol.
171:6409-6413[Abstract/Free Full Text].
|
| 7.
|
Burke, P. A., and R. O. Poyton.
1998.
Structure/function of oxygen-regulated isoforms in cytochrome c oxidase.
J. Exp. Biol.
201:1163-1175[Abstract].
|
| 8.
|
Carratu, L.,
S. Franceschelli,
C. L. Pardini,
G. S. Kobayashi,
I. Horvath,
L. Vigh, and B. Maresca.
1996.
Membrane lipid perturbation modifies the set point of the temperature of heat shock response in yeast.
Proc. Natl. Acad. Sci. USA
93:3870-3875[Abstract/Free Full Text].
|
| 9.
|
Choi, J. Y., and C. E. Martin.
1999.
The Saccharomyces cerevisiae FAT1 gene encodes an acyl-CoA synthetase that is required for maintenance of very long chain fatty acid levels.
J. Biol. Chem.
274:4671-4683[Abstract/Free Full Text].
|
| 10.
|
Choi, J. Y.,
J. Stukey,
S. Y. Hwang, and C. E. Martin.
1996.
Regulatory elements that control transcription activation and unsaturated fatty acid-mediated repression of the Saccharomyces cerevisiae OLE1 gene.
J. Biol. Chem.
271:3581-3589[Abstract/Free Full Text].
|
| 11.
|
Coffman, J. A.,
R. Rai,
D. M. Loprete,
T. Cunningham,
V. Svetlov, and T. G. Cooper.
1997.
Cross regulation of four GATA factors that control nitrogen catabolic gene expression in Saccharomyces cerevisiae.
J. Bacteriol.
179:3416-3429[Abstract/Free Full Text].
|
| 12.
|
Cunningham, T. S.,
R. A. Dorrington, and T. G. Cooper.
1994.
The UGA4 UASNTR site required for GLN3-dependent transcriptional activation also mediates DAL80-responsive regulation and DAL80 protein binding in Saccharomyces cerevisiae.
J. Bacteriol.
176:4718-4725[Abstract/Free Full Text].
|
| 13.
|
Cunningham, T. S.,
V. V. Svetlov,
R. Rai,
W. Smart, and T. G. Cooper.
1996.
Gln3p is capable of binding to UASNTR elements and activating transcription in Saccharomyces cerevisiae.
J. Bacteriol.
178:3470-3479[Abstract/Free Full Text].
|
| 14.
|
Evans, T., and G. Felsenfeld.
1989.
The erythroid-specific transcription factor Eryf1: a new finger protein.
Cell
58:877-885[CrossRef][Medline].
|
| 15.
|
Faergeman, N. J.,
C. C. DiRusso,
A. Elberger,
J. Knudsen, and P. N. Black.
1997.
Disruption of the Saccharomyces cerevisiae homologue to the murine fatty acid transport protein impairs uptake and growth on long-chain fatty acids.
J. Biol. Chem.
272:8531-8538[Abstract/Free Full Text].
|
| 16.
|
Fujimori, K.,
S. Anamnart,
Y. Nakagawa,
S. Sugioka,
D. Ohta,
Y. Oshima,
Y. Yamada, and S. Harashima.
1997.
Isolation and characterization of mutations affecting expression of the 9- fatty acid desaturase gene, OLE1, in Saccharomyces cerevisiae.
FEBS Lett.
413:226-230[CrossRef][Medline].
|
| 17.
|
Fujiwara, D.,
O. Kobayashi,
H. Yoshimoto,
S. Harashima, and Y. Tamai.
1999.
Molecular mechanism of the multiple regulation of the Saccharomyces cerevisiae ATF1 gene encoding alcohol acetyltransferase.
Yeast
15:1183-1197[CrossRef][Medline].
|
| 18.
|
Fujiwara, D.,
H. Yoshimoto,
H. Sone,
S. Harashima, and Y. Tamai.
1998.
Transcriptional co-regulation of Saccharomyces cerevisiae alcohol acetyltransferase gene, ATF1 and -9 fatty acid desaturase gene, OLE1 by unsaturated fatty acids.
Yeast
14:711-721[CrossRef][Medline].
|
| 19.
|
Gallwitz, D., and I. Sures.
1980.
Structure of a split yeast gene: complete nucleotide sequence of the actin gene in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
77:2546-2550[Abstract/Free Full Text].
|
| 20.
|
Gonzalez, C. I., and C. E. Martin.
1996.
Fatty acid-responsive control of mRNA stability.
J. Biol. Chem.
271:25801-25809[Abstract/Free Full Text].
|
| 21.
|
Guillemin, K., and M. A. Krasnow.
1997.
The hypoxic response: huffing and HIFing.
Cell
89:9-12[CrossRef][Medline].
|
| 22.
|
Hazel, J. R.
1995.
Thermal adaptation in biological membranes: is homeoviscous adaptation the explanation?
Annu. Rev. Physiol.
57:19-42[Medline].
|
| 23.
|
Hereford, L.,
K. Fahrner,
J. Woolford, Jr.,
M. Rosbash, and D. B. Kaback.
1979.
Isolation of yeast histone genes H2A and H2B.
Cell
18:1261-1271[CrossRef][Medline].
|
| 24.
|
Ito, H.,
Y. Fukuda,
K. Murata, and A. Kimura.
1983.
Transformation of intact yeast cells treated with alkali cations.
J. Bacteriol.
153:163-168[Abstract/Free Full Text].
|
| 25.
|
Kwast, K. E.,
P. V. Burke, and R. O. Poyton.
1998.
Oxygen sensing and the transcriptional regulation of oxygen-responsive genes in yeast.
J. Exp. Biol.
201:1177-1195[Abstract].
|
| 26.
|
Kwast, K. E.,
P. V. Burke,
B. T. Staahl, and R. O. Poyton.
1999.
Oxygen sensing in yeast: evidence for the involvement of the respiratory chain in regulating the transcription of a subset of hypoxic genes.
Proc. Natl. Acad. Sci. USA
96:5446-5451[Abstract/Free Full Text].
|
| 27.
|
Lowry, C. V.,
M. E. Cerdan, and R. S. Zitomer.
1990.
A hypoxic consensus operator and a constitutive activation region regulate the ANB1 gene of Saccharomyces cerevisiae.
Mol. Cell. Biol.
10:5921-5926[Abstract/Free Full Text].
|
| 28.
|
Lowry, C. V., and R. H. Lieber.
1986.
Negative regulation of the Saccharomyces cerevisiae ANB1 gene by heme, as mediated by the ROX1 gene product.
Mol. Cell. Biol.
6:4145-4148[Abstract/Free Full Text].
|
| 29.
|
Maeda, M.,
K. Kubo,
T. Nishi, and M. Futai.
1996.
Roles of gastric GATA DNA-binding proteins.
J. Exp. Biol.
199:513-520[Abstract].
|
| 30.
|
Marzluf, G. A.
1997.
Genetic regulation of nitrogen metabolism in the fungi.
Microbiol. Mol. Biol. Rev.
61:17-32[Abstract].
|
| 31.
|
Mizuno, T.,
N. Nakazawa,
P. Remgsamrarn,
T. Kunoh,
Y. Oshima, and S. Harashima.
1998.
The Tup1-Ssn6 general repressor is involved in repression of IME1 encoding a transcriptional activator of meiosis in Saccharomyces cerevisiae.
Curr. Genet.
33:239-247[CrossRef][Medline].
|
| 32.
|
Mortimer, R. K.,
C. R. Contopoulou, and J. S. King.
1992.
Genetic and physical maps of Saccharomyces cerevisiae, edition 11.
Yeast
8:817-902[CrossRef][Medline].
|
| 33.
|
Mortimer, R. K., and J. R. Johnston.
1986.
Genealogy of principal strains of the yeast genetic stock center.
Genetics
113:35-43[Abstract/Free Full Text].
|
| 34.
|
Mukai, Y.,
S. Harashima, and Y. Oshima.
1993.
Function of the Ste signal transduction pathway for mating pheromones sustains MAT 1 transcription in Saccharomyces cerevisiae.
Mol. Cell. Biol.
13:2050-2060[Abstract/Free Full Text].
|
| 35.
|
Ntambi, J. M.
1999.
Regulation of stearoyl-CoA desaturase by polyunsaturated fatty acids and cholesterol.
J. Lipid Res.
40:1549-1558[Abstract/Free Full Text].
|
| 36.
|
Orkin, S. H.
1992.
GATA-binding transcription factors in hematopoietic cells.
Blood
80:575-581[Free Full Text].
|
| 37.
|
Pevny, L.,
M. C. Simon,
E. Robertson,
W. H. Klein,
S. F. Tsai,
V. D'Agati,
S. H. Orkin, and F. Costantini.
1991.
Erythroid differentiation in chimaeric mice blocked by a targeted mutation in the gene for transcription factor GATA-1.
Nature
349:257-260[CrossRef][Medline].
|
| 38.
|
Rose, M. D.,
F. Winston, and P. Hieter.
1990.
Methods in yeast genetics: a laboratory manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 39.
|
Sakumoto, N.,
Y. Mukai,
K. Uchida,
T. Kouchi,
J. Kuwajima,
Y. Nakagawa,
S. Sugioka,
E. Yamamoto,
T. Furuyama,
H. Mizubuchi,
N. Ohsugi,
T. Sakuno,
K. Kikuchi,
I. Matsuoka,
N. Ogawa,
Y. Kaneko, and S. Harashima.
1999.
A series of protein phosphatase gene disruptants in Saccharomyces cerevisiae.
Yeast
15:1669-1679[CrossRef][Medline].
|
| 40.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 41.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 42.
|
Schaffer, J. E., and H. F. Lodish.
1994.
Expression cloning and characterization of a novel adipocyte long chain fatty acid transport protein.
Cell
79:427-436[CrossRef][Medline].
|
| 43.
|
Semenza, G. L.,
B. H. Jiang,
S. W. Leung,
R. Passantino,
J. P. Concordet,
P. Maire, and A. Giallongo.
1996.
Hypoxia response elements in the aldolase A, enolase 1, and lactate dehydrogenase A gene promoters contain essential binding sites for hypoxia-inducible factor 1.
J. Biol. Chem.
271:32529-32537[Abstract/Free Full Text].
|
| 44.
|
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27[Abstract/Free Full Text].
|
| 45.
|
Stewart, L. C., and M. P. Yaffe.
1991.
A role for unsaturated fatty acids in mitochondrial movement and inheritance.
J. Cell Biol.
115:1249-1257[Abstract/Free Full Text].
|
| 46.
|
Stukey, J. E.,
V. M. McDonough, and C. E. Martin.
1990.
The OLE1 gene of Saccharomyces cerevisiae encodes the 9 fatty acid desaturase and can be functionally replaced by the rat stearoyl-CoA desaturase gene.
J. Biol. Chem.
265:20144-20149[Abstract/Free Full Text].
|
| 47.
|
Tanabe, A.,
T. Furukawa,
Y. Ogawa,
M. Yamamoto,
N. Hayashi,
R. Tokunaga, and S. Taketani.
1997.
Involvement of the transcriptional factor GATA-1 in regulation of expression of coproporphyrinogen oxidase in mouse erythroleukemia cells.
Biochem. Biophys. Res. Commun.
233:729-736[CrossRef][Medline].
|
| 48.
|
Toh-e, A.,
Y. Ueda,
S. I. Kakimoto, and Y. Oshima.
1973.
Isolation and characterization of acid phosphatase mutants in Saccharomyces cerevisiae.
J. Bacteriol.
113:727-738[Abstract/Free Full Text].
|
| 49.
|
Tsai, S. F.,
D. I. Martin,
L. I. Zon,
A. D. D'Andrea,
G. G. Wong, and S. H. Orkin.
1989.
Cloning of cDNA for the major DNA-binding protein of the erythroid lineage through expression in mammalian cells.
Nature
339:446-451[CrossRef][Medline].
|
| 50.
|
Vieille-Grosjean, I., and P. Huber.
1995.
Transcription factor GATA-1 regulates human HOXB2 gene expression in erythroid cells.
J. Biol. Chem.
270:4544-4550[Abstract/Free Full Text].
|
| 51.
|
Wang, G. L., and G. L. Semenza.
1993.
General involvement of hypoxia-inducible factor 1 in transcriptional response to hypoxia.
Proc. Natl. Acad. Sci. USA
90:4304-4308[Abstract/Free Full Text].
|
| 52.
|
Watkins, P. A.,
J. F. Lu,
S. J. Steinberg,
S. J. Gould,
K. D. Smith, and L. T. Braiterman.
1998.
Disruption of the Saccharomyces cerevisiae FAT1 gene decreases very long-chain fatty acyl-CoA synthetase activity and elevates intracellular very long-chain fatty acid concentrations.
J. Biol. Chem.
273:18210-18219[Abstract/Free Full Text].
|
| 53.
|
Zitomer, R. S.,
P. Carrico, and J. Deckert.
1997.
Regulation of hypoxic gene expression in yeast.
Kidney Int.
51:507-513[Medline].
|
Journal of Bacteriology, January 2001, p. 745-751, Vol. 183, No. 2
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.2.745-751.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kandasamy, P., Vemula, M., Oh, C.-S., Chellappa, R., Martin, C. E.
(2004). Regulation of Unsaturated Fatty Acid Biosynthesis in Saccharomyces: THE ENDOPLASMIC RETICULUM MEMBRANE PROTEIN, Mga2p, A TRANSCRIPTION ACTIVATOR OF THE OLE1 GENE, REGULATES THE STABILITY OF THE OLE1 mRNA THROUGH EXOSOME-MEDIATED MECHANISMS. J. Biol. Chem.
279: 36586-36592
[Abstract]
[Full Text]
-
Krishnamurthy, S., Plaine, A., Albert, J., Prasad, T., Prasad, R., Ernst, J. F.
(2004). Dosage-dependent functions of fatty acid desaturase Ole1p in growth and morphogenesis of Candida albicans. Microbiology
150: 1991-2003
[Abstract]
[Full Text]
-
Sahara, T., Goda, T., Ohgiya, S.
(2002). Comprehensive Expression Analysis of Time-dependent Genetic Responses in Yeast Cells to Low Temperature. J. Biol. Chem.
277: 50015-50021
[Abstract]
[Full Text]
-
Jiang, Y., Vasconcelles, M. J., Wretzel, S., Light, A., Gilooly, L., McDaid, K., Oh, C.-S., Martin, C. E., Goldberg, M. A.
(2002). Mga2p Processing by Hypoxia and Unsaturated Fatty Acids in Saccharomyces cerevisiae: Impact on LORE-Dependent Gene Expression. Eukaryot Cell
1: 481-490
[Abstract]
[Full Text]
-
Chellappa, R., Kandasamy, P., Oh, C.-S., Jiang, Y., Vemula, M., Martin, C. E.
(2001). The Membrane Proteins, Spt23p and Mga2p, Play Distinct Roles in the Activation of Saccharomyces cerevisiae OLE1 Gene Expression. FATTY ACID-MEDIATED REGULATION OF Mga2p ACTIVITY IS INDEPENDENT OF ITS PROTEOLYTIC PROCESSING INTO A SOLUBLE TRANSCRIPTION ACTIVATOR. J. Biol. Chem.
276: 43548-43556
[Abstract]
[Full Text]
-
Jiang, Y., Vasconcelles, M. J., Wretzel, S., Light, A., Martin, C. E., Goldberg, M. A.
(2001). MGA2 Is Involved in the Low-Oxygen Response Element-Dependent Hypoxic Induction of Genes in Saccharomyces cerevisiae. Mol. Cell. Biol.
21: 6161-6169
[Abstract]
[Full Text]