Journal of Bacteriology, November 2001, p. 6169-6174, Vol. 183, No. 21
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.21.6169-6174.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
54: Role in Alcohol Catabolism and
Encystment
Departamento de Microbiología Molecular, Instituto de Biotecnología, Universidad Nacional Autónoma de México, Cuernavaca, Morelos 62250, Mexico
Received 1 September 2000/Accepted 7 August 2001
| |
ABSTRACT |
|---|
|
|
|---|
Encystment in Azotobacter vinelandii is induced by
n-butanol or
-hydroxybutyrate (BHB). We identified a
gene, encoding an aldehyde dehydrogenase, that was named
aldA. An aldA mutation impaired bacterial
growth on n-butanol, ethanol, or hexanol as the sole carbon
source. Expression of aldA increased in cells shifted from
sucrose to n-butanol and was shown to be dependent on the
alternative
54 factor. A mutation in rpoN
encoding the
54 factor also impaired growth on alcohols.
Encystment on n-butanol, but not on BHB, was impaired in
aldA or rpoN mutants, indicating that
n-butanol is not an inducer of encystment by itself but
must be catabolized in order to induce encystment.
| |
INTRODUCTION |
|---|
|
|
|---|
Azotobacter vinelandii is a soil
nitrogen-fixing bacterium which produces the intracellular
polyester poly-
-hydroxybutyrate (poly-BHB) and undergoes
differentiation to form desiccation-resistant cysts. Encystment can be
induced by removing sucrose from exponential-phase cells and replacing
it with BHB or n-butanol (7, 20, 27): BHB,
which is a natural metabolite in A. vinelandii
(7), is believed to induce encystment because its addition
results in conditions approximating poly-BHB degradation and because
induction by n-butanol has been proposed to result from its
conversion to BHB (20). Encystment induced by BHB or
n-butanol or that occurring in late-stationary-phase glucose
cultures is accompanied by the formation of a family of
5-n-alkylresorcinols and 6-n-alkylpirones that are lipids present only in encysting cells. They replace the
membrane phospholipids and are a major component of the exine (16-18). Thus, encystment seems to be induced by a
metabolic shift from carbohydrate metabolism to lipid metabolism, and
this shift seems to be promoted in the presence of either
n-butanol or BHB.
Aldehyde dehydrogenases participate in metabolic processes, such as the catabolism of alcohols (15); they catalyze the oxidation of aldehydes to their corresponding acid form. Some bacterial aldehyde dehydrogenases, such as Pseudomonas aeruginosa malonic semialdehyde dehydrogenase, have high specificity (12), while others such as acetaldehyde dehydrogenase II (AcDH-II) from Ralstonia eutropha function on a broad spectrum of substrates. AcDH-II is involved in the catabolism of acetoin as well as of ethanol (15).
We identified aldA, a gene encoding an aldehyde
dehydrogenase, whose expression was increased in cells shifted from
sucrose to n-butanol. We found that AldA activity is
essential for catabolism of n-butanol and other alcohols and
that aldA expression is controlled by the alternative
54 factor. We also show that n-butanol has to
be catabolized to induce encystment.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Microbiological procedures.
The bacterial strains and
plasmids used in this study are listed in Table
1. A. vinelandii was grown at
30°C on Burk's medium (5), supplemented with 2%
sucrose, 0.2% n-butanol, or 0.2% BHB. A. vinelandii transformation was carried out as reported by Bali et
al. (2). Encystment was determined by measuring resistance
to desiccation as previously described (3). Bacterial strains were grown on liquid Burk's sucrose medium for 24 h,
washed with 10 mM magnesium sulfate, and induced for encystment by
incubation on plates of Burk's medium supplemented with
n-butanol or BHB.
-Galactosidase activity was measured as
reported by Miller (10); 1 U corresponds to 1 nmol of
o-nitrophenyl-
-D-galactoside hydrolyzed per
min per µg of protein. Protein was determined by the Lowry method
(8). All measurements were done in triplicate.
|
Transposon mutagenesis.
Random transposon mutagenesis of
strain JG8 was carried out with a pUT derivative containing the
mini-Tn5-lacZ2 transposon as described
previously (4). We isolated 3,200 kanamycin derivatives. Unexpectedly, all 3,200 mutants showed blue on plates containing Burk's sucrose medium with sucrose and
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal).
The parental strain JG8, used as a control, showed white. It is
unlikely that, in all kanamycin-resistant mutants, the lacZ gene was fused to an A. vinelandii promoter, thus suggesting
that the lacZ gene is transcribed in A. vinelandii. However, about 10% of the mutants were bluer,
suggesting that, in these strains, expression of lacZ was
also initiated from A. vinelandii promoters.
Construction of strains SG9A and CN10.
Plasmid pSG9 (Fig.
1), which is unable to replicate in
A. vinelandii, was introduced by transformation into strain
ATCC 9046. Strain SG9A is a kanamycin-resistant derivative. The
replacement of the aldA wild-type gene by the
aldA-mini-Tn5 mutation on the chromosome of the
SG9A was confirmed by Southern blotting using labeled pSG9 as a probe
(data not shown).
|
Recombinant DNA techniques. All DNA manipulations were performed by standard procedures (21).
Primer extension analysis.
Primer extension reactions were
performed with a primer extension system (Amersham) as instructed by
the manufacturer. Oligonucleotide primer 5'CACTGCCAGGATGGGCATAC
was labeled with [
-32P]dATP (Amersham) at the 5'
end by using polynucleotide kinase and was hybridized to 50 µg of
total RNA. After extension with reverse transcriptase, cDNA products
were examined by electrophoresis in an 8% polyacrylamide gel. To map
transcriptional start points, sequencing reactions were performed on
pSG9 DNA by the dideoxy chain method (22), using
[
-32P]dATP and a sequencing kit with the same primer
employed for the primer extension reactions.
Aldehyde dehydrogenase assay. A. vinelandii cells were grown to early stationary phase on Burk's sucrose medium at 30°C. The cultures were centrifuged, washed, and resuspended in Burk's n-butanol medium. After 20 h of induction in this medium, the cells were collected by centrifugation, resuspended in 1/25 volume of phosphate buffer, pH 7.4, and sonicated. The sonicated cell suspensions were centrifuged at 14,000 × g for 5 min, and the supernatants were centrifuged for 1.5 h at 192,000 × g. Ammonium sulfate was added to give 50% saturation. The precipitate was collected by centrifugation at 14,000 × g, resuspended in phosphate buffer, pH 7.4, and dialyzed against the same buffer. The activity was assayed spectrophotometrically as reported previously (13) by measuring the reduction of NAD+ at 340 nm. The reaction was initiated by addition of butyraldehyde or acetaldehyde. The rate of endogenous NAD+ reduction was recorded in the absence of butyraldehyde or acetaldehyde in the assay. One unit of activity is defined as the amount of enzyme reducing 1 nmol of NAD+ per min per mg of protein.
Cloning of aldA gene. A cosmid clone pSM888 from an A. vinelandii gene library that harbored a 2.2-kb PstI fragment containing the aldA gene was identified by hybridization with a 0.5-kb SalI fragment from pSG9. The 2.2-kb PstI fragment was subcloned into plasmid pKS to give plasmid pSM9 (Fig. 1). A Gm resistance gene was cloned into the polylinker of pSM9 to give plasmid pSM9-Gm (Fig. 1).
Nucleotide sequence accession number. The A. vinelandii aldA gene sequence reported here has been assigned GenBank accession no. AF277380.
| |
RESULTS |
|---|
|
|
|---|
Identification of A. vinelandii gene induced in
n-butanol.
In A. vinelandii,
encystment can be induced by transferring vegetative cells into plates
of Burk's salt medium containing sublethal levels
(0.2%) of n-butanol as the carbon source. To identify
genes expressed during the induction of the encystment process, we
isolated 3,200 mutants carrying
mini-Tn5-lacZ insertions (see Materials
and Methods). When mini-Tn5-lacZ is
inserted downstream, a promoter in the correct orientation
creates a gene fusion. We transferred the 3,200 mini-Tn5-lacZ mutants to plates of Burk's medium containing n-butanol as the only carbon source and
X-Gal and to plates with Burk's medium with 2.0% sucrose and X-Gal. A
mutant named SG9, that, although unable to grow on Burk's butanol, showed a bluer phenotype on Burk's butanol than on Burk's sucrose, was identified (data not shown). A 7.0-kb PstI fragment
containing the mini-Tn5-lacZ insertion from SG9
was cloned into pBluescript KS. The resultant plasmid pSG9 (Fig. 1) was
transformed to wild-type ATCC 9046. Strain SG9A, a transformant that
was unable to grow on Burk's butanol (Fig.
2C) and showed a bluer phenotype on
Burk's butanol was isolated, confirming that these phenotypes were
caused by the mini-Tn5 insertion. We also confirmed
induction of transcription under encystment conditions of the
identified gene by measuring
-galactosidase activity. Cultures
of strain SG9A were grown for 24 h in liquid Burk's medium
supplemented with 2.0% sucrose. Cells from these cultures were
transferred to agar plates containing Burk's medium supplemented with
n-butanol or sucrose. As expected, an increase in
-galactosidase activity was observed during incubation on
n-butanol (Fig. 3).
|
|
Cloning and DNA sequence.
Plasmid pSG9 (Fig. 1) was used to
determine 2.3 kb of the A. vinelandii DNA sequence
surrounding the transposon. Analysis of this sequence revealed an open
reading frame encoding a polypeptide of 506 amino acid residues with a
calculated molecular mass of 55,061 Da. The location of the
mini-Tn5-lacZ mutation was determined by
sequencing across the transposon insertion junction and was found to
lie within codons 135 to 137. Comparison of the deduced amino acid
sequence with those in the databases revealed a high degree of
similarity with aldehyde dehydrogenases from different sources. Thus,
we named this A. vinelandii gene aldA. The
deduced protein product shares 89% identity with the P. aeruginosa putative aldehyde dehydrogenase PA4022
(24) (accession no. F83142), 88% with P. aeruginosa ExaC (23) (accession no. AF068264), and
69% with R. eutropha AcDH-II (P46368), an enzyme
responsible for the oxidation of acetaldehyde to acetate during growth
on ethanol or acetoin (15). In the sequenced DNA fragment,
303 nucleotides upstream of aldA, an incomplete open reading
frame comprised of 207 nucleotides and divergently oriented is present (Fig. 1). A Blast P GenBank search for the deduced protein revealed similarity to the acetoin catabolism regulatory protein AcoR (SWISS PROT P28614), the putative activator for acetoin catabolism genes
of R. eutropha H16 (6). It is a
member of the NifA family of transcriptional activators known as
enhancer binding proteins, required for transcription from
54-dependent genes (11). The highest
identity of this A. vinelandii AcoR homologue (89%) was
found with the P. aeruginosa PAO1 putative transcriptional
activator PA4021, which is located upstream and in opposite orientation
to that of the putative aldehyde dehydrogenase PA4022
(24).
Effect of aldA mutation on aldehyde dehydrogenase activity. The inability of SG9A to grow on the carbon source n-butanol and the high similarity of aldA with aldehyde dehydrogenases suggested that this gene encodes an enzyme with butyraldehyde dehydrogenase activity. We assayed this activity in extracts of the wild-type strain ATCC 9046 and SG9A.
After induction on n-butanol, coenzyme A-independent butyraldehyde dehydrogenase activity was detected in the wild type and a significant reduction of this activity was found in the SG9A mutant (Table 2). The aldA mutation did not completely abrogate butyraldehyde activity, suggesting that another enzyme is the source of the background activity. AldA activity on acetaldehyde as a substrate was also tested. As shown in Table 2, AldA also displays acetaldehyde dehydrogenase activity. In agreement with this result, strain SG9A was unable to grow with ethanol or hexanol as the carbon source (Fig. 2D and E). These data indicate that the AldA activity is not specific for n-butanol and participates in the catabolism of several alcohols.
|
Identification of an aldA
54
promoter.
Primer extension experiments were performed to determine
the transcriptional start site of aldA. Figure
4 shows the primer extension products
obtained with RNA isolated from strain ATCC 9046 grown in Burk's
medium supplemented with n-butanol. A transcriptional start
site corresponding to an A residue located 57 nucleotides upstream
of the proposed aldA start codon was identified (Fig. 4).
Examination of the 5' upstream region revealed the presence of putative
24 (CTGGCA) and
12 (TTGCT) promoter sequences recognized by
54. We therefore carried out primer extension analysis
of aldA in strain CN10, an ATCC 9046 derivative carrying a
mutation in rpoN encoding
54. As shown in
Fig. 4, no primer extension products were detected with RNA from strain
CN10.
|
Effect of rpoN mutation on aldehyde dehydrogenase
activity and on growth on alcohols.
As transcription of
aldA seems to be impaired by the rpoN mutation,
growth on alcohols and aldehyde dehydrogenase activity in the
rpoN mutant were expected to be similar to those of the aldA mutant. The results shown in Table 2 and Fig. 2
indicate that this is indeed the case and confirm the dependence of the aldA promoter on the
54 factor. Together
these data confirm that aldA is transcribed from a single
54 promoter and that its product AldA is essential for
the utilization of several alcohols as carbon sources.
Effect of aldA and rpoN mutations on
encystment.
Induction of encystment by n-butanol is
proposed to be due to its conversion to BHB (20). If this
hypothesis is correct, AldA and
54 are expected to be
essential for encystment induced by n-butanol. We tested
encystment of strains SG9A and CN10 in either n-butanol or
BHB. As expected, strain SG9A was unable to produce
desiccation-resistant cells when induced with n-butanol but
not with BHB (Table 3). Growth of strain
SG9A on BHB is similar to that of the wild-type strain (Fig. 2).
However, it produced cysts resistant to desiccation with a reduced
frequency when BHB rather than n-butanol was the sole carbon
source (Table 3). This result supports the hypothesis that
n-butanol induces encystment because it is converted to BHB; however, it does not rule out the possibility that the lack of encystment of SG9A is caused by its inability to grow on
n-butanol. We added 0.1% sucrose to the Burk's
n-butanol encysting medium to promote growth of strain SG9A
during encystment; however, no mature cysts were detected under this
condition, either in the wild type or the aldA mutant (data
not shown). This result is in agreement with the abortion of encystment
that was observed when glucose was added to encysting A. vinelandii cultures (7).
|
SG9A complementation by aldA wild-type gene. Plasmid pSM9-Gm (Fig. 1), which is unable to replicate in A. vinelandii and carries the aldA gene flanked by 500 nucleotides upstream of the ATG start codon and 200 nucleotides downstream of the stop codon, was transformed into SG9A for integration into the chromosome. Strain SG9A::pSM9-Gm, a gentamicin-resistant transformant, was selected. The presence of a wild-type aldA gene was confirmed by PCR analysis using SG9A::pSM9-Gm chromosomal DNA as a template as well as oligonucleotides aldA1 5'- and aldA2 3'- (data not shown). Strain SG9A::pSM9-Gm grew in n-butanol, ethanol, or hexanol (Fig. 2) and produced cells resistant to desiccation after induction with n-butanol (Table 3). We do not know whether the aldA mutation has a polar effect on downstream genes; however, integration of pSM9-Gm downstream of the mini-Tn5-lacZ insertion (in strain SG9A::pSM9-Gm) should restore the activity of these genes. Therefore, this result confirms that, either polar or nonpolar, the aldA mutation causes an inability to grow on alcohols and to encyst.
| |
DISCUSSION |
|---|
|
|
|---|
In an effort to understand the nature of genes involved in the induction of the encystment and the molecular mechanisms that control this process in A. vinelandii, we have identified, through mini-Tn5-lacZ mutagenesis and subsequent screening for lacZ gene fusions whose expression increased when shifted from sucrose to n-butanol, a gene encoding a protein with high similarity to aldehyde dehydrogenases. The gene was named aldA. Inactivation of aldA by mini-Tn5-lacZ led to a significant reduction in aldehyde dehydrogenase activity, demonstrating that this gene indeed encodes an aldehyde dehydrogenase. Inactivation of aldA also led to the inability to grow on n-butanol, ethanol, or hexanol as the sole carbon source. Thus, AldA is a wide substrate specificity enzyme that is responsible for the oxidation of aldehydes during growth on alcohols.
An interesting finding was the presence upstream from and in opposite orientation to aldA of an open reading frame whose deduced amino acid sequence is highly similar to that of the activator AcoR. The highest similarity of both AldA and this AcoR homologue was found with the not-yet-characterized P. aeruginosa PA4022 and PA4021 gene products, respectively. The physical organization of these two genes was also similar in both bacteria. It would be interesting to find out whether these P. aeruginosa genes are involved in alcohol catabolism.
This study demonstrates that expression of aldA is under
54 control.
54 controls diverse and
unrelated functions in different groups of bacteria (for a recent
review, see reference 25). Some of these functions include
the catabolism of acetoin and ethanol in Alcaligenes
eutrophus (13, 14). Our finding that aldA
is transcribed from a
54-dependent promoter and the
inability of rpoN and aldA mutants to grow on
ethanol, n-butanol, or hexanol add the catabolism of these
alcohols to the processes controlled by rpoN.
Transcription from
54-dependent genes requires
additional transcriptional factors known as enhancer binding proteins
(11); this implies the requirement of an activator protein
for aldA transcription. In fact the presence upstream of
aldA of an acoR homologue, encoding a member of
the NifA family of transcriptional activators, suggests that this AcoR
might be the activator of the aldA promoter. In R. eutropha, AcoR is the putative activator for acetoin and AcDH-II
genes (6).
The inability of rpoN and aldA mutants to form mature cysts on n-butanol but not in BHB supports the hypothesis that n-butanol is not by itself an inductor but that it induces encystment because it is converted to BHB or other related metabolites. The lack of encystment by SG9A and CN10 on n-butanol could be caused by their inability to grow under these conditions. However, we showed that encystment can occur under nongrowing conditions, as was the case for strain CN10 when it was induced in BHB without ammonia. In addition, encystment is initiated by the rounding up of the vegetative cell and the termination of cell division (19).
It is important that lack of growth of strain CN10 on BHB in the absence of ammonia is due to the negative effect of the rpoN mutation on nitrogen fixation and that this process has been shown to be arrested upon initiation of encystment (19, 20). In contrast, lack of growth on n-butanol of either SG9A or CN10 strain is caused by each strain's inability to catabolize alcohols. Thus, a source of carbon (able to induce a shift from glucose to BHB metabolism) seems to be essential for the encystment process even under nongrowing conditions.
In conclusion, we identified an aldehyde dehydrogenase AldA gene
regulated by
54 that is essential for the catabolism of
alcohols and provided evidence that the catabolism of
n-butanol by AldA activity is required to induce encystment.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by grants 27767-N from CONACyT and IN209399 from DGAPA/PAPIIT UNAM to G.E.
We thank G. Soberón and M. Villanueva for reviewing the manuscript.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Departamento de Microbiología Molecular, Instituto de Biotechnología, Universidad Nacional Autónoma de México, Apdo. postal 510-3, Cuernavaca, Morelos 62250, Mexico. Phone: (52) (73) 291644. Fax: (52) (73) 172388. E-mail: espin{at}ibt.unam.mx.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Alexeyev, M. F., I. Shokolenko, and T. P. Croughan. 1995. Improved antibiotic-resistance gene cassettes and omega elements for Escherichia coli vector construction and in vitro deletion/insertion mutagenesis. Gene 160:63-67[CrossRef][Medline]. |
| 2. |
Bali, A.,
G. Blanco,
S. Hill, and C. Kennedy.
1992.
Excretion of ammonium by a nifL mutant of Azotobacter vinelandii fixing nitrogen.
Appl. Environ. Microbiol.
58:1711-1718 |
| 3. |
Campos, M. E.,
J. Martínez-Salazar,
L. Lloret,
S. Moreno,
C. Núñez,
G. Espín, and G. Soberón-Chávez.
1996.
Characterization of the gene coding for GDP-mannose dehydrogenase (algD) from Azotobacter vinelandii.
J. Bacteriol.
178:1793-1799 |
| 4. |
de Lorenzo, V.,
M. Herrero,
U. Jakubzik, and K. N. Timmis.
1990.
Mini-Tn5 transposon derivatives for insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in gram-negative eubacteria.
J. Bacteriol.
172:6568-6572 |
| 5. | Kennedy, C., R. Gamal, R. Humphrey, J. Ramos, K. Brigle, and D. Dean. 1986. The nifH, nifM and nifN genes of Azotobacter vinelandii: characterization by Tn5 mutagenesis and isolation from pLARF1 gene banks. Mol. Gen. Genet. 205:318-325[CrossRef]. |
| 6. |
Krüger, N., and A. Steinbüchel.
1992.
Identification of acoR, a regulatory gene for the expression of genes essential for acetoin catabolism in Alcaligenes eutrophus H16.
J. Bacteriol.
174:4391-4400 |
| 7. |
Lin, L. P., and H. L. Sadoff.
1968.
Encystment and polymer production by Azotobacter vinelandii in the presence of -hydroxybutyrate.
J. Bacteriol.
98:1335-1341.
|
| 8. |
Lowry, O. H.,
N. J. Rosebrough,
A. L. Farr, and R. J. Randall.
1951.
Protein measurement with the Folin phenol reagent.
J. Biol. Chem.
193:265-275 |
| 9. | Mejía-Ruíz, H. J. Guzmán, S. Moreno, G. Soberón-Chávez, and G. Espín. 1997. The Azotobacter vinelandii alg8 and alg44 genes are essential for alginate synthesis and can be transcribed from an algD-independent promoter. Gene 199:271-277[CrossRef][Medline]. |
| 10. | Miller, J. H. 1972. Experiments in molecular genetics, p. 431-435. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 11. |
Morett, E., and L. Segovia.
1993.
The 54 bacterial enhancer-binding protein family: mechanism of action and phylogenetic relationship of their functional domains.
J. Bacteriol.
175:6067-6074 |
| 12. | Nakamura, K., and F. Bernheim. 1961. Studies on malonic semialdehyde dehydrogenase from Pseudomonas aeruginosa. Biochim. Biophys. Acta 50:147-152. |
| 13. |
Palosaari, N. R., and P. Rogers.
1988.
Purification and properties of inducible coenzyme A-linked butyraldehyde dehydrogenase from Clostridium acetobutylicum.
J. Bacteriol.
170:2971-2976 |
| 14. |
Priefert, H.,
S. Hein,
N. Krüger,
K. Zeh,
B. Schmidt, and A. Steinbüchel.
1991.
Identification and molecular characterization of the Alcaligenes eutrophus H16 aco operon genes involved in acetoin catabolism.
J. Bacteriol.
173:4056-4071 |
| 15. |
Priefert, H.,
N. Krüger,
D. Jendrossek,
B. Schmidt, and A. Steinbüchel.
1992.
Identification and molecular characterization of the gene coding for acetaldehyde dehydrogenase II (acoD) of Alcaligenes eutrophus.
J. Bacteriol.
174:899-907 |
| 16. |
Reusch, R. N., and H. L. Sadoff.
1979.
5-n-Alkylresorcinols from encysting Azotobacter vinelandii: isolation and characterization.
J. Bacteriol.
139:448-453 |
| 17. |
Reusch, R. N., and H. L. Sadoff.
1981.
Lipid metabolism during encystment of Azotobacter vinelandii.
J. Bacteriol.
145:889-895 |
| 18. | Reusch, R. N., and H. L. Sadoff. 1983. Novel lipid components of the Azotobacter vinelandii cyst membrane. Nature 302:268-270[CrossRef][Medline]. |
| 19. |
Sadoff, H. L.,
E. Berke, and B. Loperfido.
1971.
Physiological studies of encystment in Azotobacter vinelandii.
J. Bacteriol.
105:185-189 |
| 20. |
Sadoff, H. L.
1975.
Encystment and germination in Azotobacter vinelandii.
Bacteriol. Rev.
39:516-539 |
| 21. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 22. |
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467 |
| 23. | Schobert, M., and H. Görisch. 1999. Cytochrome c550 is an essential component of the quinoprotein ethanol oxidation system in Pseudomonas aeruginosa: cloning and sequencing of the genes encoding cytochrome c550 and adjacent acetaldehyde dehydrogenase. Microbiology 145:471-481[Abstract]. |
| 24. | Stover, C. K., X. Q. Pham, A. L. Erwin, S. D. Mizoguchi, P. Warrener, M. J. Hickey, F. S. L. Brinkman, W. O. Hufnagle, D. J. Kowalik, M. Lagrou, R. L. Garber, L. Goltry, E. Tolentino, S. Westbrook-Wadman, Y. Yuan, L. L. Brody, S. N. Coulter, K. R. Folger, A. Kas, K. Larbig, R. M. Lim, K. A. Smith, D. H. Spencer, G. K. S. Wong, Z. Wu, I. T. Paulsen, J. Reizer, M. H. Saier, R. E. W. Hancock, S. Lory, and M. V. Olson. 2000. Complete genome sequence of Pseudomonas aeruginosa PA01, an opportunistic pathogen. Nature 406:959-964[CrossRef][Medline]. |
| 25. | Studholme, D. J., and M. Buck. 2000. The biology of enhancer-dependent transcriptional regulation in bacteria: insights from genome sequences. FEMS Microbiol. Lett. 186:1-9[CrossRef][Medline]. |
| 26. | Toukdarian, A., and C. Kennedy. 1986. Regulation of nitrogen metabolism in Azotobacter vinelandii: isolation of ntr and glnA genes and construction of ntr mutants. EMBO J. 5:399-407[Medline]. |
| 27. |
Wyss, O.,
M. G. Newmann, and M. D. Sokolofsky.
1961.
Development and germination of the Azotobacter cyst.
J. Biophys. Biochem. Cytol.
10:555-565 |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Appl. Environ. Microbiol. | Infect. Immun. | Eukaryot. Cell |
|---|---|---|
| Mol. Cell. Biol. | J. Virol. | Microbiol. Mol. Biol. Rev. |
| ALL ASM JOURNALS |