Previous Article | Next Article 
Journal of Bacteriology, October 2001, p. 6107-6118, Vol. 183, No. 20
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.20.6107-6118.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Cytochrome Complex Essential for Photosynthetic Oxidation of both
Thiosulfate and Sulfide in Rhodovulum
sulfidophilum
Corinne
Appia-Ayme,1
Phillip J.
Little,1
Yumi
Matsumoto,2
Andrew P.
Leech,1 and
Ben C.
Berks1,
,*
Center for Metalloprotein Spectroscopy and
Biology, School of Biological Sciences, University of East Anglia,
Norwich NR4 7TJ, United Kingdom,1 and
Department of Biology, Tokyo Metropolitan University,
Minamiohsawa, Hachioji, Tokyo 192-0397, Japan2
Received 2 April 2001/Accepted 17 July 2001
 |
ABSTRACT |
Many photosynthetic bacteria use inorganic sulfur compounds as
electron donors for carbon dioxide fixation. A thiosulfate-induced cytochrome c has been purified from the photosynthetic
-proteobacterium Rhodovulum sulfidophilum.
This cytochrome c551 is a heterodimer of a
diheme 30-kDa SoxA subunit and a monoheme 15-kDa SoxX subunit. The cytochrome c551 structural genes are
part of an 11-gene sox locus. Sequence analysis suggests
that the ligands to the heme iron in SoxX are a methionine and a
histidine, while both SoxA hemes are predicted to have unusual
cysteine-plus-histidine coordination. A soxA mutant
strain is unable to grow photoautotrophically on or oxidize either
thiosulfate or sulfide. Cytochrome c551 is
thus essential for the metabolism of both these sulfur species.
Periplasmic extracts of wild-type R. sulfidophilum
exhibit thiosulfate:cytochrome c oxidoreductase
activity. However, such activity can only be measured for a
soxA mutant strain if the periplasmic extract is supplemented with purified cytochrome c551. Gene clusters
similar to the R. sulfidophilum sox locus can
be found in the genome of a green sulfur bacterium and in
phylogenetically diverse nonphotosynthetic autotrophs.
 |
INTRODUCTION |
The environmentally
most abundant reduced inorganic sulfur species are sulfide and
thiosulfate. These species are converted to sulfate in the
oxidative half of the sulfur cycle, primarily by bacterial action.
Photosynthetic sulfur-oxidizing bacteria use sulfur compounds as the
electron donor for reductive carbon dioxide fixation during
photolithotrophic growth (4, 5). In these organisms
electrons obtained from the sulfur compounds are initially fed into the
photosynthetic electron transfer chain. Light energy is then used
to drive movement of the electrons onto the more reducing electron
carriers NAD(P)+ and ferredoxin.
Photosynthetic sulfur oxidation is an ancient metabolism, and most
anoxygenic photosynthetic bacteria have at least a limited ability to
use such compounds (4). In nonphotosynthetic (colorless)
sulfur bacteria, sulfur compounds are oxidized to support
chemolithotrophic growth (12, 21). In these bacteria the
sulfur compounds function primarily as respiratory electron donors,
providing energy for cellular metabolism via oxidative phosphorylation. The electron acceptor is either oxygen or
inorganic nitrogen compounds. A minority of the electrons derived from
the sulfur species are used for carbon dioxide fixation.
In our laboratory we seek to understand photolithotrophic sulfur
metabolism using the genetically accessible
-proteobacterium Rhodovulum sulfidophilum (formerly [f.]
Rhodobacter sulfidophilus, formerly
Rhodopseudomonas sulfidophila) (17, 18) as our
model organism. R. sulfidophilum is able to carry out the
complete eight-electron oxidation of sulfide or thiosulfate to sulfate.
The thiosulfate oxidation pathway in R. sulfidophilum is
thiosulfate inducible, and sulfite is a free intermediate in the
process (36).
Photosynthetic
-proteobacteria operate a cyclical
light-driven electron transport chain. Excitation of the
photosynthetic reaction center by light of the appropriate wavelength
results in transfer of electrons from the reaction center to
ubiquinone. The resultant ubiquinol is then oxidized by the cytochrome
bc1 complex with a periplasmic
c-type cytochrome, normally cytochrome c2, acting as the electron acceptor.
The cycle is completed by transfer of electrons from the
ferrocytochrome c to the oxidized reaction center. During
photolithotrophic growth the reductant for carbon dioxide fixation is
provided in the form of NADH. This is produced by reverse electron
transfer from ubiquinol through the NADH:ubiquinone oxidoreductase
(complex I). The electrons removed from the photosynthetic electron
transfer chain in this way are replaced by oxidation of an inorganic
electron donor. It is therefore anticipated that the electron transfer
pathways associated with thiosulfate and sulfide oxidation in R. sulfidophilum will utilize cytochrome
c2 and/or ubiquinone as the terminal oxidant.
In an earlier study it was observed that R. sulfidophilum
grown autotrophically with thiosulfate as electron donor expresses a
c-type cytochrome that is not found in heterotrophically
grown cells (36). The cytochrome is therefore a good
candidate to be a component of the thiosulfate oxidation pathway.
Taking this observation as our starting point, we have purified the
thiosulfate-induced cytochrome and shown it to be a heterodimeric
protein containing three covalently bound heme groups. The structural
genes encoding the cytochrome are part of a large genetic locus
involved in inorganic sulfur metabolism. Biochemical and genetic
evidence is presented that confirms a function for the cytochrome in
thiosulfate oxidation. Unexpectedly, the cytochrome is also essential
for sulfide oxidation.
 |
MATERIALS AND METHODS |
Bacterial strains and growth conditions.
R.
sulfidophilum DSM1374T (strain W4 in
reference 17) or a spontaneous rifampin-resistant
derivative, strain 3.1, was used throughout this study. R. sulfidophilum was normally cultured at 30°C in sealed glass
vessels placed in front of tungsten lamps. R. sulfidophilum
was routinely grown on a basal salts medium, RCV-N, adapted from the
RCV medium of Weaver et al. (16, 52). The constituents of
this medium are 5 mM
KH2PO4, 5 mM
K2HPO4, 7.5 mM
(NH4)2SO4,
425 mM NaCl, 0.5 mM MgSO4, 0.5 mM
CaCl2, 85 µM
FeSO4, 50 µM disodium EDTA, 11 µM
H2BO3, 1.8 µM
MnSO4, 0.9 µM
NaMoO4, 0.2 µM
ZnSO4, and 40 nM
Cu(NO3)2, and the pH
is adjusted to 6.5. After autoclaving, 1 mg of thiamine-HCl, 1 mg of
nicotinic acid, 0.1 mg of biotin. and 0.2 mg of
para-aminobenzoic acid per liter are added from a
1,000-fold-concentrated filter-sterilized stock. For photoheterotrophic
growth, RCV-N was supplemented with 30 mM
D,L-disodium malate to give medium RCV-NM. For
photolithotrophic growth, RCV-N was modified by replacing the
KH2PO4 and
K2HPO4 components with 20 mM Tricine and 1 mM K2HPO4
and adjusting the pH of the medium to 7.8 with NaOH. After autoclaving,
40 mM NaHCO3 was added from a filter-sterilized
0.6 M stock or, for large-scale cultures, directly as a powder. This
basal medium constitutes RCV-A. Control experiments demonstrate that
R. sulfidophilum does not use the Tricine in RCV-A as a
carbon source. For photolithotrophic growth with thiosulfate as
electron donor, RCV-A was additionally supplemented after autoclaving
with 100 mM
Na2S2O3
from a separately autoclaved 1 M stock solution to give medium RCV-AT.
The pH of the culture medium was monitored every 12 h during
photolithotrophic growth, and an additional 40 mM
NaHCO3 was added if the pH fell to 7.5. For
photomixotrophic growth with thiosulfate as electron donor and malate
as carbon source, RCV-AT medium was supplemented with 20 mM
D,L-disodium malate to give medium
RCV-ATM. For photolithotrophic growth of R. sulfidophilum
strains with sulfide as electron donor, RCV-A was supplemented with 3.5 mM Na2S to produce medium RCV-AS. For
photomixotrophic growth on sulfide plus malate, RCV-AS was supplemented
with 20 mM D,L-disodium malate to produce
medium RCV-ASM. For photolithotrophic growth with formate as electron donor, RCV-A medium was supplemented with 50 mM sodium formate.
For single-colony isolation, R. sulfidophilum was routinely
cultured phototrophically at 30°C on LB-agar medium (32)
in a Don Whitley Mark 3 anaerobic cabinet (atmosphere of 10%
H2, 10%CO2, and
80%N2) custom modified with tungsten bulb strip
lighting in the roof. For photolithotrophic growth on solid media with sulfide as electron donor, RCV-A agar plates were incubated in an
illuminated anaerobic jar (Oxoid) containing an Anaerogen (Oxoid) hydrogen-free anoxia-generating sachet. A sulfidic atmosphere was
generated over the plates by taping an open Eppendorf tube containing a
mixture of 0.1 g of thioacetamide in 1 ml of 0.2 M HCl
(19, 46) to the inside surface of the jar.
Escherichia coli strains DH5

[
supE44
lacU169(
80lacZ
M15)
hsdR17 recA1
endA1 gyrA96 thi-1 relA1 

], used in
routine cloning experiments, and S17-1 [
endA1 recA1 gyrA96
hsdR17supE44 

(
lac-proAB)/F'(
traD36 proAB+
lacZ
M15)] (
47) were grown on LB medium.
Antibiotics, when
required, were added to
E. coli or
R. sulfidophilum cultures at
the following final
concentrations: ampicillin, 50 µg/ml; kanamycin,
25 µg/ml;
spectinomycin, 25 µg/ml; streptomycin, 50 µg/ml; rifampin,
50 µg/ml; and gentamicin, 5 µg/ml.
Preparation of periplasmic extract from R.
sulfidophilum
Cells were harvested by centrifugation at
12,000 × g for 20 min at 4°C and then
resuspended in 20 ml of spheroplasting buffer (50 mM Tris-HCl, pH 8.0, 0.5 M sucrose, 1.5 mM disodium EDTA) per g (wet weight) of cells. The
resuspended cells were incubated with 600 µg of lysozyme (Sigma
L2879) ml
1 for 30 min at 30°C. Spheroplasts were
removed by centrifugation at 12,000 × g for 20 min
at 4°C. The supernatant was further centrifuged at 200,000 × g and 4°C for 1 h to remove fine membrane fragments.
Periplasmic extracts for use in the thiosulfate:cytochrome
c
oxidoreductase activity assays were prepared by the same protocol
except that prior to fractionation the cells were washed three
times
with growth medium lacking electron donor, the cells were
then
resuspended in 4 ml of spheroplasting buffer per g (wet weight)
of
cells, and lysozyme was added to a final concentration of 3
mg
ml
1.
Purification of R. sulfidophilum cytochrome
c551
A 50-liter total culture volume
of R. sulfidophilum grown photolithotrophically with
thiosulfate as electron donor was harvested at early stationary phase
(A650 = 1 to 1.3) by crossflow
ultrafiltration, and a periplasmic extract prepared as
described above. The first two chromatography steps in the purification
procedure were carried out at 4°C, with the remaining column
separations performed at room temperature. The periplasmic
extract was loaded onto a Q Sepharose Fast Flow (Amersham Pharmacia
Biotech) anion-exchange column (2.6-cm diameter by 55-cm height) that
had previously been equilibrated with 50 mM Tris-HCl, pH 7.8. The
column was then washed with 300 ml of the equilibration buffer and
developed with a linear gradient of 0 to 1 M NaCl in 1.5 liters of
equilibration buffer. Fractions in the hemoprotein peak (as judged by
absorbance at 410 nm) eluting at approximately 0.45 M NaCl were pooled.
Solid (NH4)2SO4 was added to a
concentration of 25% saturation, and the sample was applied to a
Phenyl Sepharose 6 Fast Flow high sub (Amersham Pharmacia
Biotech) hydrophobic interaction column (1.6-cm diameter by
20-cm height) that had been preequilibrated with 50 mM Tris-HCl, pH
7.8, and 25% saturation (NH4)2SO4.
The column was developed with a linear gradient of 25 to 0% saturation (NH4)2SO4 in 50 mM Tris-HCl, pH
7.8, and the hemoprotein fractions [eluting around 13% saturation
(NH4)2SO4] were pooled.
Ultrafiltration with an Amicon Diaflo YM3 membrane was used to exchange
the buffer of the pooled fractions for 20 mM HEPES-NaOH (pH 7.8)-150
mM NaCl and then to concentrate the fractions to 1 ml. The concentrated sample was subject to fast protein liquid chromatography size exclusion
chromatography on a Superdex 75 HiLoad (Amersham Pharmacia Biotech)
column (1.6-cm diameter by 60-cm height) equilibrated with 20 mM
HEPES-NaOH (pH 7.8)-150 mM NaCl. The highest purity cytochrome
c551-containing fractions were identified by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis, pooled, and subjected to separation by anion-exchange perfusion chromatography on a 1.6-ml SP12 VAB POROS 20HQ column run on
a BioCAD Sprint system. The column running buffer was 20 mM sodium
acetate, pH 5.0, and the column was developed with a 110-ml linear
gradient of 0 to 0.75 M NaCl. Immediately following chromatography, 0.2 volume of 100 mM HEPES-NaOH, pH 7.8, was added to each collected
fraction. Fractions containing pure cytochrome c551 were identified by SDS-PAGE analysis.
Routinely these fractions were exchanged into 10 mM HEPES-NaOH, pH 7.0, and concentrated by ultrafiltration, and 50-µl aliquots were flash
frozen in liquid N2 for long-term storage.
Analytical methods.
SDS-PAGE analysis employed the
buffer system of Laemmli (26). Following
electrophoresis, c-type cytochromes were detected by a
heme-linked peroxidase stain (50). For peptide sequencing, purified SoxAX complex was subjected to SDS-PAGE with 2 mM
thioglycolate added to the cathode buffer. The gel was blotted on a
polyvinylidene difluoride (Bio-Rad Sequi-Blot PVDF) membrane and
stained with Ponceau S, and the SoxA and SoxX bands were excised.
N-terminal peptide sequences were determined directly from the
membrane-immobilized subunits. Tryptic peptides of the SoxA subunit
were obtained by digesting the membrane-bound protein and separating
the resultant fragments by microbore reverse-phase high-pressure liquid chromatography.
Electrospray mass spectra were acquired on a Micromass Platform
instrument, using 1:1:0.001
CH
3CN/H
2O/HCOOH as sample
solvent
and horse heart myoglobin as calibration standard.
Approximately
40 pmol of sample was used per run. Data were analyzed
with the
supplier's Masslynx
software.
Analytical ultracentrifugation experiments were carried out in a
Beckman Optima XL/I centrifuge with absorbance optics using
an An50Ti
rotor. Aliquots (110 µl) of SoxAX dialyzed against 10
mM HEPES (pH
7.0)-100 mM NaCl buffer were placed in the sample
sectors of
charcoal-filled Epon two-channel centerpieces. The
reference sectors
were loaded with 120 µl of dialysis buffer.
Centrifugation was
performed at 15,000 rpm and 20°C. Equilibrium
data were collected at
410 nm, with five readings averaged for
each scan and data from five
scans combined. Equilibrium was confirmed
by the absence of any
difference between data collected 4 h or
more apart. Partial
specific volumes were calculated from the
SoxA and SoxX amino acid
sequences using the program SEDNTERP,
neglecting the hemes. Data were
analyzed using software supplied
by Beckman with the
centrifuge.
Thiosulfate concentrations in growth media were measured by an
iodometric method (
20) after removal of cells by
centrifugation.
Sulfide concentrations were measured by the method of
Hallenbeck
et al. (
15).
Cloning and sequence analysis of R. sulfidophilum
sox locus.
Standard molecular genetic techniques were
carried out as described (32, 45). R. sulfidophilum genomic DNA was prepared using the Wizard Genomic
DNA purification kit from Promega. Degenerate oligonucleotides
5'-GA(C/T)CC(C/G)CT(C/G)GT(C/G)ATCAA(C/T)GG-3' and
5'-C(G/T)(C/G)AC(C/G)(C/G)(A/T)(C/G)GG(C/G)CC(C/T)TC(C/G)AC-3' were designed on the basis of, respectively, the SoxA internal peptide sequence RGNGLSVEGPSVR and the SoxA amino-terminal sequence GPDDPLVINGEIEIVTRAPT and used to amplify an 800-bp internal
soxA fragment using R. sulfidophilum
DSM1374T chromosomal DNA as the template. The
amplified soxA fragment was cloned into plasmid Bluescript
SK(+) (Stratagene) and then used as a hybridization probe to screen an
R. sulfidophilum DSM1374T genomic
library (31) constructed in the vector SuperCos
(Stratagene). Cosmid 207 containing the entire sox locus was
identified by this procedure and used by MWG Biotech and Genome Express
to determine the DNA sequence of the sox region. The DNA
sequence was analyzed by the GCG v10.1 (11) and Lasergene
(DNAstar Inc.) software packages together with Web facilities.
Predicted proteins were compared with the protein databases using the
BlastP program (1) with the BLOSUM62 scoring matrix. The
possible presence of signal peptides on the sox gene
products was assessed using the program SignalP (37),
while proteins were tested for the presence of potential transmembrane
helices using the program TMHMM (48).
Construction of soxA mutant strains.
Suicide
plasmids for the construction of the soxA mutant strains
were prepared as follows. A 1,082-bp fragment starting 508 bp upstream
of soxA was amplified from the R. sulfidophilum
chromosome by PCR with primers
5'-AAAATCTAGACCAATACCGTGAAAGTCACCATCGGCGGCT-3' and
5'-AAAAGGATCCAGATCTCGCGGCCCTTCTCCCAGGTCGACT-3'. The product was digested with XbaI and BamHI and cloned into
the same sites in the polylinker of suicide vector pARO181
(38), producing plasmid psoxA-N. A second
fragment of the R. sulfidophilum chromosome covering the
1,716-bp region ending 1,502 bp after the soxA stop codon
was amplified using primers
5'-AAAAGGATCCGACCATCTGAGCCAGGGCCAGATCAACGGC-3' and
5'-AAAAGGTAC CGAGGATGGTGTGCAGCATCTCGCCCG TCAT-3', digested with BamHI and KpnI, and cloned into
BamHI- and KpnI-cut psoxA-N to produce
plasmid psoxA. The 2-kb BamHI fragment of pUX-
(40) bearing the
(Specr,
Strepr) cartridge was then cloned into the
BamHI site of plasmid psoxA to produce the
plasmid psoxA::
. Plasmid
psoxA::Gmr was constructed by
cloning the BamHI fragment of pWKR189I (34) into the BamHI site of psoxA and then selecting a
construct in which the gentamicin resistance gene was transcribed in
the same direction as soxA. The final constructs were
verified by DNA sequencing.
Interposon-containing plasmids were mobilized from
E. coli
S17.1 into
R. sulfidophilum 3.1 (Rif
r) by mixing exponential-phase donor and
recipient cells in a 1
to 4 ratio and spotting the mixture onto
nitrocellulose filters
placed on LB agar plates. Following overnight
aerobic incubation
at 30°C, recombinant donor cells were selected by
plating dilutions
of the mating mixture on LB agar containing the
appropriate interposon-selective
antibiotic together with rifampin and
incubating the plates in
the illuminated anaerobic cabinet for 4 days.
Recombinant cells
were then screened for the loss of vector-encoded
kanamycin resistance
by replica plating. Southern hybridization was
used to confirm
the presence in the mutant strains of an interposon in
the
soxA gene and loss of the
vector.
RNA purification and analysis.
Cultures (50 ml) of R. sulfidophilum strains were harvested in exponential growth phase,
resuspended in 200 µl of 10 mM Tris-HCl (pH 8.0)-1 mM disodium EDTA
and 0.4 mg of lysozyme per ml. RNA was then prepared from the cells
using the Sigma total mammalian RNA miniprep kit. The RNA was further
purified by RQ1 DNase I (Promega) treatment followed by extraction with
phenol and then with phenol-chloroform (5:1). Each reverse
transcriptase PCR (RT-PCR) reaction contained 2 µg of the purified
RNA. The reactions were carried out using the Promega Access RT-PCR
kit. The soxC-specific primers were
5'-AAGGAAGATTACCGGCTGATG-3' and
5'-CGTATCGGTGTATTTCGAGGTC-3'. The soxF-specific
primers were 5'-GGCAAGACCTATTACACCTGCT-3' and 5'-TGTTTCGAGAAGTTTTCCTTGG-3'. Each set of primers amplifies
an approximately 500-bp fragment.
Measurement of thiosulfate:cytochrome c
oxidoreductase activity in periplasmic extracts.
Reactions
were carried out at 30°C in 0.5-ml capacity glass cuvettes stoppered
with a butyl rubber septum and rendered anoxic by bubbling with
oxygen-free nitrogen for 5 min. The reaction mixture comprised 0.4 ml
of freshly prepared periplasmic extract together with 65 µl
of spheroplasting buffer and 10 µl of a 100 mM
Na2S2O3
solution to give a final concentration of electron donor in the assay
of 2 mM. The reaction was initiated by the addition of 25 µl of
equine heart ferricytochrome c (Sigma) from a 1 mM stock.
Cytochrome c reduction was monitored at 550 nm, and initial rates were calculated using
E550
nm(ferrocytochrome c
ferricytochrome c) = 20 mM
1
cm
1. All other donor-cytochrome c
oxidoreductase activity assays were carried out in a Belle Technology
anaerobic glove box (<10 ppm O2) fitted with a
World Precision Instruments modular diode array spectrophotometer.
 |
RESULTS |
Purification and characterization of a thiosulfate-induced
cytochrome c
Neutzling and coworkers have
previously observed that R. sulfidophilum grown
photolithotrophically with thiosulfate as electron donor contains a
c-type cytochrome that is not present in
photoheterotrophically grown cells (36). This
cytochrome has an
-band visible absorption maximum at 551 nm in the reduced state and is therefore designated cytochrome
c551. We determined that cells grown
photomixotrophically on thiosulfate plus malate also produced
cytochrome c551, confirming a correlation
between the occurrence of cytochrome
c551 and the presence of thiosulfate in
the growth medium. The thiosulfate induction of cytochrome
c551 expression suggests that this
hemoprotein is likely to have a function in thiosulfate oxidation.
Cytochrome
c551 was purified to
homogeneity from a periplasmic extract of
R. sulfidophilum cells cultured photolithotrophically
with
thiosulfate as electron donor. The purified preparation contains
two
polypeptides with apparent molecular masses of 18 kDa and
30 kDa under
SDS-PAGE (Fig.
1) and 15,357.3 ± 0.8 Da and 30,177
± 4 Da by electrospray mass spectrometery. We
designated the larger
polypeptide SoxA and the smaller protein SoxX.
The alkaline pyridine
ferrohemochrome spectrum of cytochrome
c551 has a single

-band
absorption
maximum at 550 nm. This is characteristic of
c-type
cytochromes in which the heme group is covalently linked to the
protein
by two thioether linkages. SoxA and SoxX both stained
for heme-linked
peroxidase activity following denaturing electrophoresis
(Fig.
1),
indicating that both subunits of cytochrome
c551 possess
covalently bound heme.
Solvent extraction experiments gave no
evidence for additional
non-covalently bound hemes or other chromophores.

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 1.
Purified cytochrome c551 is
composed of two heme-binding subunits. Purified cytochrome
c551 was subjected to nonreducing SDS-PAGE
in a 15% polyacrylamide gel. Lane A was stained with Coomassie
brilliant blue R250 to detect proteins. Lane B was treated with a
heme-linked peroxidase stain to identify polypeptides possessing
covalently bound heme groups. The electrophoretic mobility of marker
proteins is indicated to the side of the gel.
|
|
The copurification of SoxA and SoxX is presumptive evidence that the
two proteins form a complex. To rigorously assess the
oligomeric state
of cytochrome
c551, the hydrodynamic
properties
of the purified material were analyzed by analytical
ultracentrifugation.
Sedimentation velocity experiments carried out in
a 10 mM sodium
HEPES-100 mM NaCl, pH 7.0, buffer at 20°C gave no
indication that
multiple components were present (data not shown).
Thus, SoxA
and SoxX form a single tight complex under these conditions.
Sedimentation
equilibrium studies in the same buffer system at three
different
protein concentrations (0.14, 0.07, and 0.035 mg
ml
1) gave three essentially identical
sedimentation curves and allowed
the calculation of a mass of 48,742 Da
for native cytochrome
c551 (Fig.
2). This value corresponds closely to the
mass of a 1 to
1 complex of the SoxA and SoxX polypeptides (45,534 Da),
and so
we conclude that cytochrome
c551 is a heterodimeric
SoxA
1-SoxX
1 complex.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 2.
Determination of the native molecular mass of cytochrome
c551 by sedimentation equilibrium
studies. The sample contained 0.14 mg of cytochrome
c551 per ml in 10 mM sodium HEPES-100 mM
NaCl, pH 7.0. The sample was sedimented at 18,000 × g for 72 h at 20°C. Sedimentation of the
cytochrome was monitored by visible spectroscopy using the heme
absorption maximum at 410 nm. The lower panel shows the sedimentation
curve for cytochrome c551 together with the
simulated single-component sedimentation curve for a species with a
weight average molecular mass of 48,742 Da. Residuals between
experimental data and the fitted curve are shown in the top panel.
|
|
Purified cytochrome
c551 was not
reduced by thiosulfate (2 mM), did not exhibit
thiosulfate:cytochrome
c oxidoreductase activity
with either
R. sulfidophilum ferricytochrome
c2 or equine heart
ferricytochrome
c as electron acceptor, and did
not possess thiosulfate:ferricyanate
oxidoreductase activity. The
ability of cytochrome
c551 to oxidize
other sulfur compounds with equine heart ferricytochrome
c
as
electron acceptor was also tested. However, no oxidation of sulfite
(1 mM) or enhancement of the rate of chemical reduction of cytochrome
c by 50 µM sulfide was
observed.
Cloning of R. sulfidophilum genomic locus
encoding cytochrome c551.
Amino-terminal and five internal peptide sequences were obtained from
the SoxA subunit of purified R. sulfidophilum
cytochrome c551. Degenerate primers
designed on the basis of the amino-terminal and one of the
internal peptide sequences were used to amplify an 800-bp fragment of
the SoxA-encoding gene. This fragment was then used to isolate a cosmid
containing the full soxA gene together with approximately 45 kbp of the surrounding chromosomal DNA. Sequence analysis of the cosmid
shows soxA to be one of a set of 11 closely spaced and
identically orientated open reading frames that potentially form a
transcriptional unit (Fig. 3 and
4). Two of the open reading frames at the
soxA locus (soxC and soxD) overlap, while the remaining genes are separated by noncoding regions of between
27 and 430 bp. Amino-terminal sequence analysis of the small subunit of
cytochrome c551 allows identification
of one of the soxA-linked open reading frames as the SoxX
structural gene (Fig. 5). The genes in
the soxA cluster show sequence similarity to a chromosomal
region involved in thiosulfate oxidation in the nonphotosynthetic
-proteobacterium Paracoccus pantotrophus (formerly Paracoccus denitrificans GB17, formerly Thiosphaera
pantotropha) (13, 53, 54) (Fig. 3). We have therefore
adopted the P. pantotrophus sox designations for the
corresponding open reading frames in R. sulfidophilum.
A soxA-like gene has also recently been identified in
another nonphotosynthetic
-proteobacterium, Thiobacillus
sp. strain KCT001, where it is the site of transposon insertion in a
thiosulfate oxidation-defective mutant (35) (Fig. 4).
Homologues of many of the genes in the R. sulfidophilum
soxA gene cluster can be found grouped in the genome sequences of
another thiosulfate-oxidizing photosynthetic
-proteobacterium,
Rhodopseudomonas palustris, the nonphotosynthetic
hyperthermophilic bacterium Aquifex aeolicus, and the green
sulfur bacterium Chlorobium tepidum, supporting the proposed
functional relationship of the R. sulfidophilum
open reading frames (Fig. 3). These genes have been assigned the same designations as their R. sulfidophilum homologues
in Fig. 3. Sequence comparisons show that the SoxA protein of
C. tepidum is equivalent to a cytochrome
c551 of Chlorobium limicola
strain Tassajara (23) (Fig. 4). Synthesis of this
cytochrome c551 in
Chlorobium species is correlated with the ability of the
strain to use thiosulfate as a photosynthetic electron donor
(23), and there is biochemical evidence for an ill-defined
role of this cytochrome in thiosulfate oxidation (25).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 3.
Schematic overview of the soxA locus of
R. sulfidophilum and related gene clusters in other
bacteria. The predicted identities of the gene products are indicated
under the gene designations where appropriate. Signal peptide coding
regions are indicated in black for Sec signal peptides and are hatched
for Tat signal peptides. Both C. tepidum and A.
aeolicus produce multiple proteins with homology to the
R. sulfidophilum SoxF flavoprotein. The sequence of
the R. sulfidophilum soxA locus was determined in
the present work and has been deposited in the GenBank database with
accession number AY005800. Preliminary sequence data for C.
tepidum were obtained from the Institute for Genomic Research
website (http://www.tigr.org) and for R. palustris
from
http://www.jgi.doe.gov/JGI_microbial/html/rhodo_homepage.html.
The P. pantotrophus sequence data are from references
13, 53, and 54, while the A.
aeolicus sequence is from reference 9.
|
|

View larger version (83K):
[in this window]
[in a new window]
|
FIG. 4.
Multiple sequence analysis of SoxA proteins. The amino
acid sequences of the amino terminus of the mature R.
sulfidophilum SoxA protein and of internal SoxA peptides
determined by protein sequencing in this work are shown on the line
marked "Peptides." Experimentally determined (R.
sulfidophilum and P. pantotrophus) or predicted
signal peptides are underlined. No signal peptide is shown for the
A. aeolicus protein due to uncertainty in the identity of
the precursor start codon. The consensus c-type
cytochrome Cys-Xaa-Xaa-Cys-His heme attachment sites and conserved
cysteines that are the proposed heme iron ligands in R.
sulfidophilum SoxA are boxed. The sources of the sequence data
are the same as in Fig. 3 with the addition of C.
limicola cytochrome c551 from
reference 23 and Thiobacillus sp. strain
KCT001 SoxA from reference 35. The numbering on the
individual sequences refers to the mature protein.
|
|

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 5.
Multiple sequence analysis of SoxX proteins. The amino
terminus of the mature R. sulfidophilum SoxX
protein determined by protein sequencing is given in the line labeled
"N-terminus." Experimentally determined (R.
sulfidophilum and P. pantotrophus) or predicted
SoxX signal peptides are underlined. The consensus
c-type cytochrome Cys-Xaa-Xaa-Cys-His heme attachment
site and the proposed methionine distal heme iron ligand are boxed. The
sources of the sequence data are as for Fig. 3. The numbering on the
individual sequences refers to the mature protein.
|
|
With the exception of SoxV, all 11
R. sulfidophilum Sox
gene products are predicted to be water-soluble proteins. Nine of
these
water-soluble proteins are predicted to be synthesized as
precursor
proteins, with N-terminal signal sequences directing
export of the
protein to the periplasm (Fig.
3). Five of these
proteins have standard
signal peptides that target the unfolded
precursor by the Sec pathway
(
41), while the other four proteins
have twin arginine
signal peptides that mediate export of the
prefolded, often
cofactor-containing, precursor via the Tat apparatus
(
2,
3) (Fig.
3).
Sequence analysis of SoxA and SoxX.
Each subunit of cytochrome
c551 contains covalently bound heme
(Fig. 1), and consistent with this observation, the SoxA sequence contains two, and the SoxX sequence contains one, Cys-Xaa-Xaa-Cys-His c-type cytochrome heme attachment motif (Fig. 4 and 5). The
assignment of two c-type heme groups (616.5 Da of additional
mass for each heme, assuming protonated propionate groups under the
assay conditions) to the large subunit is supported by the similarity
of the calculated mass of diheme-modified mature SoxA protein (30,142.3 Da) to the experimentally determined mass of the large subunit
(30,177 ± 4 Da). However, having taken the two heme groups into
account, the experimentally determined mass exceeds the calculated mass by approximately 35 Da, suggesting that SoxA is subject to a
posttranslational modification. This extra mass might arise from an
additional sulfur atom (32 Da) or two additional oxygen atoms (32 Da).
The calculated mass of the mature SoxX protein with one covalently
bound heme (15,360.2 Da) is in good agreement with the mass of the
cytochrome c551 small subunit
determined by mass spectrometry (15,357.3 ± 0.8 Da).
In hemoproteins the heme iron is coordinated by either one or two axial
protein ligands. In structurally characterized
c-type
cytochromes, the histidines of the two Cys-Xaa-Xaa-Cys-His heme
attachment sites are invariably found to coordinate the iron of
the
heme attached to the adjacent cysteine residue. Thus, the
three heme
groups of
R. sulfidophilum cytochrome
c551 should each
have at least one
histidine iron ligand. Detailed spectroscopic
analysis of
R. sulfidophilum cytochrome
c551
suggests the presence
of one methionine-plus-histidine-coordinated heme
and two further
heme groups with spectroscopic properties dominated by
thiolate,
and thus presumably cysteine, coordination (
7a).
Due to their
functional importance, amino acids that act as heme
ligands are
almost invariably conserved between related hemoproteins. A
multisequence
comparison of
R. sulfidophilum SoxA and
SoxX sequences with their
homologues is therefore useful in attempting
to assign specific
amino acid residues as sixth ligands to the three
spectroscopically
defined hemes. In making this sequence comparison, it
is necessary
to take into account the fact that the
Chlorobium and
R. palustris SoxA sequences
lack the more amino-terminal heme binding motif
found in the
R. sulfidophilum protein and may thus retain the
ligands for only one of the two hemes present in the
R. sulfidophilum protein (Fig.
4). Only SoxX subunits contain a
conserved methionine
residue (Met92 in the mature
R. sulfidophilum protein), suggesting
that SoxX contains the
His/Met-coordinated heme (Fig.
4 and
5).
This inference is supported by
the observation that, while the
SoxX proteins do not show significant
overall sequence similarity
to other proteins, they do contain the key
highly conserved amino
acids of class I
c-type cytochromes
(
33) and are likely to have
a similar overall structure.
In class I cytochromes the heme is
attached close to the N terminus of
the polypeptide and the heme
iron is bound by the histidine from the
heme attachment motif
and a more carboxy-terminal methionine residue
that corresponds
to the conserved Met92 of
R. sulfidophilum SoxX. In addition to
the cysteines of the heme
attachment motifs, SoxA, but not SoxX,
contains two conserved cysteine
residues, Cys114 and Cys222 (
R. sulfidophilum mature
SoxA protein numbering). On the basis of
this sequence conservation,
these cysteine residues are predicted
to be the thiolate ligands of the
remaining two heme groups. Remarkably,
the monoheme
Chlorobium and
R. palustris SoxA sequences
conserve
both Cys114 and Cys222 equivalents. The Cys114 equivalent in
Chlorobium limicola cytochrome
c551 has been shown to form a
disulfide bond
with a cysteine located at the same position as the
amino-terminal
heme attachment motif in
R. sulfidophilum SoxA (
23). Given that
to form a
disulfide bond, both cysteine residues in the
C. limicola protein must be in close proximity, we infer that Cys114
is likely
to provide a ligand to the heme attached to the
amino-terminal
heme binding motif in the homologous
R. sulfidophilum SoxA structure.
It is possible that the
disulfide bridge in
Chlorobium cytochrome
c551 and the amino-terminal heme in
R. sulfidophilum SoxA have
similar functions since both
moieties are redox active and would
cross-link the protein structure.
If Cys114 coordinates the amino-terminal
heme group, then Cys222 is
predicted to act as a ligand to the
more carboxy-terminal
heme.
Sequence analysis of other R. sulfidophilum
soxA locus gene products.
Friedrich and coworkers have
previously presented analyses of sequence features in the
sox gene products of P. pantotrophus (13, 53, 54). Here we present additional insights into Sox protein structure derived from multiple sequence alignments of the
R. sulfidophilus proteins with those of P. pantotrophus and the other bacteria analyzed in Fig. 3. In
addition we identify significant structural differences between the
R. sulfidophilus and P. pantotrophus SoxD proteins.
The SoxY and SoxZ proteins of
P. pantotrophus form a complex
corresponding to the thiosulfate-binding enzyme A of the
Paracoccus versutus (formerly
Thiobacillus
versutus, formerly
Thiobacillus A2)
thiosulfate-oxidizing system (
13,
27,
30).
Multiple
sequence analysis reveals a remarkable degree of sequence
conservation
in the decapeptide
Val-Lys-Val-Thr-Ile-Gly-Gly-Cys-Gly-Gly at
the carboxyl terminus
of SoxY. This peptide is invariant between
the SoxY proteins of
R. sulfidophilum,
P. pantotrophus,
R. palustris,
and
C. tepidum, and
there are only two changes (Val for Ile and
loss of the
carboxyl-terminal Gly) in the
A. aeolicus protein.
This is
by far the highest level of sequence conservation between
the
sox gene products of these phylogenetically widespread
organisms
and suggests a critical role for the decapeptide in
thiosulfate
oxidation.
P. pantotrophus SoxY is covalently
modified by a species
of approximately 117 Da in mass
(
13). Given the earlier demonstration
of thiosulfate
binding by
P. versutus enzyme A (
30), we
tentatively
infer this modifying group to be thiosulfate (112 Da). The
conserved
cysteine residue in the SoxY carboxyl-terminal decapeptide is
an obvious candidate to form covalent adducts with thiosulfate-derived
species since no other conserved cysteine residues are found in
either
SoxY or SoxZ. The carboxyl-terminal context and adjacent
glycine
residues potentially render this conserved cysteine highly
accessible
and mobile. An alternative substrate binding site is
suggested by the
observation that members of the ubiquitin superfamily
also contain a
carboxyl-terminal Gly-Gly sequence that they use
to form thioether
adducts (
44,
51). Genome comparisons suggest
an intimate
functional connection between cytochrome
c551 and
the SoxYZ complex since the
soxY and
soxZ genes are interpolated
between the
two cytochrome
c551 structural genes
not only in
R. sulfidophilum but also in
P. pantotrophus and
C. tepidum (Fig.
3). Plausibly
the substrate for cytochrome
c551 is a
thiosulfate-derived
species covalently bound to the SoxYZ
complex.
The SoxB protein is thought to have a hydrolytic function. The
N-terminal domain of the SoxB protein has sequence similarity
to
5'-nucleotidases and related enzymes (
24) and is the
probable
location of a dinuclear Mn
2+ site
(
6). Intriguingly, while the SoxB proteins have Tat signal
peptides, the periplasmically located members of the homologous
5'-nucleotidase family are synthesized as precursors with Sec
signal
peptides.
The products of the overlapping
soxC and
soxD
genes are homologous to the molybdopterin and diheme cytochrome
c subunits,
respectively, of the sulfite:cytochrome
c oxidoreductase (sulfite
dehydrogenase) of
P. pantotrophus (
42,
54). However, the 191-residue
mature
R. sulfidophilum SoxD protein lacks the final
169 amino
acids of the corresponding
P. pantotrophus
polypeptide. Since
this region contains the second consensus heme
attachment motif,
the
R. sulfidophilum SoxD is a
monoheme (class I)
c-type cytochrome.
It is possible that
this deletion relative to the
P. pantotrophus protein
renders the
R. sulfidophilum sulfite:cytochrome
c oxidoreductase
defective since
R. sulfidophilum, uniquely among lithotrophic
bacteria, liberates
substantial quantities of sulfite as a free
intermediate in the
oxidation of thiosulfate to sulfate (
36).
In addition, and
in agreement with an earlier report (
36), we
have been
unable to detect substantive enzymatic sulfite:cytochrome
c
oxidoreductase activity in periplasmic extracts of
R. sulfidophilum.
Intriguingly,
R. sulfidophilum,
R. palustris, and
P. pantotrophus SoxD proteins conserve a potentially redox-active
Cys-(Xaa)
3-Cys
motif.
SoxF is homologous to the catalytic flavin subunit of
Allochromatium vinosum flavocytochrome
c
(
7), an enzyme that is generally
held to have the
physiological function of oxidizing sulfide to
elemental sulfur or
polysulfides (
4,
43). SoxE contains two
c-type
heme attachment motifs. The amino-terminal half of the
protein
bearing the first of these motifs shows high sequence
similarity
to the
c2 family of class I
c-type cytochromes and
to the carboxy-terminal domain of the
P. pantotrophus SoxD protein.
SoxE may be the redox partner
of the SoxF flavoprotein, since
genes coding for SoxE-like proteins
also lie adjacent to
soxF genes in
P. pantotrophus,
R. palustris, and
C. tepidum (Fig.
3)
and since experiments reported below suggest that
soxE and
soxF form a separate transcription unit
in
R. sulfidophilum.
SoxV is homologous to proteins of the CcdA protein family. These
are integral membrane proteins containing six transmembrane
helices
(
10). Proteins of the CcdA and related DsbD families
function in disulfide bond isomerization and heme attachment to
c-type cytochromes. These proteins catalyze movement of
electrons
from cytoplasmic thioredoxins to periplasmic
thioredoxin-like
proteins using a pair of cysteine residues that
are also conserved
in the SoxV protein (
8,
10,
14,
49). The periplasmic
SoxW protein exhibits weak sequence
similarity to thioredoxins,
including the presence of an active-site
Cys-Xaa-Xaa-Cys motif,
and is therefore likely to be the
periplasmic redox partner of
SoxV. Involvement of the SoxVW
system in thiosulfate oxidation
in
R. sulfidophilum is
suggested by the observation that all currently
characterized
soxA loci contain a gene coding for a
periplasmically
located thioredoxin (Fig.
3).
Insertional mutagenesis of the R. sulfidophilum
soxA gene.
To test the involvement of R. sulfidophilum cytochrome c551
in photolithotrophic thiosulfate oxidation, the soxA
gene was disrupted by interposon mutagenesis and the phenotype of the
resultant mutant strains was assessed. Two types of mutants were
constructed. In both cases, interposon insertion was combined with
deletion of a major part of the soxA coding region. In
strain soxA::
, the interposon contains
transcriptional and translational terminators. Thus, in this strain not
only is soxA inactivated but also any downstream genes that
rely on transcriptional readthrough from soxA for
expression. In the second mutant,
soxA::Gmr, the promoter of the
antibiotic resistance gene carried on the interposon is expected to
drive transcription of the genes downstream from soxA. Thus,
although the level of transcriptional readthrough from soxA
is likely to differ from the parental strain,
soxA::Gmr was anticipated to be a
null mutant for soxA alone. The RT-PCR experiments shown in
Fig. 6 were undertaken to test
transcription of genes downstream of soxA in the mutant
strains. Transcription of soxC is blocked in mutant
soxA::
(Fig. 6A, lane 2). This shows that
soxC is transcribed exclusively from promoters upstream of (or in) soxA. In contrast, soxC-containing mRNA
is detected in mutant soxA::Gmr
(Fig. 6A, lane 3). This confirms that the gentamicin resistance gene of
the interposon drives transcription of the genes lying downstream of
soxA. Intriguingly, soxF transcripts could be
detected in both soxA mutant strains (Fig. 6B, lanes 2 and
3). Since the interposon insertion in strain soxA::
prevents soxC transcription, it follows that soxF
can be transcribed from a promoter lying between soxC and
soxF. This promoter is presumably located in the 430-bp
soxD-soxE intergenic region. Given the implied
function of soxEF in sulfide oxidation, this internal
sox promoter could explain the reported differential
expression of thiosulfate- and sulfide-oxidizing capabilities in
R. sulfidophilum (36).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 6.
Assessment of transcriptional readthrough in
soxA mutant strains using RT-PCR. RT-PCR
experiments using primers in soxC (A) or
soxF (B) employed total RNA isolated from strains
cultured photomixotrophically with malate as carbon source and
thiosulfate as electron donor. Lanes 1 to 3 in each panel are the
complete RT-PCRs, while lanes 4 to 6 are control experiments in which
reverse transcriptase was omitted. The sources of the RNA were
R. sulfidophilum strains 3.1 (lanes 1 and 4),
soxA:: (lanes 2 and 5), and
soxA::Gmr (lanes 3 and 6).
|
|
Periplasmic extracts were prepared from cultures of each of the two
soxA mutant strains grown photomixotrophically on
thiosulfate
plus malate and fractionated by anion-exchange
chromatography.
The cytochrome
c551-containing hemoprotein peak
exhibited by parental
strain 3.1 cultured under these conditions was
absent from the
elution profiles of the mutant periplasm separations.
This analysis
confirms that the
soxA strains have a defect
in the production
of native cytochrome
c551 complexes.
Neither
soxA mutant was capable of photolithotrophic
growth with thiosulfate as electron donor. However, both strains
grew
photolithotrophically when the electron donor was either formate
or hydrogen, indicating that the
soxA mutants were
specifically
defective in thiosulfate metabolism. Washed cells of
photomixotrophic
(thiosulfate-malate) cultures of parental strain 3.1 catalyzed
the light- and carbon dioxide-dependent oxidation of
thiosulfate
at a mean rate of 6 nmol of
S
2O
32
oxidized min
1 (g of cells [wet
weight])
1. In contrast, photomixotrophically
grown cultures of the two
soxA mutants did not consume
thiosulfate.
Periplasmic extracts prepared from the parental strain cultured in
thiosulfate-containing media reduce equine heart ferricytochrome
c with thiosulfate as electron donor (Table
1), while periplasmic
extracts
from heterotrophically grown cells exhibit substantially
lower specific
activity in the same assay (Table
1). Thiosulfate:cytochrome
c oxidoreductase activity can also be measured using
R. sulfidophilum ferricytochrome
c2 as electron acceptor, but for
experimental
convenience the commercially available equine heart
protein was
used. Thiosulfate:cytochrome
c oxidoreductase
activity was zero
in periplasmic extracts prepared from
photomixotrophically (thiosulfate
plus malate) grown cells of the two
soxA mutant strains (Table
1). However, supplementation of
the mutant periplasmic extracts
with purified cytochrome
c551 complex led to the reappearance
of substantial thiosulfate:cytochrome
c oxidoreductase
activity
(Table
1) even though the purified cytochrome itself does not
exhibit such activity. For mutant
soxA::Gm
r maximal activity
was obtained with 20 µg of cytochrome
c551 per
ml of periplasmic
extract.
Taken together, these various data indicate that SoxA is
required for thiosulfate oxidation in
R. sulfidophilum. In addition,
although we have been unable to
establish the precise reaction
catalyzed by cytochrome
c551, the biochemical reconstitution
data
demonstrate that our purified protein is enzymatically
active.
R. sulfidophilum is capable of photolithotrophic growth
with sulfide as electron donor (
17). However, neither
soxA mutant
grew photoautotrophically in medium containing
3.5 mM Na
2S. In
mixotrophic sulfide-plus-malate
culture the
soxA mutant strains
did not consume detectable
sulfide over 24 h, while over the same
time period parallel
cultures of parental strain 3.1 completely
oxidized 3.5 mM sulfide to
sulfate. Washed cells of photomixotrophic
(thiosulfate plus malate)
cultures of parental strain 3.1 catalyzed
the light- and carbon
dioxide-dependent oxidation of Na
2S at a
mean
rate of 0.8 nmol of H
2S oxidized
min
1 (g of cells [wet
weight])
1. The
soxA mutants did not
oxidize sulfide in this assay. It was
not possible to analyze
sulfide:cytochrome
c oxidoreductase activity
in cell
extracts because even in the parental strain we could
not detect
activity significantly above the background rate of
chemical reduction
of the
cytochrome.
Sulfide is a toxic compound, and it was conceivable that the apparent
defect in sulfide oxidation exhibited by the
soxA mutant
strains was due to a change in level of sulfide tolerance of the
cells
rather than a defect in sulfide metabolism. In an attempt
to
distinguish between these two possibilities, we tested autotrophic
growth of
R. sulfidophilum on agar plates in
a sulfidic atmosphere
using conditions that allow growth of the
closely related but
more sulfide-sensitive bacterium
Rhodobacter capsulatus (
46).
After
a 3-week incubation, single colonies of the parental strain
3.1 had
formed but only trace growth was evident for either
soxA mutant strain. However, if malate was included in the plates,
strong
growth of the
soxA mutants was observed, suggesting that
the
mutant strains were not sensitive to the prevailing sulfide
concentrations.
R. capsulatus grown in the sulfidic
atmosphere
in the presence of malate deposits elemental sulfur around
the
colonies as the product of sulfide oxidation (
46).
This behavior
was not observed for any of the three
R. sulfidophilum strains.
We conclude that SoxA is essential for
photolithotrophic sulfide
oxidation in
R. sulfidophilum
and that the pathways of thiosulfate
and sulfide oxidation in this
organism have common
components.
 |
DISCUSSION |
A thiosulfate-induced hemoprotein, SoxAX, has been purified from
the marine photosynthetic bacterium R. sulfidophilum.
Analysis of a soxA-specific null mutant demonstrates that
SoxAX is an obligate component of the photolithotrophic thiosulfate
oxidation pathway. More unexpectedly, SoxAX was also shown to be
essential for photosynthetic oxidation of sulfide. The biochemical,
biophysical, and sequence data presented here, together with
spectroscopic data (7a), allow assignment of cysteine
residues as heme iron ligands in the SoxA protein, making SoxA the
first c-type cytochrome for which cysteine heme ligation has
been described. The R. sulfidophilum soxA gene is part
of a large cluster of genes coding for proteins with homology to
components of sulfur oxidation pathways in other thiosulfate-oxidizing
organisms (Fig. 3). The bacteria possessing these gene clusters span a
wide range of phylogenetic and physiological groupings, indicating that
the mechanism of lithotrophic thiosulfate oxidation is conserved
between at least some photosynthetic and facultatively
chemolithotrophic bacteria. This conclusion is supported by a recent
analysis of the phylogenetic distribution of soxB genes
(39). The five bacterial species analyzed in Fig. 3
conserve a core set of Sox components, namely, SoxAX, SoxB, SoxYZ, a
flavocytochrome c (not always at the soxA locus),
and a periplasmic thioredoxin, suggesting that these are the
minimal components of the pathway. Additional enzymatic activities
coded at the soxA loci in some of the organisms, for
example, sulfite:cytochrome c oxidoreductase, may not be
required for sulfur metabolism in all these bacteria.
With sequence data suggesting an identical mechanism of thiosulfate
oxidation in the bacterial species detailed in Fig. 3, it is of some
interest to reexamine the available biochemical data on these processes
in each organism to see how each might provide insight into the
operation of their common sulfur oxidation pathway.
Characterization of thiosulfate oxidation in the two Paracoccus species, P. versutus and P. pantotrophus, has led to a model in which a periplasmic
thiosulfate-oxidizing multienzyme system (TOMES) fully oxidizes
thiosulfate to sulfate and feeds electrons into the respiratory chain
at the level of cytochrome c (reviewed in reference
21). The components of the TOMES system are a
thiosulfate-binding enzyme A (SoxYZ), enzyme B (SoxB), and cytochrome
c552.5 (29), which
spectroscopic data identify as analogous to the cytochrome
c551 (SoxAX) complex of R. sulfidophilum (7a, 21). A sulfite dehydrogenase
(SoxCD) has been reported either to be an additional essential
component of this process (54) or to facilitate the
reaction (13, 28). Since there are no readily detectable
free intermediates in the TOMES system, it has been proposed that the
sulfur species remain protein bound during the oxidation process. This
could explain our failure to detect sulfur-oxidizing activities with
R. sulfidophilum cytochrome c551 unless other periplasmic
proteins are also present (Table 1). However, the observation that
R. sulfidophilum produces sulfite as a free
intermediate in the oxidation of either thiosulfate or sulfide
(36) supports the idea that sulfite at least is produced during operation of the Sox pathway. Since only some of the
sox gene products are required for complete thiosulfate
oxidation in the TOMES system, this model would imply that the
additional conserved sox genes are involved
specifically either in sulfide oxidation (perhaps SoxEF) or in
the biosynthesis or maintenance of the TOMES system (perhaps SoxVW).
The cytochrome c551 component of the
Sox pathway is required for the oxidation of sulfide as well as
thiosulfate in R. sulfidophilum. A crucial question is
then whether sulfide is the product of thiosulfate metabolism or vice
versa, or whether the metabolic pathways for the two compounds are
initially distinct and later converge. The observation that the ability
to oxidize sulfide but not thiosulfate is constitutive in R. sulfidophilum (36) argues against thiosulfate being formed from sulfide oxidation. In addition, experiments in which
C. vibrioforme f. thiosulfatophilum was fed
thiosulfate differentially labeled at the sulfane and sulfone sulfur
positions have been interpreted in terms of an initial reductive
cleavage of thiosulfate to sulfide plus sulfite (22). At
possible variance with these conclusions, both C. vibrioforme f. thiosulfatophilum and C. limicola f. thiosulfatophilum have also been
observed to produce thiosulfate during oxidation of sulfide
(4). However, there may be more than one mechanism for
sulfide oxidation in the green sulfur bacteria, and caution is
therefore required in the interpretation of these experiments. Since
our soxA mutagenesis data suggest that there is only one
pathway of sulfide oxidation in R. sulfidophilum, this
bacterium may be a tractable system in which to study the
photosynthetic oxidation of sulfide by the Sox pathway.
It is noteworthy that the
soxA::Gmr mutant is unable to grow
on or oxidize sulfide even though the soxEF genes, encoding
a probable sulfide dehydrogenase, are still transcribed in the
mutant (Fig. 6). Similarly, while the purified SoxAX complex does not initiate thiosulfate oxidation, the
soxA::Gmr mutant is incapable of
utilizing thiosulfate. It is also pertinent to note that a P. pantotrophus
soxC mutant is unable to grow on
thiosulfate (54). These observations suggest strong
cooperativity between the individual steps of the Sox pathway. This
behavior would be expected of a system in which the pathway
intermediates remain protein bound.
 |
ACKNOWLEDGMENTS |
This work was supported by U.K. Biotechnology and Biological
Research Council (BBSRC) grant 83/P09311 to B.C.B. and by the BBSRC and
the Engineering and Physical Sciences Research Council through core
funding to the Center for Metalloprotein Spectroscopy and Biology.
P.J.L. was the recipient of a BBSRC studentship. B.C.B. is R. J. P. Williams Senior Research Fellow at Wadham College, Oxford.
We thank W. Klipp for supplying plasmid pWKR189I and A. Willis for
performing the peptide sequencing. We acknowledge S. G. Haigh and
P. Barrell for their input into the preliminary stages of this project
and J. Mayne, J. Thornton, and D. Clarke for assistance in protein
purification and cell culture.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: School of
Biological Sciences, University of East Anglia, Norwich NR4 7TJ, United
Kingdom. Phone: 44(0)1603 592186. Fax: 44(0)1603 592250. E-mail:
b.berks{at}uea.ac.uk.
Present address: Department of Biochemistry, University of Oxford,
Oxford OX1 3QU, United Kingdom.
 |
REFERENCES |
| 1.
|
Altschul, S. F.,
T. L. Madden,
A. A. Schäffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402[Abstract/Free Full Text].
|
| 2.
|
Berks, B. C.
1996.
A common export pathway for proteins binding complex redox cofactors?
Mol. Microbiol.
22:393-404[CrossRef][Medline].
|
| 3.
|
Berks, B. C.,
F. Sargent, and T. Palmer.
2000.
The Tat protein export pathway.
Mol. Microbiol.
35:260-274[CrossRef][Medline].
|
| 4.
|
Brune, D. C.
1989.
Sulfur oxidation by phototrophic bacteria.
Biochim. Biophys. Acta
975:189-221[Medline].
|
| 5.
|
Brune, D. C.
1995.
Sulfur compounds as photosynthetic electron donors, p. 847-870.
In
R. E. Blankenship, M. T. Madigan, and C. E. Bauer (ed.), Anoxygenic photosynthetic bacteria. Kluwer, Amsterdam, The Netherlands.
|
| 6.
|
Cammack, R.,
A. Chapman,
W.-P. Lu,
A. Karagouni, and D. P. Kelly.
1989.
Evidence that protein B of the thiosulfate-oxidizing system of Thiobacillus versutus contains a binuclear manganese cluster.
FEBS Lett.
253:239-243[CrossRef].
|
| 7.
|
Chen, Z. -W.,
M. Koh,
G. van Driessche,
J. J. van Beeumen,
R. G. Bartsch,
T. E. Meyer,
M. A. Cusanovich, and F. S. Mathews.
1994.
The structure of flavocytochrome c sulfide dehydrogenase from a purple phototrophic bacterium.
Science
266:430-432[Abstract/Free Full Text].
|
| 7a.
| Cheesman, M. R., P. J. Little, and B. C. Berks.
Heme ligation in a c-type cytochrome involved in thiosulfate
oxidation: EPR and MCD of SoxAX from Rhodovulum
sulfidophilum. Biochemistry, in press.
|
| 8.
|
Chung, J.,
T. Chen, and D. Missiakas.
2000.
Transfer of electrons across the cytoplasmic membrane by DsbD, a membrane protein involved in thiol-disulphide exchange and protein folding in the bacterial periplasm.
Mol. Microbiol.
35:1099-1109[CrossRef][Medline].
|
| 9.
|
Deckert, G.,
P. V. Warren,
T. Gaasterland,
W. G. Young,
A. L. Lenox,
D. E. Graham,
R. Overbeek,
M. A. Snead,
M. Keller,
M. Aujay,
R. Huber,
R. A. Feldman,
J. M. Short,
G. J. Olson, and R. V. Swanson.
1998.
The complete genome of the hyperthermophilic bacterium Aquifex aeolicus.
Nature
392:353-358[CrossRef][Medline].
|
| 10.
|
Deshmukh, M.,
G. Brasseur, and F. Daldal.
2000.
Novel Rhodobacter capsulatus genes required for the biogenesis of various c-type cytochromes.
Mol. Microbiol.
35:123-138[CrossRef][Medline].
|
| 11.
|
Devereux, J.,
P. Haeberli, and O. Smithies.
1984.
A comprehensive set of sequence analysis programs for the VAX.
Nucleic Acids Res.
12:387-395.
|
| 12.
|
Friedrich, C. G.
1998.
Physiology and genetics of sulfur-oxidizing bacteria.
Adv. Microbiol. Physiol.
39:235-289[Medline].
|
| 13.
|
Friedrich, C. G.,
A. Quentmeier,
F. Bardischewsky,
D. Rother,
R. Kraft,
S. Kostka, and H. Prinz.
2000.
Novel genes coding for lithotrophic sulfur oxidation of Paracoccus pantotrophus GB17.
J. Bacteriol.
182:4677-4687[Abstract/Free Full Text].
|
| 14.
|
Gordon, E. H. J.,
M. D. Page,
A. C. Willis, and S. J. Ferguson.
2000.
Escherchia coli DipZ: anatomy of a transmembrane protein disulphide reductase in which three pairs of cysteine residues, one in each of three domains, contribute differentially to function.
Mol. Microbiol.
35:1360-1374[CrossRef][Medline].
|
| 15.
|
Hallenbeck, P. C.,
M. A. Clark, and E. L. Barrett.
1989.
Characterization of anaerobic reduction by Salmonella typhimurium and purification of the anaerobically induced sulfite reductase.
J. Bacteriol.
171:3008-3015[Abstract/Free Full Text].
|
| 16.
|
Hanlon, S. P.,
R. A. Holt,
G. R. Moore, and A. G. McEwan.
1994.
Isolation and characterization of a strain of Rhodobacter sulfidophilus: a bacterium which grows autotrophically with dimethylsulphide as electron donor.
Microbiology
140:1953-1958.
|
| 17.
|
Hansen, T. A., and H. Veldkamp.
1973.
Rhodopseudomonas sulfidophila, nov. spec., a new species of the purple nonsulfur bacteria.
Arch. Mikrobiol.
92:45-58[CrossRef][Medline].
|
| 18.
|
Hiraishi, A., and Y. Ueda.
1994.
Intrageneric structure of the genus Rhodobacter: transfer of Rhodobacter sulfidophilus and related marine species to the genus Rhodovulum gen. nov.
Int. J. Syst. Bacteriol.
44:15-23[Abstract/Free Full Text].
|
| 19.
|
Irgens, R. L.
1983.
Thioacetamide as a source of hydrogen sulfide for colony growth of purple sulfur bacteria.
Curr. Microbiol.
8:183-186[CrossRef].
|
| 20.
|
Kelly, D. P., and A. Wood.
1994.
Synthesis and determination of thiosulfate and polythionates.
Methods Enzymol.
243:475-501[CrossRef].
|
| 21.
|
Kelly, D. P.,
J. K. Shergill,
W.-P. Lu, and A. P. Wood.
1997.
Oxidative metabolism of inorganic sulfur compounds by bacteria.
Antonie Leeuwenhoek
71:95-107[CrossRef][Medline].
|
| 22.
|
Khanna, S., and D. J. D. Nicholas.
1982.
Utilization of tetrathionate and 35S-labelled thiosulfate by washed cells of Chlorobium vibrioforme f. sp. thiosulfatophilum.
J. Gen. Microbiol.
128:1027-1034.
|
| 23.
|
Klarskov, K.,
F. Verté,
G. van Driessche,
T. E. Meyer,
M. A. Cusanovich, and J. van Beeumen.
1998.
The primary structure of soluble cytochrome c-551 from the phototrophic green sulfur bacterium Chlorobium limicola, strain Tassajara, reveals a novel c-type cytochrome.
Biochemistry
37:10555-10562[CrossRef][Medline].
|
| 24.
|
Knöfel, T., and N. Sträter.
1999.
X-ray structure of the Escherichia coli periplasmic 5'-nucleotidase containing a dimetal catalytic site.
Nat. Struct. Biol.
6:448-453[CrossRef][Medline].
|
| 25.
|
Kusai, K., and T. Yamanaka.
1973.
The oxidation mechanism of thiosulfate and sulfide in Chlorobium thiosulfatophilum: roles of cytochrome c-551 and cytochrome c-553.
Biochim. Biophys. Acta
325:304-314[Medline].
|
| 26.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:280-285[Medline].
|
| 27.
|
Lu, W.-P., and D. P. Kelly.
1983.
Purification and some properties of two principal enzymes of the thiosulfate-oxidizing multi-enzyme system from Thiobacillus A2.
J. Gen. Microbiol.
129:3549-3564.
|
| 28.
|
Lu, W.-P., and D. P. Kelly.
1984.
Properties and role of sulphite cytochrome c oxido-reductase purified from Thiobacillus versutus (A2).
J. Gen. Microbiol.
130:1683-1692.
|
| 29.
|
Lu, W.-P., and D. P. Kelly.
1984.
Purification and characterization of two essential cytochromes of the thiosulfate-oxidizing multi-enzyme system from Thiobacillus A2 (Thiobacillus versutus).
Biochim. Biophys. Acta
765:106-117[CrossRef].
|
| 30.
|
Lu, W.-P.,
B. E. P. Swoboda, and D. P. Kelly.
1985.
Properties of the thiosulfate-oxidizing multi-enzyme system from Thiobacillus versutus.
Biochim. Biophys. Acta
828:116-122.
|
| 31.
|
Masuda, S.,
Y. Matsumoto,
K. V. P. Nagashima,
K. Shimada,
K. Inoue,
C. E. Bauer, and K. Matsuura.
1999.
Structural and functional analyses of photosynthetic regulatory genes regA and regB from Rhodovulum sulfidophilum, Roseobacter denitrificans, and Rhodobacter capsulatus.
J. Bacteriol.
181:4205-4215[Abstract/Free Full Text].
|
| 32.
|
Miller, J. H.
1992.
A short course in bacterial genetics: a laboratory manual and handbook for Escherichia coli and related bacteria.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 33.
|
Moore, G. R., and G. W. Pettigrew.
1990.
Cytochromes c: evolutionary, structural and physicochemical aspects.
Springer-Verlag, Berlin, Germany.
|
| 34.
|
Moreno-Vivien, C.,
M. Schmehl,
B. Masepohl,
W. Arnold, and W. Klipp.
1989.
DNA sequence and genetic analysis of the Rhodobacter capsulatus nifENX region: homology between NifX and NifB suggests involvement of NifX in processing of the iron-molybdenum cofactor.
Mol. Gen. Genet.
216:353-363[CrossRef][Medline].
|
| 35.
|
Mukhopadhyaya, P. N.,
C. Deb,
C. Lahiri, and P. Roy.
2000.
A soxA gene, encoding a diheme cytochrome c, and a sox locus, essential for sulfur oxidation in a new sulfur lithotrophic bacterium.
J. Bacteriol.
182:4278-4287[Abstract/Free Full Text].
|
| 36.
|
Neutzling, O.,
C. Pfleiderer, and H. G. Trüper.
1985.
Dissimilatory sulphur metabolism in phototrophic `non-sulphur' bacteria.
J. Gen. Microbiol.
131:791-798.
|
| 37.
|
Nielsen, H.,
J. Engelbrecht,
S. Brunak, and G. von Heijne.
1997.
Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites.
Protein Eng.
10:1-6[Abstract/Free Full Text].
|
| 38.
|
Parke, D.
1990.
Construction of mobilizable vectors derived from plasmids RP4, pUC18, and pUC19.
Gene
93:135-137[CrossRef][Medline].
|
| 39.
|
Petri, R.,
L. Podgorsek, and J. F. Imhoff.
2001.
Phylogeny and distribution of the soxB gene among thiosulfate-oxidizing bacteria.
FEMS Microbiol. Lett.
197:171-178[CrossRef][Medline].
|
| 40.
|
Prentki, P., and H. M. Krisch.
1984.
In vitro insertional mutagenesis with a selectable DNA fragment.
Gene
29:303-313[CrossRef][Medline].
|
| 41.
|
Pugsley, A. P.
1993.
The complete general-secretory pathway in gram-negative bacteria.
Microbiol. Rev.
57:50-108[Abstract/Free Full Text].
|
| 42.
|
Quentmeier, A.,
R. Kraft,
S. Kostka,
R. Klockenkämper, and C. G. Friedrich.
2000.
Characterization of a new type of sulfite dehydrogenase from Paracoccus pantotrophus GB17.
Arch. Microbiol.
173:117-125[CrossRef][Medline].
|
| 43.
|
Reinartz, M.,
J. Tschäpe,
T. Brüser,
H. G. Trüper, and C. Dahl.
1998.
Sulfide oxidation in the phototrophic sulfur bacterium Chromatium vinosum.
Arch. Microbiol.
170:59-68[CrossRef][Medline].
|
| 44.
|
Rudolph, M. J.,
M. M. Wuebbens,
K. V. Rajagopalan, and H. Schindelin.
2001.
Crystal structure of molybdopterin synthase and its evolutionary relationship to ubiquitin activation.
Nat. Struct. Biol.
8:42-46[CrossRef][Medline].
|
| 45.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 46.
|
Schütz, M.,
I. Maldener,
C. Griesbeck, and G. Hauska.
1999.
Sulfide-quinone reductase from Rhodobacter capsulatus: requirement for growth, periplasmic localization, and extension of gene sequence analysis.
J. Bacteriol.
181:6516-6523[Abstract/Free Full Text].
|
| 47.
|
Simon, R. U.,
U. Priefer, and A. Pühler.
1983.
A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram-negative bacteria.
Bio/Technology
1:784-791[CrossRef].
|
| 48.
|
Sonnhammer, E. L. L.,
G. von Heijne, and A. Krogh.
1998.
A hidden Markov model for predicting transmembrane helices in protein sequences, p. 175-182.
In
J. Glasgow, T. Littlejohn, F. Major, R. Lathrop, D. Sankoff, and C. Sensen (ed.), Proceedings of the Sixth International Conference on Intelligent Systems for Molecular Biology. AAAI Press, Menlo Park, Calif.
|
| 49.
|
Stewart, E. J.,
F. Katzen, and J. J. Beckwith.
1999.
Six conserved cysteines of the membrane protein DsbD are required for the transfer of electrons from the cytoplasm to the periplasm of Escherichia coli.
EMBO J.
18:5963-5971[CrossRef][Medline].
|
| 50.
|
Thomas, P. E.,
D. Ryan, and W. Levin.
1976.
An improved staining procedure for the detection of peroxidase activity of cytochrome P-450 on sodium dodecyl sulfate polyacrylamide gels.
Anal. Biochem.
75:168-176[CrossRef][Medline].
|
| 51.
|
Wang, C.,
J. Xi,
T. P. Begley, and L. K. Nicholson.
2001.
Solution structure of ThiS and implications for the evolutionary roots of ubiquitin.
Nat. Struct. Biol.
8:47-51[CrossRef][Medline].
|
| 52.
|
Weaver, P. T.,
J. D. Wall, and H. Gest.
1975.
Characterization of Rhodopseudomonas capsulata.
Arch. Microbiol.
105:207-216[CrossRef][Medline].
|
| 53.
|
Wodara, C.,
S. Kostka,
M. Egert,
D. P. Kelly, and C. G. Friedrich.
1994.
Identification and sequence analysis of the soxB gene essential for sulfur oxidation of Paracoccus denitrificans GB17.
J. Bacteriol.
176:6188-6191[Abstract/Free Full Text].
|
| 54.
|
Wodara, C.,
F. Bardischewsky, and C. G. Friedrich.
1997.
Cloning and characterization of sulfite dehydrogenase, two c-type cytochromes, and a flavoprotein of Paracoccus denitrificans GB17: essential role of sulfite dehydrogenase in lithotrophic sulfur oxidation.
J. Bacteriol.
179:5014-5023[Abstract/Free Full Text].
|
Journal of Bacteriology, October 2001, p. 6107-6118, Vol. 183, No. 20
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.20.6107-6118.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Sauve, V., Roversi, P., Leath, K. J., Garman, E. F., Antrobus, R., Lea, S. M., Berks, B. C.
(2009). Mechanism for the Hydrolysis of a Sulfur-Sulfur Bond Based on the Crystal Structure of the Thiosulfohydrolase SoxB. J. Biol. Chem.
284: 21707-21718
[Abstract]
[Full Text]
-
Ogawa, T., Furusawa, T., Nomura, R., Seo, D., Hosoya-Matsuda, N., Sakurai, H., Inoue, K.
(2008). SoxAX Binding Protein, a Novel Component of the Thiosulfate-Oxidizing Multienzyme System in the Green Sulfur Bacterium Chlorobium tepidum. J. Bacteriol.
190: 6097-6110
[Abstract]
[Full Text]
-
Kappler, U., Bernhardt, P. V., Kilmartin, J., Riley, M. J., Teschner, J., McKenzie, K. J., Hanson, G. R.
(2008). SoxAX Cytochromes, a New Type of Heme Copper Protein Involved in Bacterial Energy Generation from Sulfur Compounds. J. Biol. Chem.
283: 22206-22214
[Abstract]
[Full Text]
-
Sauve, V., Bruno, S., Berks, B. C., Hemmings, A. M.
(2007). The SoxYZ Complex Carries Sulfur Cycle Intermediates on a Peptide Swinging Arm. J. Biol. Chem.
282: 23194-23204
[Abstract]
[Full Text]
-
Mandal, S., Chatterjee, S., Dam, B., Roy, P., Gupta, S. K. D.
(2007). The dimeric repressor SoxR binds cooperatively to the promoter(s) regulating expression of the sulfur oxidation (sox) operon of Pseudaminobacter salicylatoxidans KCT001. Microbiology
153: 80-91
[Abstract]
[Full Text]
-
Ghosh, W., Roy, P.
(2006). Mesorhizobium thiogangeticum sp. nov., a novel sulfur-oxidizing chemolithoautotroph from rhizosphere soil of an Indian tropical leguminous plant. Int. J. Syst. Evol. Microbiol.
56: 91-97
[Abstract]
[Full Text]
-
Ghosh, W., Bagchi, A., Mandal, S., Dam, B., Roy, P.
(2005). Tetrathiobacter kashmirensis gen. nov., sp. nov., a novel mesophilic, neutrophilic, tetrathionate-oxidizing, facultatively chemolithotrophic betaproteobacterium isolated from soil from a temperate orchard in Jammu and Kashmir, India. Int. J. Syst. Evol. Microbiol.
55: 1779-1787
[Abstract]
[Full Text]
-
Rother, D., Orawski, G., Bardischewsky, F., Friedrich, C. G.
(2005). SoxRS-mediated regulation of chemotrophic sulfur oxidation in Paracoccus pantotrophus. Microbiology
151: 1707-1716
[Abstract]
[Full Text]
-
Kappler, U., Aguey-Zinsou, K.-F., Hanson, G. R., Bernhardt, P. V., McEwan, A. G.
(2004). Cytochrome c551 from Starkeya novella: CHARACTERIZATION, SPECTROSCOPIC PROPERTIES, AND PHYLOGENY OF A DIHEME PROTEIN OF THE SoxAX FAMILY. J. Biol. Chem.
279: 6252-6260
[Abstract]
[Full Text]