Journal of Bacteriology, October 2001, p. 6148-6149, Vol. 183, No. 20
Department of Microbiology and
Immunology, University of North Dakota School of Medicine, Grand
Forks, North Dakota 58202-9037
Received 9 July 2001/Accepted 2 August 2001
Previously, we constructed a set of mutants from which eight
penicillin binding protein (PBP) genes were deleted in 192 combinations from Escherichia coli (S. A. Denome, P. K. Elf,
T. A. Henderson, D. E. Nelson, and K. D. Young, J. Bacteriol. 181:3981-3993, 1999). Although these mutants were
constructed correctly as determined by restriction mapping and
the absence of relevant protein products, we recently discovered by PCR
mapping that strains from which mrcA (PBP 1a) was deleted
were also missing two neighboring genes of unknown function
(yrfE and yrfF). We created a new deletion mutation in mrcA and reconstructed 63 strains lacking PBP
1a and other PBP mutant combinations. The new mrcA mutants
do not exhibit mucoidy, phage resistance, temperature sensitivity,
growth rate defects, or antibiotic resistance, suggesting that these
phenotypes require the loss of either yrfE or
yrfF alone or in combination with the absence of multiple PBPs.
Four high-molecular-weight
penicillin binding proteins (PBPs) of Escherichia coli (PBPs
1a, 1b, 2, and 3) are responsible for synthesizing and assembling the
peptidoglycan sacculus that forms the rigid bacterial cell wall
(5, 6). However, E. coli also possesses at
least seven low-molecular-weight PBPs (PBPs 4, 5, 6, and 7 and DacD,
AmpC, and AmpH), the biological functions of which are either poorly
characterized or completely unknown (2, 5, 6).
To address this question of physiological function, we constructed a
set of multiply mutated strains in which one to seven PBPs were deleted
in every viable combination (2). At the time of
construction, each strain was tested by restriction mapping and by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) to
confirm that the correct genes and protein products had been deleted.
Recently, we found we were unable to PCR amplify the mutated
mrcA gene (encoding PBP 1a) from chromosomal preparations when using oligonucleotide primers hybridizing to sequences just upstream and downstream of the putative deletion endpoints. Primers further away from the mutated site did give an amplification product (data not shown), suggesting that a larger fragment had been deleted than was reported previously. DNA sequencing confirmed that one open
reading frame (ORF) (yrfE) and the promoter and 5' end of a
second open reading frame (yrfF) were deleted in addition to most of the mrcA gene (data not shown). The extent of the
deletion is pictured schematically in Fig.
1B. Thus, every strain designated as
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.20.6148-6149.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Reconstruction of Escherichia coli mrcA (PBP 1a)
Mutants Lacking Multiple Combinations of Penicillin Binding
Proteins
and
![]()
ABSTRACT
Top
Abstract
Text
References
![]()
TEXT
Top
Abstract
Text
References
mrcA in our previous publication (2) is
actually a
(mrcA-yrfE-yrfF) deletion. All other PBP gene
deletions were correct as reported (data not shown).

View larger version (21K):
[in a new window]
FIG. 1.
Deletions of mrcA and neighboring genes in
E. coli. (A)Gene order downstream of mrcA
in the parental strain, E. coli CS109. (B) Extent of
deletion created in E. coli CS13-2K, previously reported to
encompass only mrcA (2). The segment from the
XhoI site in mrcA to the BspDI site in
yrfF was replaced by the res-npt-res cassette
(4). (C) Extent of the new mrcA deletion in
E. coli BMCS04-1K reported in this work. The entire
mrcA gene from the initiation codon to the termination codon
was replaced by the res-npt-res cassette (4).
Abbreviations: B, BamHI; E, EcoRI; DI,
BspDI; H, HindIII; X, XhoI.
The data in Fig. 1 illustrates why the deletion was not correctly
characterized earlier. When creating the original mrcA
mutation we observed a single XhoI-BspDI DNA
fragment, leading us to believe that one BspDI site existed
in the cloned segment. However, after the mutants were constructed, the
complete genomic sequence of E. coli (1)
revealed there were three BspDI sites
two so close together
that they could not be distinguished as separate sites and the third in
the yrfF gene. Because the lengths of the two XhoI-BspDI and BspDI-BspDI
fragments are almost identical, they appeared as a single band on our
gels. Thus, our original digestions actually created a deletion from
the XhoI site in mrcA to the BspDI
site in yrfF (Fig. 1B).
To correct this situation, we deleted mrcA by using the
recombination system described by Yu et al. (8). The
res-npt-res cassette of plasmid pCK155 (4) was
amplified by PCR using two primers homologous to each end of the
cassette and containing at their 5' ends chromosomal sequences
homologous to those preceding the AUG start codon of mrcA or
sequences following the UGA stop codon of mrcA. The primer
sequences were, respectively,
ACCGCGCGTTTGTTTATAAACTGCCCAAATGAAACTAAATGGAATTCGAGCTCTGCAGTCCC and
CACTTTGTCAGCAAACTGAAAAGGCGCCGAAGCGCCTTTTTAAGATAAGCTTGCATGCCTGCAG. The resulting PCR product was electroporated into E. coli DY329 (8), and the cells were plated onto
Luria-Bertani agar plates plus kanamycin (50 µg/ml) and incubated for
2 days at 32°C. Kanamycin-resistant colonies were screened for the
correct mutation by PCR amplification, and the new mrcA
deletion was confirmed by PCR amplification with combinations of
internal and external primers and by SDS-PAGE of
125I-labeled PBPs (3) (data not shown). The
mutation was moved into E. coli CS109 by P1 transduction to
form strain BMCS04-1K. The extent of this new mrcA deletion
is pictured schematically in Fig. 1C.
The new
mrcA::res-npt-res mutation
was moved into selected E. coli strains to recreate the set
of multiple mutants lacking PBP 1a in combination with every possible
combination of six other PBPs (Table 1).
Therefore, these strains are replacements for and should be used
instead of the mrcA mutants described previously (2).
|
After screening the original mrcA mutants (now known to be
mrcA-yrfEF) (2), we reported preliminary
observations that deletion of PBP 1a alone or in combination with other
PBP mutations resulted in expression of a colanic acid capsule,
phage resistance, temperature sensitivity, and resistance to
lysis by certain
-lactams (7). The new mutant
combinations described in this work exhibited none of these phenotypes
(data not shown), suggesting that loss of either yrfE or
yrfF alone or in combination with the absence of multiple
PBPs is responsible for these characteristics. We are currently
examining the relationship among these genes and phenotypes.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology and Immunology, School of Medicine, University of North Dakota, Grand Forks, ND 58202-4037. Phone: (701) 777-2624. Fax: (701) 777-2054. E-mail: kyoung{at}medicine.nodak.edu.
Present address: Division of Pulmonary, Allergy, Critical Care and
Occupational Medicine, Indiana University School of Medicine, Indianapolis, IN 46202.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Blattner, F. R.,
G. Plunkett III,
C. A. Bloch,
N. T. Perna,
V. Burland,
M. Riley,
J. Collado-Vides,
J. D. Glasner,
C. K. Rode,
G. F. Mayhew,
J. Gregor,
N. W. Davis,
H. A. Kirkpatrick,
M. A. Goeden,
D. J. Rose,
B. Mau, and Y. Shao.
1997.
The complete genome sequence of Escherichia coli K-12.
Science
277:1453-1462 |
| 2. |
Denome, S. A.,
P. K. Elf,
T. A. Henderson,
D. E. Nelson, and K. D. Young.
1999.
Escherichia coli mutants lacking all possible combinations of eight penicillin binding proteins: viability, characteristics, and implications for peptidoglycan synthesis.
J. Bacteriol.
181:3981-3993 |
| 3. |
Henderson, T. A.,
P. M. Dombrosky, and K. D. Young.
1994.
Artifactual processing of penicillin-binding proteins 7 and 1b by the OmpT protease of Escherichia coli.
J. Bacteriol.
176:256-259 |
| 4. |
Kristensen, C. S.,
L. Eberl,
J. M. Sanchez-Romero,
M. Givskov,
S. Molin, and V. de Lorenzo.
1995.
Site-specific deletions of chromosomally located DNA segments with the multimer resolution system of broad-host-range plasmid RP4.
J. Bacteriol.
177:52-58 |
| 5. | Matsuhashi, M. 1994. Utilization of lipid-precursors and the formation of peptidoglycan in the process of cell growth and division: membrane enzymes involved in the final steps of peptidoglycan synthesis and the mechanism of their regulation, p. 55-71. In J.-M. Ghuysen, and R. Hakenbeck (ed.), Bacterial cell wall. Elsevier Science BV, Amsterdam, The Netherlands. |
| 6. |
Spratt, B. G.
1975.
Distinct penicillin binding proteins involved in the division, elongation, and shape of Escherichia coli K12.
Proc. Natl. Acad. Sci. USA
72:2999-3003 |
| 7. | Young, K. D. 2001. Approaching the physiological functions of penicillin-binding proteins in Escherichia coli. Biochimie 83:99-102[Medline]. |
| 8. |
Yu, D.,
H. M. Ellis,
E.-C. Lee,
N. A. Jenkins,
N. G. Copeland, and D. L. Court.
2000.
An efficient recombination system for chromosome engineering in Escherichia coli.
Proc. Natl. Acad. Sci. USA
97:5978-5983 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»