Previous Article | Next Article ![]()
Journal of Bacteriology, October 2001, p. 5942-5955, Vol. 183, No. 20
, Institute of Biochemistry, University of
Stuttgart, 70569 Stuttgart, Germany,1 and
Centre for High Resolution Imaging and Processing,
University of Dundee, Dundee DD1 5EH, Scotland, United Kingdom2
Received 11 May 2001/Accepted 26 July 2001
Selective disintegration of membrane-enclosed autophagic bodies is
a feature of eukaryotic cells not studied in detail. Using a
Saccharomyces cerevisiae mutant defective in
autophagic-body breakdown, we identified and characterized Aut5p, a
glycosylated integral membrane protein. Site-directed mutagenesis
demonstrated the relevance of its putative lipase active-site motif for
autophagic-body breakdown. aut5 All eukaryotic cells use
autophagy as a transport pathway to deliver part of their own
intracellular constituents to the lysosome (vacuole) for degradation.
Autophagy helps cells to survive periods of nutrient limitation by
recycling amino acids and other cellular building blocks. Autophagy has
initially been studied in mammalian cells (7). During
recent years our mechanistic and molecular knowledge of autophagy
emerged due to work using Saccharomyces cerevisiae as a
model of mammalian cells (21, 19, 38, 36). Autophagy
starts with the formation of autophagosomes,
double-membrane-layered vesicles, which enclose cytosol, and
even whole organelles such as mitochondria. After fusion of
autophagosomes with the vacuolar membrane, monolayered autophagic
bodies are released into the vacuole, where they are broken down
together with their cytosolic contents (3, 33). The
breakdown of vesicles significantly distinguishes autophagy from
classical protein transport pathways. Classical vesicle-mediated
protein transport pathways such as secretion utilize monolayered
vesicles, which after fusion with the target membrane directly release
their contents. Autophagy, however, uses double-membrane-layered
autophagosomes, which release still-membrane-enclosed autophagic bodies
into the vacuole. Disintegration of their limiting membrane must occur
to allow the vacuolar hydrolases access to the cytosolic content.
Lysis of membranes has been recognized as an important step in the
pathogenesis of microorganisms such as Listeria spp., which escape from the phagosome into the host cell cytosol using a
pore-forming cytolysin and two phospholipases (12).
However, as a feature of the normal life cycle of eukaryotic cells,
disintegration of membranes, especially of autophagic bodies, has not
been studied in detail so far. To break down membranes is a challenging
task for the cell, since a failure in selectivity and control implies an enormous risk for cellular life.
The breakdown of autophagic bodies depends on proteinases A and B
(33, 37) and on vacuolar acidification (23).
How proteinases alone should be able to break down vesicles enclosed by
a lipid membrane remains elusive, however. To answer this question, we isolated S. cerevisiae aut4 and aut5 mutants with
a defect in the breakdown of autophagic bodies. AUT4 encodes
a protein with limited homologies to permeases (32). Here
we identify and characterize Aut5p as a glycosylated integral membrane
protein. Aut5p contains a lipase active-site motif, which we
demonstrate by site-directed mutagenesis to be essential for the
breakdown of autophagic bodies. While preparing this paper,
AUT5 was independently identified as CVT17 based
on its essential function in the maturation of proaminopeptidase I
(35). In growing cells proaminopeptidase I reaches the
vacuole enclosed in Cvt bodies, which resemble autophagic bodies
but are smaller in size and exclude cytosol (2).
Consistent with our findings, Aut5p/Cvt17p was found to be required for
the lysis of Cvt bodies and the importance of the lipase active-site serine was shown (35). Our study significantly extends
this characterization of Aut5/Cvt17p by focusing on autophagic aspects. Vacuolar acidification and the presence of mature vacuolar proteases are prerequisites for the breakdown of autophagic bodies. Here we
additionally check aut5 The MVB pathway has been implicated in the vacuolar targeting of
the integral membrane protein procarboxypeptidase S (proCPS) (24,
25, 30). After entry in the ER, proCPS is sorted from the Golgi
apparatus to the vacuole via a prevacuolar compartment (prevacuolar
endosome). From the prevacuolar compartment, membrane proteins are
normally delivered to the limiting vacuolar membrane. ProCPS, however,
is sorted by the novel MVB pathway to 50-nm-diameter internal vesicles.
The MVB sorting pathway (24) starts at the prevacuolar
endosome, where first invaginations into the lumen of the organelle are
formed, followed by specific sorting of integral membrane proteins such
as proCPS to these invaginations. Next vesicles pinch off from the
limiting membrane of the prevacuolar endosome and bud into its lumen.
This leads to the formation of an MVB, a prevacuolar endosome filled
with internal vesicles carrying specific cargo molecules such as proCPS
(24). Then the multivesicular body fuses with the vacuole,
thus releasing its internal vesicles into the vacuolar lumen. Finally,
in the vacuole the 50-nm-diameter vesicles are thought to be broken
down (24). Our localization of Aut5-Ha at 50-nm-diameter
intravacuolar vesicles and the lack of vacuolar Aut5-Ha in wild-type
cells, together with the results of our pulse-chase experiments,
clearly indicate Aut5-Ha degradation dependent on vacuolar
proteinase A, with a half-life of 50 to 70 min.
Strains, media, and materials.
Standard media were prepared
according to the methods described in reference 1;
SMD medium contains 0.67% Bacto Yeast Nitrogen Base, 2%
glucose, and required supplements. If not otherwise mentioned, starvation was done in 1% potassium acetate.
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.20.5942-5955.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Aut5/Cvt17p, a Putative Lipase Essential for
Disintegration of Autophagic Bodies inside the Vacuole
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
cells show reduced
protein turnover during starvation and are defective in maturation of
proaminopeptidase I. Most recently, by means of the latter phenotype,
Aut5p was independently identified as Cvt17p. In this study we
additionally checked for effects on vacuolar acidification and detected
mature vacuolar proteases, both of which are prerequisites for
autophagic-body lysis. Furthermore, biologically active
hemagglutinin-tagged Aut5p (Aut5-Ha) localizes to the endoplasmic
reticulum (nuclear envelope) and is targeted to the vacuolar
lumen independent of autophagy. In pep4
cells immunogold electron microscopy located Aut5-Ha at
~50-nm-diameter intravacuolar vesicles. Characteristic
missorting in vps class E and fab1
cells, which affects the multivesicular body (MVB) pathway, suggests
vacuolar targeting of Aut5-Ha similar to that of the MVB pathway. In
agreement with localization of Aut5-Ha at intravacuolar vesicles in
pep4
cells and the lack of vacuolar Aut5-Ha in
wild-type cells, our pulse-chase experiments clearly indicated that
Aut5-Ha degradation with 50 to 70 min of half-life is dependent on
vacuolar proteinase A.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
cells for these phenotypes.
Furthermore, using a biologically active hemagglutinin-tagged version
(Aut5-Ha), we augment the results of the Cvt17 study (35)
by localizing the protein at the endoplasmic reticulum (ER) (nuclear
envelope) and demonstrate its targeting to the vacuolar lumen at
~50-nm-diameter vesicles independent of autophagy. Localization in
50-nm-diameter vesicles in the vacuolar lumen of pep4
cells together with a characteristic missorting in vps class
E and fab1
cells, which affects the multivesicular
body (MVB) pathway (24, 25), suggests that Aut5-Ha reaches
the vacuole by a means similar to the MVB pathway.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Yeast strains used in this study
Plasmids and DNA manipulation. For isolation of the complementing genomic plasmid p303/I1, we followed a previously described procedure (31).
Digestion of p303/I1 with XbaI yielded a 4.2-kb fragment, which was ligated into the XbaI site of the centromeric plasmid pRS316 to yield pUE05 (pRS316-AUT5). pUE05 was digested with NotI and SalI, and the resulting AUT5-containing fragment (4.3 kb) was ligated into the 2µm plasmid pRS426 (cut with NotI and SalI) to yield pUE06 (pRS426-AUT5). Primers MUTup (AGAGGACGTATCGTAGGGAATTGTGATGCTTG) and MUTdown (TCCAGTTTAAACGAGCTCGAATTCCTATTAGC) were used to amplify by PCR the AUT5::Ha3 cassette with its native promoter by using chromosomal DNA of strain YUE05 as the template. The PCR product was ligated into the SmaI site of pRS426 to yield pUE07 (pRS426-AUT5::HA3). pUE07 was cut with BamHI and HindIII, and the resulting 2.6-kb fragment was ligated into pRS316 cut with BamHI and HindIII to yield pUE13 (pRS316-AUT5::HA3).Total protein turnover. We followed an established protocol to measure total protein turnover (31). Cells were grown at 30°C to 5 × 107/ml in 0.17% yeast nitrogen base without amino acids and ammonium sulfate, 2% proline, 2% glucose, and required auxotrophic nutrients were pulsed with [35S]methionine during the last 14 h of growth. After transfer to 1% K acetate with 10 mM methionine and incubation at 30°C, samples were drawn and precipitated with trichloroacetic acid. After centrifugation, the radioactivity released to the supernatant was measured with a scintillation counter (Wallac 1410; Pharmacia). Protein breakdown was calculated as increase of soluble radioactivity divided by insoluble radioactivity at 0 h.
Quinacrine staining. Logarithmically growing cells and cells starved for 4 h in 1% potassium acetate were harvested and washed in 10 mM HEPES-2% glucose (pH 7.4). Cells were then incubated in the same buffer for 3 to 5 min with 200 µM quinacrine (27) and washed with buffer.
Glass bead lysis and membrane association. Cells were grown to stationary phase and starved for 4 h in 1% potassium acetate. Sixty optical density units at 600 nm (OD600) of cells was harvested, resuspended in breaking buffer (50 mM Tris-HCl [pH 7.5], 10 mM EDTA) containing Complete protease inhibitors (Roche) and 1 mM phenylmethylsulfonyl fluoride, and vortexed with glass beads at 4°C for 10 min. To remove cell debris, the samples were centrifuged for 5 min at 500 × g. One volume of supernatant was added to 1 volume each of (i) breaking buffer, (ii) 2 M K acetate, (iii) 0.2 M Na2CO3, (iv) 2.5 M urea, and (v) 2% Triton X-100 and incubated on ice for 45 min. Membranes were pelleted by centrifugation at 100,000 × g for 45 min. The supernatant was precipitated with trichloroacetic acid. Pellets (membrane fraction) and trichloroacetic acid precipitates were resuspended in sample buffer and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting.
Deglycosylation.
Thirty OD600 units of
cells starved for 4 h was harvested, washed twice with cold TBS
(20 mM Tris-HCl [pH 7.6], 200 mM NaCl), resuspended in 400 µl of
lysis buffer (50 mM HEPES [pH 7.5], 140 mM NaCl, 1 mM EDTA, 10%
glycerol, 0.5% sodium deoxycholate, 2% Triton X-100, 0.1% SDS)
supplemented with protease inhibitors, and lysed with glass beads (see
above). After cell debris was removed, the supernatant was divided in
two aliquots and immunoprecipitated with anti-Ha antibody for 3 h
at 4°C, followed by 1 h of incubation with protein A-Sepharose
(Pharmacia). The samples were washed twice with lysis buffer and once
with wash buffer (50 mM
KH2PO4 [pH 5.5], 0.02%
SDS). Twenty-five microliters of wash buffer containing 0.1 M
-mercaptoethanol was added to the protein A-Sepharose pellets. After
addition of 15 mU of endoglycosidase H (Roche) or mock treatment, the
samples were incubated at 37°C for 1 h. Sample buffer was added,
and the samples were analyzed by SDS-PAGE and immunoblotting.
Pulse-chase analysis of Aut5-Ha. Cells were grown to mid-log phase in SMD, and for each time point 2 OD600 units was collected. Cells resuspended in fresh SMD were pulse-labeled for 20 min (20 µCi of Expre35S35S-label [NEN, Boston, Mass.] per OD600 unit). Labeled cells were then suspended at 2 OD600 units/ml in SMD containing 0.2% yeast extract, 6 mg of methionine per ml, 3 mg of cysteine per ml, and 1 mg of bovine serum albumin per ml and chased at 30°C. At the times indicated in the figures, 2 OD600 units was transferred to a chilled tube and sodium azide was added to a final concentration of 10 mM. Cells were washed with cold 10 mM sodium azide and resuspended in 100 µl of lysis buffer (50 mM HEPES [pH 7.5], 140 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% sodium deoxycholate, 2% Triton X-100, 0.1% SDS). Lysis was done by vigorously vortexing the suspension four times for 1 min each time with glass beads and intermittent cooling for 1 min. For solubilization, 900 µl of lysis buffer was added and the solution was vortexed again and incubated on ice for 30 min. After insoluble material was removed by centrifugation, 5 µl of antiserum to Ha was added to the supernatant and incubated at room temperature for 1 h. Then 70 µl of protein A-Sepharose beads (0.5% in lysis buffer) was added, and the mixture was again incubated for 1 h at room temperature on a rotary mixer. Immune complexes bound to the beads were washed three times with lysis buffer, and samples were deglycosylated as described above. After endoglycosidase H treatment, sample buffer was added, the mixture was incubated for 20 min at 37°C, and 25 µl of the immunoprecipitated protein corresponding to 1 OD600 unit of cells was loaded onto a 7% polyacrylamide-SDS gel. After electrophoresis, the dried gel was visualized using a Storm PhosphorImager (Molecular Dynamics).
Indirect immunofluorescence.
Immunofluorescence was
performed as described previously (9) with the following
modifications. Approximately 10 OD600 units of
starved cells was fixed by adding directly to the culture formaldehyde to a final concentration of 3.5% and 1 M potassium phosphate (pH 6.5)
to a final concentration of 100 mM. After 2 h of fixation at room
temperature, the cells were washed twice with buffer I (1.2 M sorbitol,
0.1 M KH2PO4 [pH 6.5]),
resuspended in buffer I containing 20 mM
-mercaptoethanol and 45 µg of Zymolyase-100T per ml, and spheroplasted at 30°C for 30 min.
Cells were first labeled with mouse anti-Ha antibody; as a secondary
antibody Cy3-conjugated goat-anti-mouse immunoglobulin G (Dianova) was
used. Cells were covered with 1 drop of mounting solution containing
DAPI (4',6'-diamidino-2-phenylindole, 0.4 µg/ml) and visualized with
a Zeiss Axioskop 2 Plus equipped with an Axiocam digital image system.
Electron microscopy.
For immunogold electron microscopy,
cells were fixed in 4% paraformaldehyde in 0.1 M citrate buffer,
embedded in 10% gelatin in phosphate-buffered saline, and infiltrated
in 2.1 M sucrose and 20% polyvinylpyrrolidone. Small blocks were
mounted on specimen holders and frozen in liquid nitrogen. Thin
sections were cut with a diamond knife at
100°C, mounted on grids,
and immunolabeled with mouse anti-Ha followed by goat
F(ab)2 coupled to 10-nm-thick gold. The sections
were contrasted and embedded in methyl cellulose-uranyl acetate.
Site-directed mutagenesis. Aut5(S332A)-Ha was generated by PCR. For the first PCR, a mutagenic primer binding 14 bp upstream and 17 bp downstream of position 994 of the AUT5 coding region with a guanine instead of a thymine in between (GGGTCACAGGCCACgCACTGGGAGGCGCATTG, where "g" is the guanine in question) and a second primer complementary to a region downstream of AUT5-Ha (MUTdown, see above) were used to amplify a megaprimer (736 bp) with chromosomal DNA of strain YUE05 as a template. In a second PCR, with plasmid pUE05 as a template, this megaprimer and a primer binding to a region 844 to 825 bp upstream of AUT5 (MUTup, see above) were used to amplify the entire AUT5(S332A)-Ha gene, including its native promoter. The PCR product was subcloned into the SmaI site of pRS426, resulting in plasmid pUE09 [pRS426-AUT5(S332A)-Ha]. Sequencing confirmed the correct sequence of the mutated AUT5-Ha gene.
| |
RESULTS |
|---|
|
|
|---|
Identification of the AUT5 gene. After EMS mutagenesis of S. cerevisiae cells, we previously isolated a set of putative autophagy mutants based on their defect in starvation-induced protein breakdown (37). We further screened these strains after a starvation period for nitrogen by light microscopy for the accumulation of autophagic bodies in the vacuole and thus identified aut5-1 mutant cells, which exhibit a defect in the breakdown of autophagic bodies (not shown) (14).
Here we now report a significantly reduced sporulation frequency of homozygous aut5-1 diploid cells. After transformation with a YCp50-based genomic library (28), we looked for reversion of this phenotype using a previously described procedure (22, 31) based on the random spore protocol to isolate a plasmid carrying a complementing genomic insert. Partial sequencing localized the genomic insert to chromosome III and pointed to YCR068w as the corresponding open reading frame (Fig. 1A). We generated a chromosomal deletion of YCR068w and confirmed correct gene replacement by Southern blotting (not shown). Crossing and subsequent tetrad dissection of aut5-1 ycr068w
cells
confirmed the identity of YCR068w with AUT5.
aut5-1 ycr068w
diploid cells showed a significantly reduced sporulation frequency, but enough asci were formed to allow
tetrad dissection. aut5
cells grow normally at 30°C on rich medium.
|
Aut5p is a putative membrane protein containing a lipase active-site motif. Resequencing of AUT5 unraveled a sequencing error in the databases, which was corrected in the latest release. AUT5 encodes a protein of 520 amino acids (Fig. 1B) with a predicted molecular mass of 58 kDa. Aut5p shares 43% identity with AL033391 from C. albicans, 39% identity with SPAC23C4 of S. pombe, and 31% identity with PSI-7, a gene identified in Cladosporium fulvum for its induced expression during starvation and pathogenic growth on tomato plants (5).
Aut5p contains one to three potential transmembrane domains (Fig. 1C). The first ranges from amino acids 15 to 35 and is predicted to be a signal or stop transfer peptide, which might function as an ER import sequence. Two further regions with less pronounced hydrophobicity from amino acids 324 to 348 and 388 to 408 are not identified as putative transmembrane domains by all programs. Most interestingly, a pattern search identified a lipase active-site motif from amino acids 326 to 335 (Prosite accession no. PS00120) (Fig. 1B). This potential lipase active site is located within the second hydrophobic domain. Furthermore, three potential Asn glycosylation sites are predicted.Aut5p is essential for the breakdown of autophagic bodies in the
vacuole.
In the vacuoles of wild-type cells autophagic bodies are
rapidly broken down dependent on the presence of vacuolar proteinases (Fig. 2A). In contrast,
aut5
cells grown into late stationary phase or starved
for nitrogen accumulate 300- to 400-nm-diameter vesicles in the vacuole
(Fig. 2C), similar to cells lacking proteinase A (Fig. 2B).
AUT1 is essential for formation of autophagosomes (29) (16). To confirm the autophagic nature
of the vesicles accumulating in starved aut5
cells, we
constructed an aut1
aut5
double mutant. As
expected, these cells lack the starvation-induced accumulation of 300- to 400-nm-diameter vesicles inside the vacuole (Fig. 2D).
|
aut5
cells exhibit phenotypes typical for cells
defective in autophagy or vacuolar proteolysis.
A defect in
vacuolar lysis of the membranes of autophagic bodies prevents the
access of vacuolar proteinases to the autophagocytosed material and
thus should cause a significantly reduced vacuolar protein turnover
rate. To check this, growing cells were metabolically labeled with
radioactive methionine and then transferred into nitrogen-free
starvation medium to induce autophagy. Aliquots were withdrawn, and the
amount of acid-soluble small peptides generated by proteolysis was
measured. As expected, aut5
cells exhibited a
significantly reduced total protein breakdown rate (Fig.
3A), similar to that of
pep4
cells, which due to the lack of vacuolar proteinase
A show a severe defect in vacuolar proteolysis (34).
|
cells grown to stationary
phase are further impaired in maturation of proaminopeptidase I (Fig. 3B, lane 4) (14). This finding is consistent with the most
recently published analysis of Cvt17p (35).
Vacuolar pH appears normal, and mature vacuolar proteinases are
detectable in aut5
cells.
Vacuolar acidification
is a prerequisite for disintegration of autophagic bodies
(23). We therefore checked aut5
cells for
phenotypes of vacuolar acidification mutants (15, 26, 42).
Such mutants typically exhibit a defect in accumulation of the
fluorescent dye quinacrine in the vacuole (Fig.
4A) or are impaired for growth on media
(i) with pH 7.0, (ii) with high concentrations of calcium ions, and
(iii) containing a nonfermentable carbon source such as glycerol (Fig.
4B). Growing and starved aut5
cells showed normal
vacuolar accumulation of quinacrine, and they grew normally in
selective media, indicating nonaltered vacuolar acidification. A lack
of mature vacuolar proteinases also causes an accumulation of
autophagic bodies in the vacuole (33, 37). We
therefore confirmed by immunoblotting in growing and starved
aut5
cells the presence of the mature proteinases B
and Y (Fig. 4C).
|
Biologically active Aut5p-HA is an integral membrane protein.
We generated yeast cells carrying a C-terminally
Ha3-tagged AUT5 gene under the control
of its native promoter on the chromosome. Correct tagging was confirmed
by Southern blotting (not shown). In immunoblots of these cells, an
antibody against Ha clearly detected a band at 75 kDa (Fig.
5A, lane 2) which was absent in cells
lacking the Ha-tagged protein (Fig. 5A, lane 1). Dosage-dependent expression of Aut5-Ha from a centromeric plasmid (Fig. 5A, lane 4) and
a 2µm plasmid (Fig. 5A, lanes 5 and 6) further confirmed detection of
Aut5-Ha. Chromosome- and plasmid-expressed Aut5-Ha complemented the
aut5
defect in the breakdown of autophagic bodies during
starvation (not shown) and the defect in maturation of proaminopeptidase I in stationary cells (Fig. 5B, lanes 1 to 6), indicating the biological activity of Aut5-Ha.
|
cells
lacking proteinase A for this experiment to also examine the membrane
association status of the part of Aut5-Ha which resides in the
vacuolar lumen. In wild-type cells, the vacuolar part of Aut5-Ha is
missing due to degradation. Therefore, this experiment extends the
study describing Cvt17/Aut5 as an integral membrane protein in
wild-type cells (35).
Starved pep4
cells expressing Aut5-Ha from the chromosome
under the control of its native promoter were homogenized with glass
beads and centrifuged to yield a supernatant and pellet fraction. As
shown in Fig. 5C, Aut5-Ha was almost completely pelletable. Incubation
with 1 M potassium acetate, 0.1 M
Na2CO3, or 2.5 M urea did
not solubilize significant amounts of Aut5-Ha. Incubation with 1%
Triton X-100, however, resulted in detection of most of Aut5-Ha in the
supernatant fraction (Fig. 5C). Aut5-Ha in this respect behaves like
the integral membrane protein Vph1 and differs from the peripherally
membrane-attached Vma2p (Fig. 5C). To exclude the possibility that
Aut5-Ha might be trapped inside vesicles, thus mimicking
characteristics of an integral membrane protein, we used quite harsh
conditions for glass bead lysis of the cells. Therefore, part of the
peripheral membrane protein Vma2p was already released into the
supernatant with buffer alone. Our findings suggest that in starved
pep4
cells Aut5-Ha is an integral membrane protein.
Aut5-Ha is glycosylated. Most integral membrane proteins enter the ER-Golgi sorting pathway, where they undergo posttranslational modifications and are glycosylated. Aut5p contains three putative N-linked glycosylation sites, and Aut5-Ha showed a smear to higher molecular mass in immunoblots (Fig. 5A), which suggests that Aut5p is glycosylated. To test this, we treated cell extracts with endoglycosidase H (Fig. 5D). After endoglycosidase H digestion, Aut5-Ha showed a mobility shift to a lower molecular mass (~73 kDa) (Fig. 5D), showing glycosylation of the protein.
Aut5-Ha reaches the vacuole via an autophagy-independent
pathway.
We next performed indirect immunofluorescence microscopy
of starved cells, expressing Aut5-Ha from the chromosome under the control of its native promoter, using antibodies to Ha. The ring-like Aut5-Ha immunostaining (Fig. 6A) seen in
wild-type cells clearly surrounded the nucleus, which was stained with
DAPI (Fig. 6A), suggesting localization of Aut5-Ha at the ER (nuclear
envelope). In sucrose density gradient fractionation using starved
wild-type cells expressing Aut5-Ha from the chromosome, the ER marker
Kar2p sedimented to a position similar to that of Aut5-Ha (not shown), further supporting ER localization.
|
cells, which due to the lack of vacuolar proteinase A accumulate autophagic bodies in the vacuole during starvation (33) (37). In these cells,
also expressing Aut5-Ha from the chromosome, a significant amount of
Aut5-Ha was detected in the vacuole (Fig. 6B). Another part was still
seen at a ring-like structure surrounding the nucleus, indicative of the ER (Fig. 6B).
We further tested whether Aut5-Ha reaches the vacuole via autophagy or
other pathways such as the ER-Golgi sorting pathway. We localized
Aut5-Ha by immunofluorescence in starved aut3
pep4
double mutant cells expressing Aut5-Ha from the
chromosome. The lack of Aut3p, a serine/threonine kinase, blocks early
steps of autophagy (31, 17) and thus prevents accumulation
of autophagic bodies in the vacuoles of starved aut3
pep4
cells. Nevertheless, as shown in Fig. 6C,
significant amounts of Aut5-Ha were detectable in the vacuole,
suggesting a transport of Aut5-Ha independent of the autophagic
traffic. No immunofluorescence signal was seen in wild-type and
pep4
control cells lacking an Ha tag (not shown).
Localizations similar to those in starved cells were seen in wild-type,
pep4
, and aut3
pep4
cells
grown to log phase in nutrient-rich medium (not shown).
Aut5-Ha is rapidly degraded dependent on vacuolar proteinase
A.
The presence of Aut5-Ha in vacuoles of cells defective in
vacuolar proteinase A and the absence of the protein in vacuoles of
wild-type cells suggests that Aut5-Ha might be rapidly degraded in
wild-type vacuoles. To test this hypothesis, we performed a pulse-chase
experiment by metabolic labeling and immunoprecipitation. Indeed,
chromosomally expressed Aut5-Ha is rapidly degraded in both wild-type
and aut3
cells, defective in early phases of autophagy (Fig. 6D). Stabilization of the protein is clearly seen in cells defective in vacuolar proteinase A and in aut3
pep4
cells (Fig. 6D). The stabilization seen in cells
lacking vacuolar proteinase A is in contrast to findings in the study
of Cvt17p (35), for which degradation of Cvt17p
"independent of the major vacuole proteases" was reported.
Quantification using a PhosphorImager indicates a half-life of Aut5-Ha
of 50 to 70 min in wild-type cells. To get sharper bands, samples were
deglycosylated with endoglycosidase H prior to SDS-PAGE. The observed
shift to a slightly higher molecular mass during the time course might
be due to carbohydrate side chains of the complex type, which are not
released by endoglycosidase H.
Immunogold electron microscopy suggests localization of Aut5-Ha at
~50-nm-diameter intravacuolar vesicles and at the ER (nuclear
envelope).
Our immunofluorescence experiments with
aut3
pep4
cells (Fig. 6C) suggest
localization of chromosomally expressed Aut5-Ha at the ER and in the
vacuolar lumen. Since Aut5-Ha is an integral membrane protein (Fig.
5C), these findings point to the existence of membranous structures in
the vacuolar lumen which are formed independent of autophagy. To
further specify the nature of these intravacuolar structures, we
carried out immunogold electron microscopy using antibodies against Ha.
Immunofluorescence also showed that Aut5-Ha expressed from the
chromosome and the 2µm plasmid localized to identical cell
compartments (not shown). Since higher protein levels are needed to
localize epitopes in thin electron microscopical sections, we used the
plasmid expression vector for immunoelectron microscopy. Control cells
not expressing Aut5-Ha were unlabeled (not shown), indicating the
specificity of our labeling. The distribution of gold labeling in
different cell compartments was quantitated by systematically screening
labeled thin sections cut from cell pellets. In starved
pep4
cells (Fig.
7A and B) the gold label (about 750 gold particles were counted) was found in the cytoplasm (52% of gold particles) and in the vacuole (48% of gold particles). The cytoplasmic labeling was found in the nuclear envelope and at the
cortical ER (42% of total cytoplasmic label) and associated with other
unidentified membrane structures. Inside the vacuole, labeling was
associated with ~50-nm-diameter vesicles (78% of total vacuolar
label) (Fig. 7B), autophagic bodies (12%), and the vacuolar membrane
(10%). Consistent with our immunofluorescence experiments, a block at
the early steps of autophagy in aut3 cells did not impair
the targeting of Aut5-Ha to ~50-nm-diameter vesicles in the
vacuolar lumen (Fig. 7C and D). Immunogold electron microscopy further
confirmed the localization of immunofluorescent Aut5-Ha both at
the ER (nuclear envelope) (Fig. 7C and D) and in the vacuolar lumen.
|
Vacuolar targeting of Aut5-Ha is characteristically affected in vps class E mutants and in mutants defective in the phosphatidylinositol 3-phosphate 5-kinase Fab1p. The occurrence of 40- to 50-nm-diameter vesicles in the vacuolar lumen has already been described (40) and implicated in the vacuolar targeting of CPS via the MVB pathway (24, 25). CPS, a resident vacuolar hydrolase, is synthesized as an inactive integral membrane proform which reaches the vacuolar lumen attached to 50-nm-long vesicles (24). In the vacuole the prosequence of proCPS, which serves as a membrane anchor, is proteolytically cleaved and mature soluble CPS is released to the vacuolar lumen.
Localization of Aut5-Ha at 50-nm-diameter vesicles in the vacuole suggests that Aut5-Ha might reach the vacuole in a way similar to the MVB pathway. The phosphatidylinositol 3-phosphate 5-kinase Fab1p is specifically required for the sorting of proCPS to the vacuolar lumen via the MVB pathway (24), without affecting the normal biosynthetic vacuolar traffic of carboxypeptidase Y and alkaline phosphatase (41, 11). In the absence of Fab1p, the defect in sorting proCPS to internal vesicles in the prevacuolar endosome causes almost complete mislocalization of the protein to the limiting vacuolar membrane (24). Consistently, indirect immunofluorescence detected mislocalization of a significant part of Aut5-Ha to the vacuolar membrane in fab1
cells (Fig. 8A), suggesting vacuolar targeting of Aut5-Ha similar to that of the MVB
pathway. In agreement with our previous findings (Fig. 6A to C), also
in fab1
cells part of Aut5-Ha is detected at the ER (Fig.
8A).
|
cells, we checked localization of Aut5-Ha in indirect
immunofluorescence in vps4
(end13
),
vps27
, and vps28
mutants, three members of the vps class E family. As expected, all three mutants
showed mislocalization of Aut5-Ha (Fig. 8B to D) reminiscent of that described for proCPS, suggesting that, similar to what occurs with
proCPS, targeting of Aut5-Ha depends on Vps class E proteins.
Site-directed mutagenesis of the putative lipase active-site serine
inhibits the vacuolar breakdown of autophagic bodies.
Aut5p
shows the putative lipase active-site motif IWVTGHSLGG from amino
acids 326 to 335. To test the relevance of this putative active-site
serine for the biological activity of Aut5p, we selectively replaced
serine 332 by alanine. Expression of AUT5(S332A)-Ha from a 2µm
plasmid in aut5
cells led to the detection of a
wild-type-like steady-state level of the mutated protein (Fig. 5A,
lanes 7 and 8). Also, localization of Aut5(S332A)-Ha in
aut5
and aut5
pep4
cells
checked by indirect immunofluorescence was like that of the wild type
(not shown). However, Aut5(S332A) was unable to complement the defect
in maturation of proaminopeptidase I (Fig. 5B, lane7) or the defect in
the vacuolar breakdown of autophagic bodies in aut5
cells
(not shown). These findings suggest an essential function of serine 332 for the biological activity of Aut5p. We further used different
commonly used lipase substrates under various conditions but were
unable to directly measure a putative lipase activity of Aut5p (not
shown). Beside the apparent instability of Aut5p, our inability to
measure this activity might be due to the requirement for more specific
substrates or the lack of specific cofactors.
| |
DISCUSSION |
|---|
|
|
|---|
Yeast cells are able to break down numerous membrane-enclosed autophagic bodies in their vacuoles, leaving the limiting vacuolar membrane intact. Except for our knowledge of the need of vacuolar acidification (23) and vacuolar proteinases (33, 37), components of this inevitably highly specific membrane disintegration machinery remain mysterious. We here identified Aut5p, a component essential for disintegration of autophagic bodies and demonstrated the relevance of its lipase active-site motif via site-directed mutagenesis.
Since autophagic bodies are lysed inside the vacuole, it seems conceivable that Aut5p is targeted to the vacuole, probably simultaneously with autophagic bodies. Indeed, our pulse-chase analysis indicates a rapid (half-life, 50 to 70 min) turnover of Aut5-Ha dependent on the presence of vacuolar proteinase A. Consistently, in cells defective in vacuolar proteolysis, indirect immunofluorescence (Fig. 6B and C) and immunogold electron microscopy (Fig. 7B to D) visualized significant amounts of Aut5-Ha in the vacuole. However, in wild-type cells this vacuolar pool of Aut5-Ha was lacking (Fig. 6A). This finding is in contrast to findings in the study of Cvt17p, for which degradation "independent of the major vacuole proteases" was reported (35). We believe this discrepancy might be due to the use of an antiserum raised against synthetic peptides, since in our hands the protein was hard to detect with two individual antisera against synthetic peptides (not shown), but a reliable strong signal was detectable using the Ha-tagged species.
How does Aut5p reach the vacuole? The breakdown of Aut5-Ha in
autophagy-deficient aut3
cells (Fig. 6D), together with
the vacuolar localization in starved (Fig. 6C) and logarithmically growing (not shown) aut3
pep4
cells in
immunofluorescence, argues against the use of the autophagic pathway.
This conclusion is consistent with our statistical analysis of
immunogold microscopy. We cannot exclude, however, the possibility that
a small portion of Aut5p travels to the vacuole via autophagy at
autophagic bodies and then induces their breakdown, but our data
clearly indicate that the major part of Aut5-Ha reaches the vacuole
independent of autophagy.
The observed glycosylation of Aut5-Ha demonstrates that Aut5-Ha
follows the ER-to-Golgi sorting pathway. Immunofluorescence suggests a
localization of Aut5-Ha in the vacuolar lumens of pep4
cells (Fig. 6B and C). Since Aut5-Ha in these cells behaves as an
integral membrane protein (Fig. 5C), we expected a localization at
membranous structures inside the vacuole. Immunogold electron microscopy in fact displayed localization at ~50-nm-diameter vesicles (Fig. 7B to D) in the vacuolar lumen. The appearance of 50-nm-diameter vesicles in the vacuolar lumen is reminiscent of the function of
the MVB pathway (24, 25). The MVB pathway at the
prevacuolar endosome (compartment) diverges from the biosynthetic
ER-to-Golgi vacuolar protein sorting pathway. Integral membrane
proteins, which are cargo molecules of the MVB pathway, are
specifically directed to invaginations of the membrane of the
prevacuolar endosome. Then vesicles carrying these cargo molecules
branch off to the interior of the organelle, and a so-called MVB
is formed. Fusion of the MVB with the vacuole finally releases the
~50-nm-diameter vesicles to the vacuolar lumen, where they are
thought to be broken down (24).
Vps class E mutants affect both the biosynthetic and MVB traffic to the vacuole. In these mutants proCPS, which is a cargo molecule of the MVB pathway, is retarded at the prevacuolar compartment and, due to a defect in sorting to internal vesicles at the prevacuolar endosome, is mislocalized to the limiting vacuolar membrane. The phosphatidylinositol 3-phosphate 5-kinase Fab1p is specifically required for MVB sorting but not for biosynthetic vacuolar protein sorting, and therefore a lack of this protein causes no retardation at the prevacuolar endosome but only mislocalization to the vacuolar membrane (41, 11, 24). We observed in both mutant types a mislocalization of Aut5-Ha similar to that described for proCPS (Fig. 8), suggesting a sorting similar to that of the MVB pathway. Taken together our findings suggest that Aut5-Ha reaches the vacuolar lumen after transit through the ER and Golgi apparatus in a way similar to that of the MVB pathway.
The lysis of membranes implies a potential high risk for the cell. Very interesting questions therefore are what prevents a premature activation of such a membrane lysis machinery and what impedes lysis of the vacuolar membrane itself? Our observation that two distinct pathways are used for vacuolar targeting of autophagic bodies and Aut5-Ha, respectively, opens up new vistas in answering these questions. Probably Aut5p, a putative lipase, becomes activated only upon direct interaction with a component present exclusively at autophagic bodies. It would be tempting to speculate that this interacting partner acts similarly to a colipase. This idea would explain not only the specificity in disintegrating autophagic bodies without the integrity of the vacuolar membrane being affected but also how the cell prevents untimely activation of Aut5p on its transit to the vacuole by keeping both partners apart by two different transport pathways, which converge at their final destination, the vacuolar lumen. Since Aut5p might remain in its active form even after lysis of the autophagic body, the observed rapid vacuolar degradation of Aut5-Ha would prevent further trouble. This idea implies that Aut5p exhibits its active site and a putative interaction domain towards the vacuolar lumen and not to the interior of the 50-nm-diameter vesicle. The potential glycosylation sites and the lipase active-site motif of Aut5p are located after its predicted transmembrane domain (Fig. 1B). Since Aut5-Ha is glycosylated, this part of the protein including the lipase active-site motif would be estimated to be exposed to the ER lumen. Assuming that the membrane topology is preserved during sorting, one would therefore indeed expect that the lipase active-site motif together with most of Aut5p is exposed to the outside of the 50-nm-diameter vesicle membrane, i.e., to the vacuolar lumen. Another possibility would be that Aut5p selectively attacks lipid molecules present only at the membranes of autophagic bodies and not at the limiting vacuolar membrane.
Interestingly, Aut5-Ha is localized at the ER (nuclear envelope) in
wild-type cells and also in pep4
cells. This localization is indicated by four lines of evidence: (i) glycosylation, which points
to entry in the ER to the Golgi secretory pathway; (ii) indirect
immunofluorescence of both starved (Fig. 6) and logarithmic (not shown)
cells, which shows a typical ring-like staining around the nucleus;
(iii) sucrose density gradient fractionation of starved wild-type
cells, in which the ER marker Kar2p cosedimented with Aut5-Ha (not
shown); and (iv) immunogold electron microscopy, which showed beside
the vacuolar localization a significant localization at the nuclear
envelope and ER and at the cortical ER (Fig. 7).
Detection of Aut5-Ha at the ER raises the possibility that instead of the vacuolar lumen Aut5p might alternatively function at the ER by hydrolyzing specific lipids, thus rendering autophagic bodies competent for breakdown. The membrane source of autophagic bodies remains unknown, although there are some hints pointing to the ER (8) or the Golgi apparatus (18). One might therefore speculate that lipids modified at the ER by Aut5p are specifically targeted to autophagosomes. Finally, yet unknown components in the vacuole might catalyze the breakdown of autophagic bodies dependent on the presence of these lipid molecules. In this scenario Aut5p would be catalytically active at the ER and most likely also on its transit to the vacuole. To avoid unspecific hydrolysis of membranes, which surely would lead to cell death, Aut5p must therefore exhibit a very high substrate specificity. When Aut5p functions at the ER, the rapid transport to the vacuolar lumen would reflect only protein degradation. Further extensive studies are necessary to distinguish between these models of Aut5p function.
Aut5p shares significant homologies with several proteins of unknown function (Fig. 1B); the homologies very interestingly include the putative lipase active-site motif. This finding might point to a common function of these proteins. The pSI-7 protein from C. fulvum was identified for its induced expression during starvation and its pathogenic growth on tomato plants (5). Probably our work on Aut5p in yeast therefore might also contribute in the future to the understanding of the pathogenic interaction between C. fulvum and plants.
| |
ACKNOWLEDGMENTS |
|---|
We are grateful to S. D. Emr for sharing antibodies with us and to M. Bredschneider for doing the transmission electron micrographs.
We thank D. H. Wolf for many helpful discussions and support.
This work was supported by DFG grant Th752/1-1.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Institute of Biochemistry, University of Stuttgart, Pfaffenwaldring 55, 70569 Stuttgart, Germany. Phone: 49 711 685 4387. Fax: 49 711 685 4392. E-mail: thumm{at}po.uni-stuttgart.de.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Ausubel, F. M., R. Brent, R. E. Kingston, and D. D. Moore. 1987. Current protocols in molecular biology. Greene Publishing Associates, New York, N.Y. |
| 2. |
Baba, M.,
M. Osumi,
S. V. Scott,
D. J. Klionsky, and Y. Ohsumi.
1997.
Two distinct pathways for targeting proteins from the cytoplasm to the vacuole/lysosome.
J. Cell Biol.
139:1687-1695 |
| 3. |
Baba, M.,
K. Takeshige,
N. Baba, and Y. Ohsumi.
1994.
Ultrastructural analysis of the autophagic process in yeast: detection of autophagosomes and their characterization.
J. Cell Biol.
124:903-913 |
| 4. | Brachmann, C. B., A. Davies, G. J. Cost, E. Caputo, J. Li, P. Hieter, and J. D. Boeke. 1998. Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 14:115-132[CrossRef][Medline]. |
| 5. | Coleman, M., B. Henricot, J. Arnau, and R. P. Oliver. 1997. Starvation-induced genes of the tomato pathogen Cladosporium fulvum are also induced during growth in planta. Mol. Plant-Microbe Interact. 10:1106-1109[Medline]. |
| 6. | Cottarel, G. 1995. The Saccharomyces cerevisiae HIS3 and LYS2 genes complement the Schizosaccharomyces pombe his5-303 and lys1-131 mutations, respectively: new selectable markers and new multi-purpose multicopy shuttle vectors, pSP3 and pSP4. Curr. Genet. 28:380-383[CrossRef][Medline]. |
| 7. | Dunn, W. J. 1994. Autophagy and related mechanisms of lysosome-mediated protein degradation. Trends Cell Biol. 4:139-143[CrossRef][Medline]. |
| 8. |
Dunn, W. J.
1990.
Studies on the mechanisms of autophagy: formation of the autophagic vacuole.
J. Cell Biol.
110:1923-1933 |
| 9. | Egner, R., Y. Mahe, R. Pandjaitan, and K. Kuchler. 1995. Endocytosis and vacuolar degradation of the plasma membrane-localized Pdr5 ATP-binding cassette multidrug transporter in Saccharomyces cerevisiae. Mol. Cell. Biol. 15:5879-5887[Abstract]. |
| 10. | Engelman, D. M., T. A. Steitz, and A. Goldman. 1986. Identifying nonpolar transbilayer helices in amino acid sequences of membrane proteins. Annu. Rev. Biophys. Biophys. Chem. 15:321-353[CrossRef][Medline]. |
| 11. |
Gary, J. D.,
A. E. Wurmser,
C. J. Bonangelino,
L. S. Weisman, and S. D. Emr.
1998.
Fab1p is essential for PtdIns(3)P 5-kinase activity and the maintenance of vacuolar size and membrane homeostasis.
J. Cell Biol.
143:65-79 |
| 12. | Goebel, W., and M. Kuhn. 2000. Bacterial replication in the host cell cytosol. Curr. Opin. Microbiol. 3:49-53[CrossRef][Medline]. |
| 13. |
Güldener, U.,
S. Heck,
T. Fielder,
J. Beinhauer, and J. H. Hegemann.
1996.
A new efficient gene disruption cassette for repeated use in budding yeast.
Nucleic Acids Res.
24:2519-2524 |
| 14. |
Harding, T. M.,
A. Hefner-Gravink,
M. Thumm, and D. J. Klionsky.
1996.
Genetic and phenotypic overlap between autophagy and the cytoplasm to vacuole targeting pathway.
J. Biol. Chem.
271:17621-17624 |
| 15. |
Hirata, R.,
N. Umemoto,
M. N. Ho,
Y. Ohya,
T. H. Stevens, and Y. Anraku.
1993.
VMA12 is essential for assembly of the vacuolar H(+)-ATPase subunits onto the vacuolar membrane in Saccharomyces cerevisiae.
J. Biol. Chem.
268:961-967 |
| 16. | Ichimura, Y., T. Kirisako, T. Takao, Y. Satomi, Y. Shimonishi, N. Ishihara, N. Mizushima, I. Tanida, E. Kominami, M. Ohsumi, T. Noda, and Y. Ohsumi. 2000. A ubiquitin-like system mediates protein lipidation. Nature 408:488-492[CrossRef][Medline]. |
| 17. |
Kamada, Y.,
T. Funakoshi,
T. Shintani,
K. Nagano,
M. Ohsumi, and Y. Ohsumi.
2000.
Tor-mediated induction of autophagy via an Apg1 protein kinase complex.
J. Cell Biol.
150:1507-1513 |
| 18. |
Kihara, A.,
T. Noda,
N. Ishihara, and Y. Ohsumi.
2001.
Two distinct Vps34 phosphatidylinositol 3-kinase complexes function in autophagy and carboxypeptidase Y sorting in Saccharomyces cerevisiae.
J. Cell Biol.
152:519-530 |
| 19. | Kim, J., S. V. Scott, and D. J. Klionsky. 2000. Alternative protein sorting pathways. Int. Rev. Cytol. 198:153-201[Medline]. |
| 20. |
Klionsky, D. J.,
R. Cueva, and D. S. Yaver.
1992.
Aminopeptidase I of Saccharomyces cerevisiae is localized to the vacuole independent of the secretory pathway.
J. Cell Biol.
119:287-299 |
| 21. | Klionsky, D. J., and Y. Ohsumi. 1999. Vacuolar import of proteins and organelles from the cytoplasm. Annu. Rev. Cell Dev. Biol. 15:1-32[CrossRef][Medline]. |
| 22. | Lang, T., E. Schaeffeler, D. Bernreuther, M. Bredschneider, D. H. Wolf, and M. Thumm. 1998. Aut2p and Aut7p, two novel microtubule-associated proteins are essential for delivery of autophagic vesicles to the vacuole. EMBO J. 17:3597-3607[CrossRef][Medline]. |
| 23. |
Nakamura, N.,
A. Matsuura,
Y. Wada, and Y. Ohsumi.
1997.
Acidification of vacuoles is required for autophagic degradation in the yeast Saccharomyces cerevisiae.
J. Biochem.
121:338-344 |
| 24. | Odorizzi, G., M. Babst, and S. D. Emr. 1998. Fab1p PtdIns(3)P 5-kinase function essential for protein sorting in the multivesicular body. Cell 95:847-858[CrossRef][Medline]. |
| 25. | Odorizzi, G., M. Babst, and S. D. Emr. 2000. Phosphoinositide signaling and the regulation of membrane trafficking in yeast. Trends Biochem. Sci. 25:229-235[CrossRef][Medline]. |
| 26. |
Preston, R. A.,
R. F. Murphy, and E. W. Jones.
1989.
Assay of vacuolar pH in yeast and identification of acidification-defective mutants.
Proc. Natl. Acad. Sci. USA
86:7027-7031 |
| 27. | Roberts, C. J., C. K. Raymond, C. T. Yamahiro, and T. H. Stevens. 1991. Methods for studying the yeast vacuole. Methods Enzymol. 194:644-661[Medline]. |
| 28. | Rose, M. D., P. Novick, J. H. Thomas, D. Botstein, and G. R. Fink. 1987. A Saccharomyces cerevisiae genomic plasmid bank based on a centromere-containing shuttle vector. Gene 60:237-243[CrossRef][Medline]. |
| 29. |
Schlumpberger, M.,
E. Schaeffeler,
M. Straub,
M. Bredschneider,
D. H. Wolf, and M. Thumm.
1997.
AUT1, a gene essential for autophagocytosis in the yeast Saccharomyces cerevisiae.
J. Bacteriol.
179:1068-1076 |
| 30. |
Spormann, D. O.,
J. Heim, and D. H. Wolf.
1992.
Biogenesis of the yeast vacuole (lysosome). The precursor forms of the soluble hydrolase carboxypeptidase yscS are associated with the vacuolar membrane.
J. Biol. Chem.
267:8021-8029 |
| 31. |
Straub, M.,
M. Bredschneider, and M. Thumm.
1997.
AUT3, a serine/threonine kinase gene, is essential for autophagocytosis in Saccharomyces cerevisiae.
J. Bacteriol.
179:3875-3883 |
| 32. | Suriapranata, I., U. D. Epple, D. Bernreuther, M. Bredschneider, K. Sovarasteanu, and M. Thumm. 2000. The breakdown of autophagic vesicles inside the vacuole depends on Aut4p. J. Cell Sci. 113:4025-4033[Abstract]. |
| 33. |
Takeshige, K.,
M. Baba,
S. Tsuboi,
T. Noda, and Y. Ohsumi.
1992.
Autophagy in yeast demonstrated with proteinase-deficient mutants and conditions for its induction.
J. Cell Biol.
119:301-311 |
| 34. |
Teichert, U.,
B. Mechler,
H. Muller, and D. H. Wolf.
1989.
Lysosomal (vacuolar) proteinases of yeast are essential catalysts for protein degradation, differentiation, and cell survival.
J. Biol. Chem.
264:16037-16045 |
| 35. | Teter, S. A., K. Eggerton, S. Scott, J. Kim, A. Fischer, and D. Klionsky. 2001. Degradation of lipid vesicles in the yeast vacuole requires function of Cvt17, a putative lipase. J. Biol. Chem. 2083-2087. |
| 36. | Thumm, M. 2000. Structure and function of the yeast vacuole and its role in autophagy. Microsc. Res. Tech. 51:563-572[CrossRef][Medline]. |
| 37. | Thumm, M., R. Egner, B. Koch, M. Schlumpberger, M. Straub, M. Veenhuis, and D. H. Wolf. 1994. Isolation of autophagocytosis mutants of Saccharomyces cerevisiae. FEBS Lett. 349:275-280[CrossRef][Medline]. |
| 38. | Thumm, M., and D. H. Wolf. 1998. From proteasome to lysosome: studies on yeast demonstrate the principles of protein degradation in the eukaryote cell. Adv. Mol. Cell Biol. 27:41-67. |
| 39. | Wach, A., A. Brachat, R. Pohlmann, and P. Philippsen. 1994. New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10:1793-1808[CrossRef][Medline]. |
| 40. | Wurmser, A. E., and S. D. Emr. 1998. Phosphoinositide signaling and turnover: PtdIns(3)P, a regulator of membrane traffic, is transported to the vacuole and degraded by a process that requires lumenal vacuolar hydrolase activities. EMBO J. 17:4930-4942[CrossRef][Medline]. |
| 41. | Yamamoto, A., W. D. De, I. V. Boronenkov, R. A. Anderson, S. D. Emr, and D. Koshland. 1995. Novel PI(4)P 5-kinase homologue, Fab1p, essential for normal vacuole function and morphology in yeast. Mol. Biol. Cell 6:525-539[Abstract]. |
| 42. |
Yamashiro, C. T.,
P. M. Kane,
D. F. Wolczyk,
R. A. Preston, and T. H. Stevens.
1990.
Role of vacuolar acidification in protein sorting and zymogen activation: a genetic analysis of the yeast vacuolar proton-translocating ATPase.
Mol. Cell. Biol.
10:3737-3749 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»