 |
INTRODUCTION |
Agrobacterium tumefaciens
VirB11 is a member of a family of ATPases widely distributed among
members of the domains Bacteria and Archaea
(38, 48, 67). Mutational studies have established the
importance of VirB11 homologs for translocation of macromolecules across the cell envelope in association with type IV secretion (17, 29, 32, 44, 52) and competence (1) systems and type
II protein secretion and pilus biogenesis systems (54). These proteins hydrolyze ATP, as demonstrated for VirB11
(17), TrbB of the IncP plasmid RP4 (38), TrwD
of the IncW plasmid R388 (38, 52), and HP0525 of the
cag pathogenicity island of Helicobacter pylori
(38). Interestingly, recent electron microscopy studies
determined that the last three proteins assemble as hexameric rings in
solution (37, 38), and a crystallography study identified
a binary complex of HP0525 bound to ADP as a two-tiered hexameric ring
with a central cavity of 50 nm (67). This structural
information and the demonstrated importance of the VirB11 ATPases for
assembly or function of supramolecular surface organelles has prompted
the proposal that the VirB11 ATPases function as chaperones for
trafficking of unfolded substrates across the cytoplasmic membrane.
VirB11 is one of 11 VirB proteins required for efficient assembly of
the A. tumefaciens transfer DNA (T-DNA) transfer system (7). This type IV secretion system translocates oncogenic
T-DNA and effector proteins to susceptible plant cells during the
course of A. tumefaciens infection (15). The
T-DNA transfer system is composed of a transenvelope channel for
substrate translocation and the T pilus for establishment of A. tumefaciens contacts with susceptible plant cells (15,
35). Like HP0525, VirB11 self-assembles as a higher-order
homomultimeric complex via domains in its N- and C-terminal halves
(49, 50, 69). VirB11 localizes at the inner face of the
cytoplasmic membrane independently of interactions with other VirB
proteins, and studies of mutant proteins with defects in the nucleoside
triphosphate binding pocket (Walker A motif) suggest that this membrane
interaction is modulated by ATP binding or hydrolysis
(51). No heterologous protein contacts have yet been
reported, but VirB11 is stabilized by the production of other VirB
proteins, most notably the outer membrane VirB7 lipoprotein-VirB9
protein complex (28, 51). In addition, dominant virB11 mutations are suppressed by overproduction of VirB
proteins, including the outer membrane protein VirB9, the bitopic
cytoplasmic membrane protein VirB10, and VirB11 itself (7, 28,
69). The current data, therefore, support a model in which the
VirB11 homooligomer, probably configured as a homohexameric ring, is situated at the cytoplasmic membrane in direct contact both with the
lipid bilayer and with subunits of the translocation channel.
Analyses of virB11 null mutants have established the
importance of VirB11 for the transfer of several secretion substrates (7, 17, 29, 62). These substrates include (i) the T-DNA transfer intermediate, which minimally consists of the VirD2
endonuclease attached covalently to the 5' end of a single strand of
T-DNA (T-strand) (60, 71); (ii) the VirE2
single-stranded-DNA-binding protein (SSB) and another virulence factor
termed VirF (16, 62); and (iii) the mobilizable IncQ
plasmid RSF1010 (9, 11, 29). Interestingly, wild-type
A. tumefaciens harboring an RSF1010 derivative inefficiently
transfers the T-DNA to plants, whereas the inhibitory effect of this
IncQ plasmid on T-DNA transfer is suppressed by overexpression of
virB9, virB10, and virB11 (64). These early findings led to the suggestion that VirB9, VirB10, and
VirB11 complex formation is rate limiting for assembly of functional
T-DNA transfer machines in a cell (64). More recent studies showed that the IncQ plasmid preferentially blocks VirE2 export
but is also inhibitory for T-strand-VirD2 export, suggesting that the
secretion substrates compete for available transfer machines (9,
60).
VirB11 also is thought to contribute to assembly of the T-DNA transfer
system. The principal finding supporting a morphogenetic function is
that virB11 null mutants fail to elaborate T pili (41,
53). However, nonpolar mutations of all 11 virB genes abolish T-pilus formation (41, 53), and no studies have
distinguished direct from indirect contributions of the VirB proteins
to pilus morphogenesis.
In this study, we characterized the effects of various
virB11 dominant or recessive alleles on T-pilus formation
and substrate transfer. Our findings support a model whereby
ATP-dependent activities of VirB11 are required at two distinct stages
for translocation, biogenesis of the T pilus, and selection of
secretion substrates. The functional importance of the T pilus is
discussed in the context of the finding that certain virB11
mutations uncouple T-pilus production from substrate translocation.
| |
MATERIALS AND METHODS |
Bacterial strains, plasmids and growth conditions.
Table
1 lists the bacterial strains and
plasmids used in this study. Conditions and media for growth of
A. tumefaciens and Escherichia coli and for
induction of A. tumefaciens vir genes in induction
medium (IM) containing acetosyringone (AS) have been described
previously (69). Plasmids were maintained in E. coli and A. tumefaciens by addition of carbenicillin
(100 µg/ml), kanamycin (100 µg/ml), tetracycline (5 µg/ml),
gentamycin (50 µg/ml), or spectinomycin (500 µg/ml) to the growth
medium. ColE1 plasmids were introduced into A. tumefaciens
by ligation to the IncP plasmid pSW172 or pXZ151; these cointegrate
plasmids are given the ColE1 name plus a B to denote ligation to a
broad-host-range replicon.
Insertion mutagenesis of virB11.
In-frame
insertions of a four-residue sequence (HMVD) were introduced at
~20-residue intervals along the length of VirB11 as follows. Plasmid
pSR1, a pBSIIKS+ derivative with
PvirB::virB11, was digested with
XhoI and SalI and religated to destroy these
restriction sites, yielding pJC902. Single-stranded pJC902 served as a
template for introduction of an XhoI site immediately
following the virB11 TAG stop codon with the oligonucleotide
CCTAAATCAATAGCTCGAGTAGCTGTAACC (the XhoI site is underlined; stop codons are in
boldface) according to the method of Kunkel (40). The
resulting plasmid, pJC903, served as the template for introduction of
tandem, in-frame NdeI-SalI restriction sites
(CATATGGTCGAC) at ~60-bp intervals along the virB11 gene by oligonucleotide-directed mutagenesis. Mutant
alleles were identified by restriction enzyme digestion, and the
insertion mutations were confirmed by sequencing across the entire
virB11 gene. Plasmids expressing the mutant alleles were
designated pJC8xxx, where xxx is the position of the residue relative
to the beginning of the protein that immediately precedes the
four-residue insertion.
Protein analysis, immunoblotting, and cell fractionation.
Proteins were resolved by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) or a Tricine-SDS-PAGE system as previously
described (50). Vir proteins were visualized by SDS-PAGE,
protein transfer to nitrocellulose membranes, and immunoblot development with goat anti-rabbit antibodies conjugated to alkaline phosphatase and histochemical substrates. For enhanced sensitivity, blots were alternatively developed with anti-rabbit antibodies conjugated to horseradish peroxidase, and antibody-antigen interactions were visualized by chemiluminescence (Amersham, Arlington Heights, Ill.). Proteins were loaded on a per-cell equivalent basis to compare
VirB protein abundance in different strains. Molecular size markers
were from GIBCO-BRL (Grand Island, N.Y.). Antibody specificities were
previously documented for the VirB1, VirB2, VirB4, VirB5, VirB7 through
VirB11, and VirE2 proteins (20, 50, 53, 68).
T-pilus isolation and sucrose fractionation.
T pili were
isolated as previously described (53). Briefly, A. tumefaciens strains were grown to an optical density at 600 nm
OD600 of 0.5 in MG/L medium (27) at
28°C. The cells were pelleted, diluted fivefold in IM, and incubated
for 6 h at 22°C. Two hundred microliters of AS-induced culture
was spread on IM agar plates, and the plates were incubated for 3 days
at 18°C. The cells were then gently scraped off the plates in 50 mM
KH2PO4 buffer, pH 5.5 (buffer A), and pelleted
by centrifugation at 14,000 × g for 15 min at room
temperature. The supernatant was removed, and the cell pellet was
resuspended in 50 mM phosphate buffer. This suspension was passed
through a 25-gauge needle 10 times to collect flagella, pili, and
surface proteins. The sheared bacterial cells were pelleted by
centrifugation at 14,000 × g for 30 min at 4°C. The
remaining supernatant was filtered through a 0.22-µm-pore-size cellulose acetate membrane to remove unpelleted cells. When necessary, the culture supernatants and sheared materials were concentrated with
trichloroacetic acid (53).
T pili were harvested by centrifugation of filtered exocellular
material at 100,000 × g for 1 h at 4°C. The
pelleted material was analyzed by SDS-PAGE and immunostaining. The
material was also solubilized in buffer A and loaded onto a 20 to 70%
linear sucrose density gradient (5 ml) prepared with buffer A. The T pili were then fractionated by ultracentrifugation in an SW55 Beckman
rotor at 80,000 × g for 20 h at 4°C. Fractions
(0.5 ml) were collected from the bottoms of the centrifugation
tubes, analyzed for the presence of Vir proteins by
immunoblotting, and analyzed for other proteins by silver staining
(53).
Conjugation assay.
The RSF1010 derivative pML122
Km was
introduced into various A. tumefaciens donor strains by
diparental mating with E. coli strain S17-1(pML122 Km)
(29, 58). A. tumefaciens strains carrying
pML122Km were mated with an Spcr derivative of
A348 by use of a protocol described previously (10).
Briefly, mid-log-phase (OD600 = 0.5) cells were
harvested and incubated in liquid IM containing AS (200 µM) at 22°C
for 6 h to induce expression of the vir genes. Five
microliters each of preinduced donor and recipient cells was
mixed on a cellulose acetate filter on an IM agar plate containing AS
(200 µM), and the plate was incubated at 18°C for 3 days. Mating
mixtures were recovered from filters in IM medium and directly plated
onto MG/L medium selective for transconjugants, or cultures were
serially diluted and plated for determination of transconjugant and
donor cell numbers. Frequencies of transfer were estimated as
transconjugants recovered per donor cell. Each assay was performed in
triplicate, and three or more independent experiments were performed.
Virulence assay.
A. tumefaciens strains were
tested for virulence by inoculating wound sites of Kalanchoe
daigremontiana leaves (69). Controls for the
tumorigenesis assay included coinoculating the same leaf with wild-type
A348 (virulent) and PC1011 (avirulent) strains. Each experiment was
repeated at least three times for each strain on separate leaves.
| |
RESULTS |
Effects of Walker A mutations on T-pilus production.
A.
tumefaciens strains synthesizing mutant forms of the VirB4 or
VirB11 ATPases with defects in the conserved nucleoside triphosphate binding sites (Walker A domain) fail to export T-DNA to plant cells
(6, 30, 51, 61). To determine whether strains synthesizing these mutant proteins elaborate T pili, exocellular material was examined for the presence of VirB2 pilin (42) and the
T-pilus-associated proteins VirB5 (53, 55) and VirB7
lipoprotein (53). As shown in Fig. 1A and
2A, mutant
strains with nonpolar deletions of virB4 (strain PC1004) or
virB11 (strain PC1011) engineered to express wild-type
virB4 or virB11 from an IncP replicon possess
abundant amounts of exocellular VirB2 and VirB5 in the exocellular
fractions. These strains translocate substrates at wild-type
frequencies (6, 7). By contrast, the isogenic strains
expressing alleles for the Walker A mutant proteins possessed
undetectable levels of these proteins, indicative of defects in T-pilus
production. virB11* alleles encoding the Walker A
derivatives are recessive to wild-type VirB11 (51,
61), whereas the corresponding virB4* alleles are
dominant with respect to substrate transfer (8, 30).
Interestingly, strain A348 expressing the mutated virB11 or
virB4 allele, hereafter designated
virB11/virB11* and virB4/virB4* merodiploid
strains, respectively, possessed abundant levels of exocellular VirB2
and VirB5 (Fig. 1A and 2A). These findings suggest that the dominance
of virB4* alleles encoding the Walker A derivatives most
probably is not due to a disruption in T-pilus production.
View larger version (91K):
[in this window]
[in a new window]
|
FIG. 1.
Effects of VirB11 Walker A mutations on accumulation of
T-pilus proteins and other VirB proteins in exocellular (A) and
cellular (B) fractions obtained as described in the text. Strains:
B11(B11), strain PC1011(pSRB1) expressing virB11 from an
IncP replicon; B11, strain PC1011; B11(GKT),
PC1011(pPCB7112) expressing virB11GKT174-176;
A348(GKT), A348(pPCB7112) coexpressing virB11 and
virB11GKT174-176; B11(K/Q), PC1011(pPCB7113)
expressing virB11K175Q; A348(K/Q), A348(pPCB7113)
coexpressing virB11 and virB11K175Q. M, molecular
mass markers, with sizes in kilodaltons indicated on the right. The
blots were developed with antisera to the VirB proteins listed on the
left.
|
|
View larger version (86K):
[in this window]
[in a new window]
|
FIG. 2.
Effects of VirB4 Walker A mutations on accumulation of
T-pilus-associated proteins and other VirB proteins in exocellular (A)
and cellular (B) fractions obtained as described in the text. Strains:
B4(B4), strain PC1004(pZDH10) expressing virB4 from an
IncP replicon; B4, strain PC1004; B4(GKT), PC1004(pBB17)
expressing virB4GKT174-176; A348(GKT), A348(pBB17)
coexpressing virB4 and virB4GKT174-176;
B4(K/Q), PC1004(pBB15) expressing virB4K175Q;
A348(K/Q), A348(pBB15) coexpressing virB4 and
virB4K175Q. M, molecular mass markers, with sizes in
kilodaltons indicated on the right. The blots were developed with
antisera to the VirB proteins listed on the left.
|
|
Figures 1A and 2A show that the presence of VirB5 in exocellular
fractions correlates well with that of VirB2 pilin. By contrast, all
strains examined possessed detectable levels of exocellular VirB7,
although the virB4 and virB11 mutations did
influence accumulation of the exocellular lipoprotein in different
ways. PC1004 engineered to produce native VirB4 accumulated abundant
levels of exocellular VirB7, whereas PC1004 itself or PC1004 engineered
to produce Walker A mutant proteins accumulated the lipoprotein at
appreciably lower levels (Fig. 2A). By contrast, PC1011 itself or
PC1011 engineered to produce either native VirB11 or the Walker A
mutant proteins accumulated abundant levels of exocellular VirB7, yet
the virB11/virB11* merodiploid strains accumulated
exocellular lipoprotein at low levels (Fig. 1A). These findings suggest
that the VirB4 and VirB11 ATPases influence the sorting of the VirB7
lipoprotein across the outer membrane by mechanisms influenced by their
oligomeric structures and by the capacity to bind or hydrolyze ATP.
All PC1011 and PC1004 strains accumulated abundant levels of cellular
forms of VirB2, VirB5, and VirB7 (Fig. 1B and 2B), as well as other
VirB proteins (data not shown). Of further note, the virB4
and virB11 mutations did not affect the migration of either
the cellular or exocellular forms of the T-pilus-associated proteins in
SDS-polyacrylamide gels. Each of these proteins possesses cleavable
signal sequences, and VirB2 and VirB7 are further processed in ways
that affect their migration in SDS-polyacrylamide gels (25,
27). Therefore, VirB4 and VirB11 probably do not participate in
the maturation of T-pilus proteins. Our anti-VirB5 antiserum reacts
against three VirB5 species present in cell extracts (Fig. 1B and 2B).
The two smaller species presumably correspond to degradation products
that fail to interact productively with the T pilus, as deduced by
their absence in exocellular fractions (Fig. 1A and 2A). Although VirB4
and VirB11 clearly are required for VirB5 sorting to the exocellular
fraction, neither protein seems to influence the formation of the
presumed VirB5 degradation products (Fig. 1B and 2B).
Effects of virB11 dominant mutations on T-pilus
production.
Next, we determined whether other VirB11 mutations
also disrupt both T-DNA transfer and T-pilus production. Of special
interest was a set of dominant alleles shown in a previous study to
strongly suppress T-DNA transfer when expressed in wild-type A348 cells (69). These dominant alleles fell into two classes.
Alleles designated class II encode nonfunctional mutant proteins,
whereas the class III alleles encode functional VirB11 proteins, as
judged by the capacity of these alleles to restore the virulence of
strain PC1011.
All merodiploid strains expressing wild-type virB11 and a
dominant allele accumulated exocellular VirB2 and VirB5 at levels comparable to those in isogenic wild-type A348 (Fig.
3; Table 2). By contrast, most of the PC1011
strains expressing the class III alleles accumulated exocellular VirB2
and VirB5, whereas none of the corresponding strains expressing the
class II alleles accumulated these pilus proteins at detectable levels.
As shown below, PC1011 strains expressing the class III alleles
elaborate wild-type T pili. Thus, in general, the class II and III
mutations are distinguished by their capacity to support T-pilus
production in the PC1011 genetic background.
View larger version (67K):
[in this window]
[in a new window]
|
FIG. 3.
Effects of virB11 dominant mutations on
T-pilus production. Exocellular fractions from PC1011 (designated
B11 or ) and A348 (designated A348 or A) strains expressing
wild-type virB11 and alleles 1 to 12 were analyzed for
accumulation of T-pilus-associated proteins, VirB2, VirB5, and VirB7,
as listed on the left of each immunoblot. Strain (B11) is
pC1011(pSRB1) expressing PvirB::virB11,
and strain (PlacZ::B11) is PC1011(pPCB117) expressing
PlacZ::virB11; alleles 1 to 12 expressed from PvirB are carried on plasmids pXZB101 to
pXZB112. Plasmid pXZB104 was shown previously to encode a wild-type
virB11 gene (69); however, we identified a
mutation in the PvirB promoter of pXZ104 that results in a
reduction in VirB11 production levels. M, molecular mass markers, with
sizes in kilodaltons indicated on the right.
|
|
Several PC1011 strains expressing class III alleles (e.g.,
alleles 2, 5, 6, and 7) accumulated exocellular VirB2 and VirB5 at reduced levels (Fig. 3). In the most extreme case,
PC1011(pXZB102) expressing virB11.I265T did not
accumulate any detectable exocellular VirB2 or VirB5 (Fig. 3). These
results are of considerable interest, because all PC1011 strains
expressing class III alleles, including PC1011(pXZB102), transfer T-DNA
at wild-type frequencies (Table 2) (69). Thus, certain
class III mutations, most notably I265T, are permissive for T-DNA
transfer but disrupt or prevent T-pilus production when synthesized in
the absence of native VirB11.
All merodiploid and PC1011 strains produced exocellular VirB7 (Fig. 3).
Interestingly, however, there was some allele-specific variation in
levels of exocellular VirB7; for example, compare strains expressing
alleles 10, 11, and 12 (Fig. 3). These findings further support the
notion that VirB11 influences the release of VirB7 lipoprotein to the
extracellular milieu.
Effects of virB11 mutations on VirB2 pilin distribution
in sucrose gradients.
The fractionation of VirB2 through sucrose
gradients can be used to monitor the production and structural
integrity of the T pilus (41, 42, 53, 55). Figure
4 shows the distribution profiles for
VirB2 from strains expressing wild-type virB11, a class II
allele (V258G), and a class III allele (H269R). Exocellular VirB2 from
each of these strains displayed similar distribution profiles in
sucrose gradients. These findings are representative of results
obtained for all strains expressing class II and III alleles that were
shown to accumulate exocellular T-pilus proteins (data not shown). At
this level of resolution, therefore, the virB11/virB11*
merodiploid strains expressing class II and III alleles and the PC1011
strains expressing class III alleles produce wild-type T pili. For
comparison, we previously determined that PC1002(pVSB10) engineered to
produce the VirB2C64S mutant pilin elaborates a T pilus with a distinct
distribution profile in sucrose gradients (53) (Fig. 4).
Based on its distribution pattern, we suspect VirB2C64S polymerizes as
a pilus that is shorter or less stable than the native T pilus
(53).
View larger version (46K):
[in this window]
[in a new window]
|
FIG. 4.
Sucrose density gradient distribution profiles of T pili
from various virB11 mutant strains. Exocellular proteins
from the strains listed on the left were centrifuged through
identically prepared sucrose density gradients, and the fractions were
analyzed for the presence of VirB2 pilin. Strains: B11(B11),
PC1011(pXZB100); B11(7), PC1011(pXZB107); A348(7), A348(pXZB107);
A348(3), A348(pXZB103); B2(B2C64S), PC1002(pVSB10) that synthesizes
mutant pilin (53).
|
|
Further evidence for uncoupling of substrate transfer and T-pilus
production.
The pilus
Tra+ phenotype of
PC1011(pXZB102) and the pilus+ Tra-deficient phenotypes
of virB11/virB11* merodiploid strains expressing both classes of dominant alleles suggest that pilus production and substrate translocation can be uncoupled by mutation of VirB11. To
further test this model, we assayed strains expressing the dominant
virB11 alleles for translocation of substrates other than
T-DNA. Wild-type A348 harboring an IncQ plasmid, pML122Km, efficiently mobilizes the IncQ plasmid to agrobacterial recipient cells
by a VirB-dependent mechanism (10, 29). Of considerable interest, all virB11/virB11* merodiploid strains mobilized
the IncQ plasmid to agrobacterial recipients at frequencies comparable to that of wild-type A348 (Table 2). These findings show that the
dominant mutations preferentially block T-DNA transfer without disrupting T-pilus production or IncQ plasmid mobilization.
Most PC1011 strains expressing class III alleles transferred the IncQ
plasmid at frequencies comparable to that of wild-type A348, whereas
strains expressing the class II alleles transferred the IncQ plasmid at
low or undetectable frequencies (Table 2). Thus, strains synthesizing
these mutant proteins without coproduction of native VirB11 transferred
T-DNA and IncQ plasmid substrates at frequencies that correlated with
the level of T-pilus production. Again, strain PC1011(pXZB102)
expressing the class III allele virB11.I265T was an
exception in that it efficiently transferred both DNA substrates even
in the absence of detectable T-pilus production.
Otten et al. (47) discovered that two avirulent
strains, a T-DNA+ virE2 mutant and a
T-DNA virE2+ mutant, can incite
tumor formation when coinoculated on a plant wound site. To explain
this phenomenon, it was proposed that these strains translocate the
T-strand-VirD2 transfer intermediate and the VirE2 SSB, respectively,
to the same plant cell. Once inside the plant cell, these molecules
assemble as a T-strand-VirD2-VirE2 complex for delivery of the T-DNA
to the plant nucleus (18). The export of VirE2
independently of T-DNA has now been shown unequivocally
(62). We used a mixed-infection assay to test whether any
virB11 mutants can separately export VirE2 and the T-strand-VirD2 transfer intermediate. Because this assay requires the
coinoculation of avirulent strains, our studies were restricted to the
analysis of the class II (dominant and nonfunctional) mutations. PC1011
strains expressing these alleles were coinoculated on plant wound sites
with the virE2 mutant A348mx358 to test for the capacity to
export VirE2 and were coinoculated with the T-DNA deletion mutant
LBA4404 to test for the capacity to export the T-strand-VirD2 intermediate. No strain expressing a class II allele transferred the
T-strand-VirD2 intermediate at detectable frequencies. However, PC1011(pXZB109) producing the VirB11.I103T/M301I mutant protein efficiently exported VirE2 (Table 2). This strain therefore
translocates VirE2 in the absence of detectable T-pilus production.
Effects of i4 insertion mutations on VirB11 function.
The
virB11 dominant mutations generally consist of conservative
substitution mutations that map to two regions in the N- and C-terminal
halves of VirB11 (see Discussion). To expand our structure-function studies, we constructed a set of four-residue (HMVD) insertion mutations at ~20- to 30-residue intervals across the entire length of
VirB11. A348 and PC1011 strains synthesizing the VirB11.i4 derivatives
were assayed for VirB protein and T-pilus production and for substrate translocation.
Only 3 of the 14 alleles coding for the mutant proteins exerted
dominant effects. Of these, only the allele encoding the E196.i4 mutant
protein displayed strong dominance (Table
3). These i4 mutations probably more
strongly perturb VirB11's tertiary structure, and hence, its partner
protein interactions, than the substitution mutations described above.
Interestingly, all of the virB11/virB11.i4 merodiploid
strains produced abundant levels of cellular VirB proteins and
exocellular VirB2, VirB5, and VirB7, suggesting that the VirB11.i4
mutant proteins do not interfere with the capacity of
otherwise-wild-type cells to assemble this transfer system.
All PC1011 strains expressing the virB11.i4 alleles
accumulated abundant levels of the VirB11.i4 mutant proteins as well as other VirB proteins (Fig. 5 and data not
shown). However, only three strains, encoding the Q135.i4, G217.i4, and
P237.i4 mutant proteins, accumulated detectable levels of exocellular
VirB2 pilin and VirB5. These strains elaborated wild-type T pili, as
judged by VirB2 distribution profiles in sucrose gradients (Fig. 5 and data not shown).
View larger version (39K):
[in this window]
[in a new window]
|
FIG. 5.
Effects of virB11.i4 mutations on T-pilus
production. Exocellular fractions from PC1011 (designated B11)
expressing wild-type virB11 (designated B11; from plasmid
pJCB903) and alleles for the i4 mutant proteins indicated were analyzed
for accumulation of T-pilus proteins, VirB2, VirB5, and VirB7.
Corresponding cellular levels of native and mutant forms of VirB11 are
shown at the bottom. M, molecular mass markers with sizes in
kilodaltons indicated on the right.
|
|
PC1011 strains producing the Q135.i4, G217.i4, and P237.i4 mutant
proteins also transferred T-DNA at wild-type levels (Table 3). Mutants
defective in T-pilus production did not translocate T-DNA, yet three
derivatives, encoding the L75.i4, C168.i4, and L302.i4 mutant proteins,
transferred the IncQ plasmid to agrobacterial recipient cells. The
transfer frequencies were 1 to 2 orders of magnitude lower than those
of the isogenic PC1011 producing native VirB11 but were still
appreciably higher (>2 orders of magnitude) than background
(Table 3). In addition, these three strains translocated VirE2
protein, as determined by the mixed-infection assay (Table 3). Thus,
three i4 mutant proteins support the translocation of selected
substrates but interfere with production of the T pilus.
Effect of an IncQ plasmid on T-pilus production and T-DNA
transfer.
Previous work has shown that RSF1010 derivatives
suppress the capacity of A. tumefaciens to transfer
T-DNA and VirE2 substrates to plants (9, 60,
64). To determine whether cells carrying an IncQ plasmid
show defects in assembly of this transfer system, we assayed for
production of cellular and exocellular VirB proteins by wild-type A348
and an isogenic strain carrying pML122Km. As shown in Fig.
6A, A348 with and without the IncQ
plasmid accumulated most VirB proteins at comparable levels; the
only reproducible effects of the IncQ plasmid were slightly diminished
levels of VirB8, VirB9, and VirB10. Both A348 and A348(pML122Km)
cells also accumulated comparable levels of exocellular VirB2, VirB5, and VirB7 (Fig. 6B). Moreover, exocellular VirB2 from both strains fractionated similarly in sucrose gradients, suggesting that both strains elaborate abundant levels of wild-type T pili (data not shown). Further studies showed that the presence of an IncQ
plasmid also does not influence the T-pilus production of A348
merodiploid and PC1011 strains expressing the dominant
virB11 alleles (Fig. 6B).
View larger version (61K):
[in this window]
[in a new window]
|
FIG. 6.
Effects of IncQ plasmid on accumulation of VirB proteins
and T-pilus proteins. (A) VirB and VirE2 protein levels in total-cell
extracts of A348 and A348(pML122), with VirB proteins listed on the
left of each immunoblot. M, molecular mass markers, with sizes in
kilodaltons indicated on the right. (B) VirB2 pilin levels in
exocellular fractions from A348 and merodiploid strains expressing the
dominant alleles 1 through 12 and pML122Km (designated pML).
Also shown are the pilin levels in PC1011 (designated 11) expressing
virB11 (B11; from plasmid pXZB100) and class III alleles.
|
|
Overexpression of virB9, virB10, and virB11
suppresses IncQ plasmid-mediated inhibition of T-DNA transfer,
prompting the proposal that the IncQ plasmid competes with the T-DNA
transfer intermediate and/or VirE2 for available transfer machines
(9, 60, 64). To determine whether any virB11
mutations counterract the suppressive effect of the IncQ plasmid, we
compared the relative efficiencies with which the virB11
mutant strains with and without the IncQ plasmid transfer T-DNA to
plants. We found that the presence of the IncQ plasmid suppressed
transfer of T-DNA and/or VirE2 by all virB11 mutant strains
capable of translocating these substrates in the absence of the IncQ
plasmid (data not shown). Therefore, none of the virB11
mutations appears to selectively block the interaction of the IncQ
transfer intermediate with the transfer machine.
| |
DISCUSSION |
In this report, we showed that VirB11 regulates in an ATP
binding-dependent manner both the assembly of the T pilus and the selection or translocation of secretion substrates. Although most mutations exerted similar effects on pilus production and substrate translocation, a few selectively impaired one or the other of these
functions. Moreover, some mutations disrupted the transfer of one or
more substrates without affecting the transfer of other substrates. We
(50, 69) and others (37, 38, 67) have postulated that the VirB11-type ATPases function as chaperones to
facilitate the movement of unfolded proteins and DNA substrates across
the cytoplasmic membrane. As discussed in more detail below, if this
chaperone model is correct, it must satisfactorily explain the dual
role of VirB11 in pilus biogenesis and substrate transfer and also the
finding that VirB11's contributions to these processes can be
uncoupled by mutagenesis. In addition, the chaperone model must also be
considered in the context of other biochemical reactions that are known
to be required for assembly of a functional T-DNA transfer system. For
reference during this discussion, Fig. 7 shows the positions and phenotypes of VirB11 mutations characterized in
this study along with an alignment of VirB11 and its conserved motifs
with the HP0525 secondary structure (67).
View larger version (25K):
[in this window]
[in a new window]
|
FIG. 7.
Positions of VirB11 mutations grouped according to their
effects on pilus production and substrate transfer. (A) Substitution
mutations with allele numbers in parantheses as defined by Zhou et al.
(69). Phenotypic descriptions are provided for mutations
of special interest. Note that all virB11/virB11*
merodiploid strains expressing the dominant alleles exhibit a
T-pilus+ IncQ plasmid Tra+ T-DNA Tra-deficient
phenotype. (B) VirB11 (343 residues) with conserved Walker A and B
domains and the Asp and His boxes denoted. The shading identifies the
two regions of VirB11 in which dominant mutations were predominantly
located. Below the VirB11 representation is the HP0525 secondary
structure with  -sheets and  -helices as presented by Yeo et al.
(67). The junction between the N- and C-terminal domains,
shown by the HP0525 crystal structure to assemble as independent
hexameric rings, is indicated. (C) i4 mutations with insertion sites
indicated.
|
|
Effects of ATP-binding mutations on T-pilus production and
substrate transfer.
Defining the structural and biological
consequences of ATP binding or hydrolysis is central to developing a
detailed mechanistic understanding of VirB11's biological activity. In
a previous study, we showed that mutations in the Walker A motif
disrupted the capacity of the C-terminal domain of VirB11 to
self-assemble (50). In addition, the electron microscopy
studies of VirB11 homologs (36, 37) together with the
HP0525 crystal structure (67) establish that nucleotide
binding is critical for coordination of the N- and C-terminal domain
rings. ATP binding therefore is likely required for the formation of
both homo- and heteromultimeric complexes. Here, we demonstrated that
mutations of VirB11 residues predicted to coordinate nucleotide binding
disrupted or abolished T-pilus production, with corresponding effects
on substrate translocation. Walker A residues are required for the
binding of phosphate groups (63, 67), and a substitution
(K175Q) and a deletion (GKT174-176) of these residues of VirB11
abolished both T-pilus assembly and substrate transfer. One mutation
near the Walker A motif, C168.i4, also abolished both processes,
whereas a second, P170L, led to diminished T-pilus production and T-DNA
transfer (reference 51 and data not shown). The structural
studies further identified several additional contacts between N- and
C-terminal residues of HP0525 and the adenine and ribose moieties
(67). Two residues in the N-terminal domain, T46 and N61,
coordinate the ribose moiety of ADP, whereas Y140 and F145, located at
the beginning of the C-terminal domain, contact the adenine moiety
(67). For VirB11, the E25G and E115.i4 mutations are at
sites aligning near T46 and F145 of HP0525, respectively, and both
mutations abolished T-DNA transfer as well as T-pilus production
(reference 51 and data not shown).
Reactive Glu residues in two other highly-conserved motifs of HP0525,
the Asp box and the Walker B domain (37, 52, 63), are
proposed to coordinate Mg2+ binding and ATP hydrolysis
(67). For VirB11, the Asp box is located between residues
198 and 210, and the E196.i4 mutation near this box abolished T-pilus
production and substrate transfer (Fig. 7). Interestingly, however, the
Walker B domain is located between residues 234 and 245, and the
P237.i4 mutation is completely permissive both for pilus production and
substrate transfer. Consistent with this finding, a substitution
mutation (R217T) within the Walker B motif of the VirB11 homolog, TrbB
of plasmid RP4, was found to abolish ATPase activity without affecting
RP4 plasmid transfer, although effects on ATP binding or pilus
production were not reported (38).
Our findings firmly establish that an intact ATP binding site is
important for T-pilus production and substrate transfer. At this time,
however, we cannot distinguish between the relative contributions of
ATP binding and ATP hydrolysis to the assembly of a functional system.
The structural findings indicating that nucleotide binding is critical
for VirB11 oligomerization raise the possibility that ATP binding
suffices at least for a subset of VirB11 activities. Walker B mutations
might be found to disrupt ATP hydrolysis without affecting ATP binding,
and further studies of such mutations should help to resolve this question.
Walker A mutations of the VirB4 ATPase also abolished T-pilus
biogenesis, consistent with previous work showing that these mutations
disrupt substrate export (6, 30, 57). Although there is no
structural information about VirB4, we previously supplied evidence for
a transmembrane topology (21), and we further demonstrated
that an N-terminal membrane-spanning domain mediates VirB4
self-assembly (20). The ATP binding pocket is located in a
central domain of this large (87-kDa) protein, and VirB4 Walker A
mutations do not abolish self-interaction of the N-terminal domain
(20). Of further interest, an independent study showed
that the production of VirB4 and a subset of other VirB proteins in
agrobacterial recipient cells stimulates the acquisition of an IncQ
plasmid in matings with agrobacterial donor cells (10).
However, production of VirB4 Walker A mutant proteins in agrobacterial
recipients stimulates IncQ plasmid acquisition to the same extent as
production of native VirB4, suggesting that ATP binding is not a
prerequisite for assembly of a VirB protein substructure with a
discernible biological activity (20). Taken together, the
data support a working model in which VirB4 establishes initial
contacts with other VirB proteins independent of ATP binding. Then, by
an ATP binding-dependent mechanism, VirB4 promotes T-pilus production
and configures the transfer apparatus as a dedicated export machine.
This model will be refined by studies examining the contributions of
ATP binding and hydrolysis activities to the VirB4 structure and
partner protein interactions.
Uncoupling of T-pilus production and substrate transfer.
The
T-DNA transfer machine is usually depicted as a supramolecular complex
composed of a translocation channel physically connected to the T pilus
(19, 43, 66). Interestingly, however, our mutational
analyses supplied strong evidence that T-pilus production is not
obligatorily coupled to substrate transfer. The Pil+
Tra-deficient phenotype of the virB11/virB11* merodiploid
strains expressing dominant alleles indicates that VirB11 can support pilus production while simultaneously blocking substrate transfer. More
intriguingly, this block is substrate specific, preventing T-DNA
transfer to plants without affecting IncQ plasmid transfer to
agrobacterial recipients. We suggest below that this class of VirB11
mutations might disrupt recognition of the T-DNA transfer intermediate
at the cytoplasmic face of the transfer channel.
It is intriguing to note that the Pil+ Tra-defective
phenotype is also observed when the IncQ plasmid is introduced into
wild-type cells. Previous studies led to a prediction that the IncQ
plasmid inhibits the export of T-DNA and VirE2 transfer intermediates (9, 64). In support of this prediction, we found that the IncQ plasmid does not interfere with production of VirB proteins or the
T pilus. Apparently, both conditions, expression of the virB11 dominant alleles and the presence of the IncQ plasmid
in a wild-type background, permit assembly of a functional transfer system, but this system is somehow configured for selective substrate translocation, e.g., IncQ plasmid mobilization. We have reported that synthesis of VirE2::GFP in an otherwise wild-type strain also interferes with T-DNA transfer without disrupting IncQ plasmid transfer (70). None of the virB11 mutations
examined in the present study counterracted the suppressive effects of
the IncQ plasmid (this study) or VirE2::GFP (data not shown)
on T-DNA transfer. Further studies might identify such mutations,
although it is also possible that the IncQ plasmid and
VirE2::GFP transfer intermediates selectively block T-DNA
transfer by a mechanism(s) that bypasses VirB11.
The Pil Tra+ phenotypes of PC1011 strains
expressing substitution (I265T) or i4 insertion (L75.i4, C168.i4, and
L302.i4) mutants supplied further evidence for uncoupling of pilus
production and substrate transfer. Clearly, the 1265T substitution
mutation is the best example of an uncoupling mutation in that it
completely abolished T-pilus formation without disrupting translocation
of any substrates tested. Of possible significance, this mutation is in
the highly conserved His box (37, 52), and other His box
mutations also led to a reduction or loss of pilus production and
substrate transfer. As noted above, besides virB11
mutations, other elements have been shown to selectively block
substrate transfer without impairing pilus production. By contrast, the isolation of mutations conferring a Pil Tra+
phenotype is completely novel, strongly indicating that production of a
wild-type T pilus is dispensible for substrate transfer. Because each
A. tumefaciens cell elaborates only a few pili
(41), we consider it unlikely that a reduction in the
number of T pili on a per-cell basis would account for the
Pil phenotype. However, we cannot exclude the possibility
that these cells elaborate morphologically aberrant pili, e.g., stubby
pili that do not protrude beyond the cell surface and thus are
refractive to isolation by shearing.
The dominant mutations generally map to two regions of VirB11, one
located between residues 75 and 135 and the second in the His box
between residues 258 and 270 (69) (Fig. 7). The
corresponding regions of HP0525 were found to establish intra- and
intersubunit contacts, and as noted above, several residues in the
N-terminal region also contact nucleotide moieties (67).
While these observations suggest that the dominant mutations might
exert their effects by perturbing the overall oligomeric structure of
VirB11, we have also shown that all VirB11 mutant proteins exerting
dominant effects can self-assemble and also interact with native VirB11
(50, 69). With these considerations in mind, we propose
that the dominant mutant proteins retain the capacity to self-assemble, forming mixed multimers with native VirB11 in merodiploid strains and
homomultimers in PC1011 strains. Depending on their overall structures,
these multimers may or may not productively enter a pilus morphogenetic
pathway described below or direct the transfer of substrates through
the translocation channel.
Entry point into the morphogenetic pathway and models for VirB11
function.
If VirB11 indeed functions as a chaperone to drive
assembly of the T-DNA transfer system, we should be able to assign its entry point into the morphogenetic pathway. The available data suggest
that an initial series of reactions occurs independently of VirB11: (i)
VirB7 undergoes maturation as a lipoprotein, (ii) VirB7 forms a
disulfide-cross-linked complex with VirB9, (iii) the VirB7-VirB9
heteromultimer is sorted to the outer membrane, (iv) the VirB7-VirB9
complex interacts with the bitopic inner membrane proteins, VirB8 and
VirB10, and (v) the VirB7-VirB9 heteromultimer directs assembly of a
VirB10 homooligomer (2, 3, 4, 22, 23, 27, 39, 59). These
reactions are proposed to lead to the assembly of a VirB protein
substructure that spans the cytoplasmic and outer membranes
(14). This core complex, composed of VirB7 through VirB10
and probably also the polytopic proteins VirB4 ATPase and VirB6, is
stable and can act independently of VirB11 to stimulate IncQ plasmid
acquisition by recipient cells during matings with agrobacterial donors
(10). VirB11 does seem to influence the sorting of VirB7
monomers or homomultimers to the extracellular milieu, but further
studies are needed to determine whether this is an on- or off-pathway
reaction with respect to biogenesis of the T-DNA transfer system.
We suggest that VirB11 contributes to T-pilus assembly subsequent to
its formation of a homooligomeric complex and interaction of the
homooligomer with the core structure. One possibility is that a VirB11
hexameric chaperone configures VirB2 pilin for translocation across the
cytoplasmic membrane through a preassembled VirB channel (43). Although it is intriguing, we do not favor this
mechanism of action because VirB2 possesses a signal sequence and is
exported to the periplasm in various A. tumefaciens virB
mutants and in heterologous E. coli, as determined by
reporter protein fusion studies (5, 24, 34, 42). Another
argument against a role for VirB11 in the translocation of pilin across
the cytoplasmic membrane is that VirB2 and its homolog, TrbC of plasmid
RP4, are processed to their mature forms via reactions occurring in the periplasm independent of their cognate type IV components (25, 26, 42). The mature form of VirB2, which, intriguingly, is a
cyclic polypeptide (25), embeds in the cytoplasmic
membrane, forming a reservoir of pilin available for T-pilus
polymerization (34, 56). Thus, an alternative possibility
is that a VirB11 chaperone acts to catalyze the release of pilin
monomers from the cytoplasmic membrane. Such a chaperone-pilin
interaction might be dynamic, driven by cycles of ATP binding and
hydrolysis and ADP release, with the net effect that pilin monomers are
successively delivered to the site of pilus polymerization. Although
there is no precedent for this type of chaperone activity, an appealing aspect of this model is that it offers a solution to a long-standing problem of how pilin proteins that are integrated into the cytoplasmic membrane can be recruited to assemble as conjugative pili.
It should be noted that VirB11's contribution to machine assembly
alternatively might be entirely structural. For example, the ADP- or
ATP-bound forms of VirB11 might interact with the VirB core structure
in a way that induces a conformational change required for the
structure to serve as a platform for T-pilus assembly. As noted
above, studies examining the relative importance of ATP or ADP binding
versus ATP hydrolysis should help distinguish structural from catalytic
contributions to pilus biogenesis.
Finally, we propose that once VirB11 assembles with the base of the
core structure and induces the production of the T pilus, presumably on
top of the core structure, it can then participate in substrate
translocation. While substrate selection or translocation might
temporally follow the elaboration of the supramolecular channel or
pilus structure, the isolation of uncoupling mutations suggests the
assembly pathway can be blocked at some stage without disrupting
substrate transfer. With respect to VirB11's role in substrate
transfer, again a chaperone model is enticing, in which VirB11 situated
at the base of the secretion machine configures secretion substrates
for translocation (67). Of considerable interest, however,
another putative ATPase termed VirD4 has been shown to be essential for
substrate translocation but dispensible for pilus biogenesis (16,
41, 45). There is also genetic evidence based on construction of
chimeric transfer systems that VirD4 and its homologs participate in
substrate selection (12, 33, 46). An intriguing question
for future studies is how VirB11 functions independently of VirD4 to
direct T-pilus biogenesis and also coordinates its activities with
VirD4 to direct substrate transfer.
We thank Simon Jakubowski and Zhiyong Ding for helpful
discussions and Juan Fernandez for excellent technical assistance. We
thank Gabriel Waksman and Thierre Rose for helpful discussions and
critiques of the manuscript.
| 1.
|
Albano, M.,
R. Breitling, and D. A. Dubnau.
1989.
Nucleotide sequence and genetic organization of the Bacillus subtilis comG operon.
J. Bacteriol.
171:5386-5404[Abstract/Free Full Text].
|
| 2.
|
Anderson, L. B.,
A. V. Hertzel, and A. Das.
1996.
Agrobacterium tumefaciens VirB7 and VirB9 form a disulfide-linked protein complex.
Proc. Natl. Acad. Sci. USA
93:8889-8894[Abstract/Free Full Text].
|
| 3.
|
Baron, C.,
Y. R. Thorstenson, and P. C. Zambryski.
1997.
The lipoprotein VirB7 interacts with VirB9 in the membranes of Agrobacterium tumefaciens.
J. Bacteriol.
179:1211-1218[Abstract/Free Full Text].
|
| 4.
|
Beaupré, C. E.,
J. Bohne,
E. M. Dale, and A. N. Binns.
1997.
Interactions between VirB9 and VirB10 membrane proteins involved in movement of DNA from Agrobacterium tumefaciens into plant cells.
J. Bacteriol.
179:78-89[Abstract/Free Full Text].
|
| 5.
|
Beijersbergen, A.,
S. J. Smith, and P. J. J. Hooykas.
1994.
Localization and topology of VirB proteins of Agrobacterium tumefaciens.
Plasmid
32:212-218[CrossRef][Medline].
|
| 6.
|
Berger, B. R., and P. J. Christie.
1993.
The Agrobacterium tumefaciens virB4 gene product is an essential virulence protein requiring an intact nucleoside triphosphate-binding domain.
J. Bacteriol.
175:1723-1734[Abstract/Free Full Text].
|
| 7.
|
Berger, B. R., and P. J. Christie.
1994.
Genetic complementation analysis of the Agrobacterium tumefaciens virB operon: virB2 through virB11 are essential virulence genes.
J. Bacteriol.
176:3646-3660[Abstract/Free Full Text].
|
| 8.
|
Berger, K. H., and R. R. Isberg.
1993.
Two distinct defects in intracellular growth complemented by a single genetic locus in Legionella pneumophila.
Mol. Microbiol.
7:7-19[Medline].
|
| 9.
|
Binns, A.,
C. Beaupre, and E. Dale.
1995.
Inhibition of VirB-mediated transfer of diverse substrates from Agrobacterium tumefaciens by the IncQ plasmid RSF1010.
J. Bacteriol.
177:4890-4899[Abstract/Free Full Text].
|
| 10.
|
Bohne, J.,
A. Yim, and A. N. Binns.
1998.
The Ti plasmid increases the efficiency of Agrobacterium tumefaciens as a recipient in virB-mediated conjugal transfer of an IncQ plasmid.
Proc. Natl. Acad. Sci. USA
95:7057-7062[Abstract/Free Full Text].
|
| 11.
|
Buchanan-Wollaston, V.,
J. E. Passiatore, and F. Cannon.
1987.
The mob and oriT mobilization functions of a bacterial plasmid promote its transfer to plants.
Nature
328:172-175[CrossRef].
|
| 12.
|
Cabezon, E.,
J. I. Sastre, and F. de la Cruz.
1997.
Genetic evidence of a coupling role for the TraG protein family in bacterial conjugation.
Mol. Gen. Genet.
254:400-406[CrossRef][Medline].
|
| 13.
|
Chen, C.-Y., and S. C. Winas.
1991.
Controlled expression of the transcriptional activator gene virG in Agrobacterium tumefaciens by using the Escherichia coli lac promoter.
J. Bacteriol.
173:1139-1144[Abstract/Free Full Text].
|
| 14.
|
Christie, P. J.
1997.
The Agrobacterium tumefaciens T-complex transport apparatus: a paradigm for a new family of multifunctional transporters in eubacteria.
J. Bacteriol.
179:3085-3094[Free Full Text].
|
| 15.
|
Christie, P. J.
2001.
Type IV secretion: intercellular transfer of macromolecules by systems ancestrally-related to conjugation machines.
Mol. Microbiol.
40:294-305[CrossRef][Medline].
|
| 16.
|
Christie, P. J.,
J. E. Ward,
S. C. Winans, and E. W. Nester.
1988.
The Agrobacterium tumefaciens virE2 gene product is a single-stranded-DNA-binding protein that associates with T-DNA.
J. Bacteriol.
170:2659-2667[Abstract/Free Full Text].
|
| 17.
|
Christie, P. J.,
J. E. Ward,
S. C. Winans, and E. W. Nester.
1989.
A gene required for transfer of T-DNA to plants encodes an ATPase with autophosphorylating activity.
Proc. Natl. Acad. Sci. USA
86:9677-9681[Abstract/Free Full Text].
|
| 18.
|
Citovsky, V., and P. Zambryski.
1993.
Transport of nucleic acids through membrane channels: snaking through small holes.
Annu. Rev. Microbiol.
47:167-197[CrossRef][Medline].
|
| 19.
|
Covacci, A.,
J. L. Telford,
G. Del Giudice,
J. Parsonnet, and R. Rappuoli.
1999.
Helicobacter pylori virulence and genetic geography.
Science
284:1328-1333[Abstract/Free Full Text].
|
| 20.
|
Dang, T. A.,
X.-R. Zhou,
B. Graf, and P. J. Christie.
1999.
Dimerization of the Agrobacterium tumefaciens VirB4 ATPase and the effect of ATP-binding cassette mutations on assembly and function of the T-DNA transporter.
Mol. Microbiol.
32:1239-1253[CrossRef][Medline].
|
| 21.
|
Dang, T. A. T., and P. J. Christie.
1997.
The VirB4 ATPase of Agrobacterium tumefaciens is a cytoplasmic membrane protein exposed at the periplasmic surface.
J. Bacteriol.
179:453-462[Abstract/Free Full Text].
|
| 22.
|
Das, A.,
L. B. Anderson, and Y. H. Xie.
1997.
Delineation of the interaction domains of Agrobacterium tumefaciens VirB7 and VirB9 by use of the yeast two-hybrid assay.
J. Bacteriol.
179:3404-3409[Abstract/Free Full Text].
|
| 23.
|
Das, A., and Y.-H. Xie.
2000.
The Agrobacterium T-DNA transport pore proteins VirB8, VirB9, and VirB10 interact with one another.
J. Bacteriol.
182:758-763[Abstract/Free Full Text].
|
| 24.
|
Das, A., and Y. H. Xie.
1998.
Construction of transposon Tn3PhoA: its application in defining the membrane topology of the Agrobacterium tumefaciens DNA transfer proteins.
Mol. Microbiol.
27:405-414[CrossRef][Medline].
|
| 25.
|
Eisenbrandt, R.,
M. Kalkum,
E. M. Lai,
R. Lurz,
C. I. Kado, and E. Lanka.
1999.
Conjugative pili of IncP plasmids and the Ti plasmid T pilus are composed of cyclic subunits.
J. Biol. Chem.
274:22548-22555[Abstract/Free Full Text].
|
| 26.
|
Eisenbrandt, R.,
M. Kalkum,
R. Lurz, and E. Lanka.
2000.
Maturation of IncP pilin precursors resembles the catalytic dyad-like mechanism of leader peptidases.
J. Bacteriol.
182:6751-6761[Abstract/Free Full Text].
|
| 27.
|
Fernandez, D.,
T. A. T. Dang,
G. M. Spudich,
X.-R. Zhou,
B. R. Berger, and P. J. Christie.
1996.
The Agrobacterium tumefaciens virB7 gene product, a proposed component of the T-complex transport apparatus, is a membrane-associated lipoprotein exposed at the periplasmic surface.
J. Bacteriol.
178:3156-3167[Abstract/Free Full Text].
|
| 28.
|
Fernandez, D.,
G. M. Spudich,
X.-R. Zhou, and P. J. Christie.
1996.
The Agrobacterium tumefaciens VirB7 lipoprotein is required for stabilization of VirB proteins during assembly of the T-complex transport apparatus.
J. Bacteriol.
178:3168-3176[Abstract/Free Full Text].
|
| 29.
|
Fullner, K. J.
1998.
Role of Agrobacterium virB genes in transfer of T complexes and RSF1010.
J. Bacteriol.
180:430-434[Abstract/Free Full Text].
|
| 30.
|
Fullner, K. J.,
K. M. Stephens, and E. W. Nester.
1994.
An essential virulence protein of Agrobacterium tumefaciens, VirB4, requires an intact mononucleotide binding domain to function in transfer of T-DNA.
Mol. Gen. Genet.
245:704-715[CrossRef][Medline].
|
| 31.
|
Garfinkel, D. J.,
R. B. Simpson,
L. W. Ream,
F. F. White,
M. P. Gordon, and E. W. Nester.
1981.
Genetic analysis of crown gall: fine structure map of the T-DNA by site-directed mutagenesis.
Cell
27:143-153[CrossRef][Medline].
|
| 32.
|
Haase, J.,
R. Lurz,
A. M. Grahn,
D. H. Bamford, and E. Lanka.
1995.
Bacterial conjugation mediated by plasmid RP4: RSF1010 mobilization, donor-specific phage production, and pilus production require the same Tra2 core components of a proposed DNA transport complex.
J. Bacteriol.
177:4779-4791[Abstract/Free Full Text].
|
| 33.
|
Hamilton, C. M.,
H. Lee,
P.-L. Li,
D. M. Cook,
K. R. Piper,
S. Beck von Bodman,
E. Lanka,
W. Ream, and S. K. Farrand.
2000.
TraG from RP4 and TraG and VirD4 from Ti plasmids confer relaxosome specificity to the conjugal transfer system of pTiC58.
J. Bacteriol.
182:1541-1548[Abstract/Free Full Text].
|
| 34.
|
Jones, A. L.,
E.-M. Lai,
K. Shirasu, and C. I. Kado.
1996.
VirB2 is a processed pilin-like protein encoded by the Agrobacterium tumefaciens Ti plasmid.
J. Bacteriol.
178:5706-5711[Abstract/Free Full Text].
|
| 35.
|
Kado, C. I.
2000.
The role of the T-pilus in horizontal gene transfer and tumorigenesis.
Curr. Opin. Microbiol.
3:643-648[CrossRef][Medline].
|
| 36.
|
Krasan, G. P.,
F. G. Sauer,
D. Cutter,
M. M. Farley,
J. R. Gilsdorf,
S. J. Hultgren, and J. W. St. Geme, III.
2000.
Evidence for donor strand complementation in the biogenesis of Haemophilus influenzae haemagglutinating pili.
Mol. Microbiol.
35:1335-1347[CrossRef][Medline].
|
| 37.
|
Krause, S.,
M. Barcena,
W. Panseqrau,
R. Lurz,
J. Carazo, and E. Lanka.
2000.
Sequence related protein export NTPases encoded by the conjugative transfer region of RP4 and by the cag pathogenicity island of Helicobacter pylori share similar hexameric ring structures.
Proc. Natl. Acad. Sci. USA
97:3067-3072[Abstract/Free Full Text].
|
| 38.
|
Krause, S.,
W. Pansegrau,
R. Lurz,
F. de la Cruz, and E. Lanka.
2000.
Enzymology of type IV macromolecule secretion systems: the conjugative transfer regions of plasmids RP4 and R388 and the cag pathogenicity island of Helicobacter pylori encode structurally and functionally related nucleoside triphosphate hydrolases.
J. Bacteriol.
182:2761-2770[Abstract/Free Full Text].
|
| 39.
|
Kumar, R. B.,
Y. H. Xie, and A. Das.
2000.
Subcellular localization of the Agrobacterium tumefaciens T-DNA transport pore proteins: VirB8 is essential for the assembly of the transport pore.
Mol. Microbiol.
36:608-617[CrossRef][Medline].
|
| 40.
|
Kunkel, T. A.,
K. Bebenek, and J. McClary.
1991.
Efficient site-directed mutagenesis using uracil-containing DNA.
Methods Enzymol.
204:125-139[Medline].
|
| 41.
|
Lai, E. M.,
O. Chesnokova,
L. M. Banta, and C. I. Kado.
2000.
Genetic and environmental factors affecting T-pilin export and T-pilus biogenesis in relation to flagellation of Agrobacterium tumefaciens.
J. Bacteriol.
182:3705-3716[Abstract/Free Full Text].
|
| 42.
|
Lai, E. M., and C. I. Kado.
1998.
Processed VirB2 is the major subunit of the promiscuous pilus of Agrobacterium tumefaciens.
J. Bacteriol.
180:2711-2717[Abstract/Free Full Text].
|
| 43.
|
Lai, E. M., and C. I. Kado.
2000.
The T-pilus of Agrobacterium tumefaciens.
Trends Microbiol.
8:361-369[CrossRef][Medline].
|
| 44.
|
Li, P.,
I. Hwang,
H. Miyagi,
H. True, and S. Farrand.
1999.
Essential components of the Ti plasmid trb system, a type IV macromolecular transporter.
J. Bacteriol.
181:5033-5041[Abstract/Free Full Text].
|
| 45.
|
Lin, T. S., and C. I. Kado.
1993.
The virD4 gene is required for virulence while virD3 and orf5 are not required for virulence of Agrobacterium tumefaciens.
Mol. Microbiol.
9:803-812[CrossRef][Medline].
|
| 46.
|
Moncalian, G.,
E. Cabezon,
I. Alkorta,
M. Valle,
F. Moro,
J. M. Valpuesta,
F. M. Goni, and F. de La Cruz.
1999.
Characterization of ATP and DNA binding activities of TrwB, the coupling protein essential in plasmid R388 conjugation.
J. Biol. Chem.
274:36117-36124[Abstract/Free Full Text].
|
| 47.
|
Otten, L.,
H. De Greve,
J. Leemans,
R. Hain,
P. Hooykaas, and J. Schell.
1984.
Restoration of virulence of vir region mutants of Agrobacterium tumefaciens strain B6S3 by coinfection with normal and mutant Agrobacterium strains.
Mol. Gen. Genet.
195:159-163[CrossRef].
|
| 48.
|
Planet, P. J.,
S. C. Kachlany,
R. DeSalle, and D. H. Figurski.
2001.
Phylogeny of genes for secretion NTPases: identification of the widespread tadA subfamily and development of a diagnostic key for gene classification.
Proc. Natl. Acad. Sci. USA
98:2503-2508[Abstract/Free Full Text].
|
| 49.
|
Rashkova, S.
1998.
Studies of subcellular localization and complex formation of the Agrobacterium tumefaciens transport ATPase VirB11. Ph.D. thesis.
University of Texas Houston Medical School, Houston.
|
| 50.
|
Rashkova, S.,
X.-R. Zhou, and P. J. Christie.
2000.
Self-assembly of the Agrobacterium tumefaciens VirB11 traffic ATPase.
J. Bacteriol.
182:4137-4145[Abstract/Free Full Text].
|
| 51.
|
Rashkova, S.,
G. M. Spudich, and P. J. Christie.
1997.
Mutational analysis of the Agrobacterium tumefaciens VirB11 ATPase: identification of functional domains and evidence for multimerization.
J. Bacteriol.
179:583-589[Abstract/Free Full Text].
|
| 52.
|
Rivas, S.,
S. Bolland,
E. Cabezon,
F. M. Goni, and F. de la Cruz.
1997.
TrwD, a protein encoded by the IncW plasmid R388, displays an ATP hydrolase activity essential for bacterial conjugation.
J. Biol. Chem.
272:25583-25590[Abstract/Free Full Text].
|
| 53.
|
Sagulenko, V.,
E. Sagulenko,
S. Jakubowski,
E. Spudich, and P. J. Christie.
2001.
VirB7 lipoprotein is exocellular and associates with the Agrobacterium tumefaciens T-pilus.
J. Bacteriol.
183:3642-3651[Abstract/Free Full Text].
|
| 54.
|
Sandkvist, M.
2001.
Biology of type II secretion.
Mol. Microbiol.
40:271-283 |
![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Top
Abstract
Introduction
