Previous Article | Next Article 
Journal of Bacteriology, November 2001, p. 6384-6393, Vol. 183, No. 21
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.21.6384-6393.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Conditional-Replication, Integration, Excision, and
Retrieval Plasmid-Host Systems for Gene Structure-Function Studies
of Bacteria
Andreas
Haldimann
and
Barry L.
Wanner*
Department of Biological Sciences, Purdue
University, West Lafayette, Indiana 47907
Received 15 June 2001/Accepted 18 August 2001
 |
ABSTRACT |
We have developed a series of powerful and versatile
conditional-replication, integration, and modular (CRIM) plasmids. CRIM plasmids can be replicated at medium or high copy numbers in different hosts for making gene (or mutant) libraries. They can be integrated in
single copies into the chromosomes of Escherichia coli
and related bacteria to study gene function under normal physiological conditions. They can be excised from the chromosome, e.g., to verify
that phenotypes are caused by their presence. Furthermore, they can be
retrieved singly or en masse for subsequent molecular analyses. CRIM
plasmids are integrated into the chromosome by site-specific
recombination at one of five different phage attachment sites.
Integrants are selected as antibiotic-resistant transformations. Since
CRIM plasmids encode different forms of resistance, several can be used
together in the same cell for stable expression of complex metabolic or
regulatory pathways from diverse sources. Following integration,
integrants are stably maintained in the absence of antibiotic
selection. Each CRIM plasmid has a polylinker or one of several
promoters for ectopic expression of the inserted DNA. Their modular
design allows easy construction of new variants with different
combinations of features. We also report a series of easily curable,
low-copy-number helper plasmids encoding all the requisite Int proteins
alone or with the respective Xis protein. These helper plasmids
facilitate integration, excision ("curing"), or retrieval of the
CRIM plasmids.
 |
INTRODUCTION |
Multicopy plasmids have
greatly facilitated gene structure-function studies. However, the use
of such plasmids can lead to high-copy-number artifacts, especially in
physiological studies. Thus, several methods have been developed for
recombining genes on bacterial chromosomes in order to study their
functions in single copies. Such methods are frequently used to
construct novel Escherichia coli strains that stably express
foreign genes for use in both basic research and biotechnology
(5, 18, 27). However, the development of strains encoding
complex metabolic or regulatory pathways poses special problems that
often require manipulating many genes and expressing them individually
at different levels or under separate regulatory controls. To address
these concerns, we have developed a series of plasmid-host systems for the introduction of multiple genes into the same cell in single copies.
Our approach is based on genome targeting systems that utilize
plasmids carrying a conditional-replication origin and a phage
attachment (attP) site (17). We refer to our
plasmids as CRIM (conditional-replication, integration, and modular)
plasmids. CRIM plasmids can be integrated into or retrieved from their
bacterial attachment (attB) site by supplying phage
integrase (Int) without or with excisionase (Xis) in trans.
Advantages of our CRIM plasmid-host systems include the use of
alternative attP and attB sites (for phages
,
HK022,
80, P21, and P22) and different selectable markers (for
chloramphenicol, gentamicin, kanamycin, spectinomycin and streptomycin,
tetracycline, and trimethoprim resistance) in conjunction with a
polylinker or promoter (ParaB,
PrhaB, PrhaS,
Ptac, Psyn1,
and Psyn4) for ectopic expression of the
cloned gene(s). These CRIM plasmids have the
replication origin of
R6K, which requires the trans-acting
protein (encoded by
pir) for replication. So, they replicate at a medium (15 per
cell) or high (250 per cell) plasmid copy number in
pir+ or pir-116
(high-copy-number mutant) E. coli hosts (28),
respectively. Int helper plasmids are used for integration of CRIM
plasmids into the corresponding chromosomal attB sites of
normal (non-pir) hosts, which are nonpermissive for CRIM
plasmid replication. Xis/Int helper plasmids are used for excision
("curing") of the respective CRIM plasmids from the chromosome,
e.g., to verify that phenotypes are due to their presence. Xis/Int
helper plasmids are also used for retrieval (cloning) of CRIM plasmids
from the chromosome, e.g., to recover a particular CRIM plasmid after
screening of CRIM plasmid or mutant libraries.
Since integration and retrieval involve phage-site-specific
recombination events, the original and recovered plasmids are identical. CRIM plasmids can therefore be used for the construction of
gene (or mutant) libraries that can be directly integrated into
bacterial chromosomes in single copies for screening or selection purposes. Afterwards, CRIM plasmids can be retrieved from individual cells or en masse. The recovered plasmids can then be propagated as
plasmids for molecular analysis or integrated directly into the
chromosomes of other hosts for subsequent processing without further in
vitro manipulation steps. We previously found similar oriR
att
plasmids to be extremely useful in mutagenesis studies, especially when
it was important that the mutated gene be free of plasmid copy number
effects (16). We also found them to be useful in studying
genes from diverse bacteria, including gram-negative and -positive
cells (14, 15, 25, 34). Our versatile CRIM plasmid-host
systems should be widely useful in gene structure-function studies.
Here we describe our basic set of CRIM plasmids, the requisite helper
plasmids, and how to use them.
 |
MATERIALS AND METHODS |
Media and culture conditions.
Luria-Bertani (LB) broth
(without glucose), tryptone-yeast extract agar (pH 7.0), and glucose
M63 agar were used as complex and minimal media (38). SOB
and SOC were prepared as described elsewhere (30). To
maintain plasmids, antibiotics (from Sigma, St. Louis, Mo.) were added
as follows: ampicillin at 100 µg/ml, chloramphenicol at 25 µg/ml,
gentamicin at 15 µg/ml, kanamycin at 50 µg/ml, spectinomycin and
streptomycin (together) at 100 µg/ml, trimethoprim at 300 µg/ml, or
tetracycline at 12.5 µg/ml. Single-copy integrants were selected
using chloramphenicol at 6 µg/ml, gentamicin at 5 µg/ml, kanamycin
at 10 µg/ml, spectinomycin and streptomycin (together) at 35 µg/ml,
trimethoprim at 25 µg/ml, or tetracycline at 8 µg/ml. We found that
proper medium pH is especially important for selection of
gentamicin-resistant (Gmr) integrants. Complex
media (tryptone-yeast extract agar) were used for selection of all
forms of resistance except trimethoprim resistance, for which minimal
media were used. Following primary selection, integrants were routinely
maintained in the absence of antibiotics.
Bacteria.
All strains are derivatives of E. coli
K-12. Normal (self-replicating) plasmids were propagated in
DH5
(12), BW5328, or BW25141. Strains from this
laboratory are fully described Table 1.
The DE(araBAD)567 and
DE(rhaBAD)568 mutations correspond to the
araBADAH33 and
rhaBADLD78 alleles (14),
respectively. The adjacent rrnB3
lacZ4787
mutations were previously called rrnBT14
lacZWJ16 (14). The
endA9 allele corresponds to the
endA8::tetAR mutation (from BT333
[9]) after Flp-mediated excision of tetAR
with pCP20 (9). The recD1014 mutation
originated from V355 (from G. C. Walker [33]). The
attP22(EcoB) allele refers to the
attP22 site of E. coli B, which
had been introduced into BW25368
(proA::Tn10) by using P1kc
grown on NC3 (E. coli B/r hsdR, also called
BW9688 [39]) by selecting proline-independent transductants to make BW25676. Our standard wild-type E. coli K-12 strain is BD792 (36), which is a direct
F
descendant of W1485 (2). The
rph-1 allele refers to the rph frameshift mutation (19), which is also present in
E. coli BD792 (data not shown). Strain BD792, like both its
parent, W1485, and wild-type E. coli K-12 EMG2
(20), carries the rpoS396(Am) allele (data not
shown). Several strains were therefore made
rpoS+. This was done in two steps. A strain
was first made tetracycline resistant (Tcr) and
kanamycin resistant (Kmr) by using
P1kc grown on ZK1001
(cysC95::Tn10
rpoS::kan; from R. Kolter). A resultant
Cys
transductant was then made cysteine
independent and kanamycin sensitive by using P1kc grown on
MG1655. E. coli K-12 strains BW25113, BW25141, BW25142, and
BW25695 are descendants of BD792 derivatives that were made
rpoS+.
CRIM (
oriR
) plasmids were propagated at
a medium copy number in BW23473, BW24249, or BW25141 or at a high copy
number
in BW23474, BW24304, or BW25142. As standard wild-type hosts,
we
used BW25113 and BW25695 [like BW25113, except with
attP22(EcoB)].
CRIM plasmids were
retrieved from integrants of BW24320 by using
helper plasmid
transformants of BW23473 (
pir+
recA) or BW25141 (
pir+
recA) when we used P1
kc transduction (P1-Int-Xis
[PIX] cloning
[
16]) or helper plasmid transformants of
BW23838 (
pir+ recD) when we used
transformation (see below). Strain BW37 was
used as the recipient for
selection of Ilv
+ transductants when we
determined the Ilv
+ transducing titers of
P1
kc lysates.
Molecular biology methods.
PCR fragments for cloning were
generated by using Vent (New England Biolabs, Beverly, Mass.) or
Pfu DNA polymerase (Stratagene, La Jolla, Calif.) and
oligonucleotide primers (from IDT Inc., Coralville, Iowa). Other
enzymes were from New England Biolabs or Promega (Madison, Wis.).
Qiagen (Hilden, Germany) products were used for the isolation of
plasmid DNA, extraction of DNA fragments from agarose gels, and
purification of PCR fragments.
Plasmids.
CRIM (Fig. 1) and
CRIM helper plasmids (Fig.
2; Table 2) were assembled by standard
techniques. pLA2 was constructed by L. Avramova and B. L. Wanner (unpublished). Various fragments were subcloned directly or cloned as PCR-generated fragments containing restriction site extensions (Table 3).
The bla, cat, kan, tet, and
oriR
segments were from pANTS
,
pCANTS
, pKANTS
, and pTANTS
(32) (from M. Koob);
the att
(with a destroyed NdeI site) and
lacIq-Ptac
segments were from pCANTS
NdeI and
pCANTS
lacIqSLP
(26) (both from A. S. Lynch); the
lacZ cassette in pAH125 was from pCS3 (29); the
promoterless uidAf (the uidA2 fusion in
pSK49
::uidA2) cassette was from pWM3
(29); the ParaB fragment in
pAH150 was from pAH31 (14); and
PrhaB in pAH120 was from pLD78
(14). The lacZ gene in pLA2 was constructed in
a series of steps that involved introducing an NdeI site
overlapping its Met start codon and eliminating a native
NdeI site; the lacZ gene was generated using pOD
(31) as the template, so it has a mutated lacO2
region; and the ParaB fragment in pLA2 was
generated as a PCR fragment (Table 3). Our initial CRIM plasmid pAH55
is a derivative of pKANTS
in which we introduced a mutated
att
segment (lacking its native
NdeI site), lacIq, and
uidAf segments in sequential steps. The CRIM helper plasmids were assembled using pINT-ts (17) as the backbone. PCR
fragments were generated by using as templates pHH7013 and pHH7009
(from J. C. Hu) for Psyn1 and
Psyn4; a derivative of pLD78
(14) called pLD81 (from L. Daniels) for
PrhaS; p34E-Tp (11) (from
D. E. Woods) for dhfr; pBBR1MCS-5 (22)
(from M. Kovach) for gen;
(from R. Somerville) for
xis
; pBAD33 (13) (from
L.-M. Guzman) and pBS1attP6-1
(6) (from A. Campbell) for
attP21, xisP21, and intP21; pEY109 (42) (from
E. Yagil) for attHK022,
xisHK022, and
intHK022; pJL10 and pJL110
(23) (from A. Landy) for
att
80, xis
80,
int
80, and
attP22; and P22 (from S. Maloy) for
xisP22 and
intP22.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 1.
Structures of CRIM plasmid series. Gene
designations include aadA (aminoglycoside
adenyltransferase for spectinomycin and streptomycin resistance),
bla ( -lactamase for ampicillin resistance),
cat (chloramphenicol acetyltransferase),
dhfr (dihydrofolate reductase for trimethoprim
resistance), gen (gentamicin-3-acetyltransferase for
gentamicin resistance), kan (aminoglycoside
3'-phosphotransferase for kanamycin resistance),
pstS* (a mutant pstS,
Pi-specific binding protein), tetA
(tetracycline resistance), and uidAf (the
uidA2 fusion in pSK49 ::uidA2
[16]). The multiple cloning site (MCS) is from pUC18
(44). Unique sites within the MCS of pAH68 include, from
left to right, SphI, PstI,
SalI, XbaI, BamHI,
SmaI, KpnI, SacI, and
EcoRI. All sites are illustrated for the enzymes shown.
Sites destroyed during construction are marked with an asterisk.
Modules are flanked by SphI, EcoRI
(BamHI or NdeI), NheI,
NcoI, NotI, and ClaI
(and/or BsaI) sites. Plasmids with aadA,
bla, or gen facilitate certain
constructions as they have a unique NcoI site. Due to
the manner in which these plasmids were constructed, the
ParaB region of pAH150, but not of
pLA2, encodes an N-terminal portion of AraC as a fusion protein. As a
consequence, ParaB is expressed at a
normal level in pLA2 but at a much reduced level in pAH150 (see the
text). All attP sites were designed taking into account
information on important DNA binding sites and structure (23, 35,
43). Accordingly, the attP21 sequence
encodes the C terminus of icd and the
attP22 sequence includes sequences for the
thrW tRNA gene (6). Unexpectedly, we found
that CRIM plasmids carrying attP22s or
att 80s (Table 3) failed to integrate or
gave very few integrants, respectively, suggesting that additional
att sequences are required (data not shown). Plasmids
carrying a longer att 80 site (such as
pAH153 and pAH162) integrated efficiently, while those carrying the
longer attP22 site (such as pAH154)
integrated less frequently than others (see the text). Primers
routinely used to verify cloned inserts by PCR or DNA sequencing
include rgnB-f (TTGTCGGTGAACGCTCTCCT), ParaB-f
(CACATTGATTATTTGCACGG), PrhaB-f
(CGTTCATCTTTCCCTGGT), and tL3-r
(AGGATGCGTCATCGCCATTA). Priming sites rgnB-f and tL3 are
common to all CRIM plasmids and are useful for sequencing inserts in
all CRIM plasmids, except those containing
lacIq, in which only tL3-r remains useful.
|
|

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 2.
CRIM helper plasmid. All helper plasmids express
int alone or with xis from
pR under cI857 control,
which is also borne by these plasmids, and are temperature sensitive
for plasmid replication. As described in Materials and Methods, all are
derivatives of pINT-ts, whose complete DNA sequence we determined in
this study. With one exception, the
xis-int plasmids express these genes in
the same orientation as that found naturally. The construction
of pAH129 resulted in placing xis 80
upstream of int 80 to create an
xis-int 80 operon (data not
shown). We also deliberately destroyed the native BamHI
site in int during the construction of
pAH57 by introducing a silent mutation with the
xis -5' primer (Table 2). Pr, phage promoter.
|
|
CRIM plasmid integration.
Cells carrying a CRIM helper
plasmid were grown in 5 ml of SOB cultures with ampicillin at 30°C to
an optical density of 600 nm of ca. 0.6 and then made electrocompetent.
Following electroporation, cells were suspended in SOC without
ampicillin, incubated at 37°C for 1 h and at 42°C for 30 min,
and then spread onto selective agar and incubated at 37°C. Colonies
were purified once nonselectively and then tested for antibiotic
resistance for stable integration and loss of the helper plasmid and by
PCR for copy number (see below).
CRIM plasmid excision.
Cells were transformed with the
respective Xis/Int CRIM helper plasmid and then spread on ampicillin
agar media at 30°C. Colonies were purified once or twice
nonselectively on plates that were incubated for 1 h at 42°C and
overnight at 37°C. They were then tested for antibiotic sensitivities
and by PCR for loss of the integrated plasmid.
CRIM plasmid retrieval.
P1kc lysates were made on
integrants by using standard procedures. Recipient cells carrying the
corresponding Xis/Int CRIM helper plasmid were grown in LB agar with
ampicillin at 30°C to early stationary phase and then infected with a
P1kc lysate. Following phage absorption, centrifugation, and
resuspension as described elsewhere (38), the infected
cells were incubated for 1 h at 37°C, 30 min at 42°C, and an
additional hour at 37°C and then spread onto selective media (without
ampicillin) for the CRIM plasmid and incubated at 37°C. To recover
plasmids by transformation, chromosomal DNAs were isolated from
integrants and subjected to shearing by sonication or DNase I digestion
in the presence of divalent manganese (1). Recipient cells
carrying a helper plasmid were grown in 5-ml SOB cultures with
ampicillin at 30°C to an optical density at 600 nm of ca. 0.6 and
then made electrocompetent. Following electroporation, cells were
suspended in SOC without ampicillin, incubated at 37°C for 1 h
and at 42°C for 30 min, and then spread onto selective agar and
incubated at 37°C.
PCR verification of integrant copy number.
Isolated colonies
were picked up with a plastic tip and suspended in 20 µl of water.
Five microliters of the cell suspension, 10 pmol of each primer (P1 to
P4 together), and 0.5 U of Taq DNA polymerase (New England
Biolabs) were combined in 1× PCR buffer-2.5 mM
MgCl2 with deoxynucleoside triphosphates in a
final volume of 25 µl. PCR was carried out for 25 cycles with
denaturing for 1 min at 94°C, annealing for 1 min (Table
4), and extension for 1 min at 72°C.
DNA sequencing.
The DNA sequences of all CRIM and CRIM
helper plasmids were deduced in their entirety by verifying the
sequences of all modules used in their constructions. PCR-amplified
segments were verified by automated DNA sequencing of both strands
after initial cloning. Many were initially cloned into
SmaI-digested pSPORT1 (from Gibco BRL, Gaithersburg, Md.) or
EcoRI- and NcoI-digested pLITMUS29 (from New
England Biolabs). Others were cloned directly into a CRIM plasmid and
then sequenced. Several additional regions were also sequenced to
permit generation of detailed maps of all CRIM and CRIM helper plasmids.
Nucleotide sequence accession numbers.
GenBank accession
numbers for the CRIM plasmids are AY048713 (pAH55), AY048714 (pAH56),
AY048716 (pAH63), AY048717 (pAH68), AY048719 (pAH70), AY048720 (pAH81),
AY048722 (pAH95), AY048723 (pAH120), AY054372 (pAH125), AY048730 (pAH143), AY048731 (pAH144), AY048732 (pAH145), AY048733 (pAH150),
AY048734 (pAH152), AY048735 (pAH153), AY048736 (pAH154), AY048737
(pAH156), AY048738 (pAH162), AY048739 (pCAH56), AY048740 (pCAH63), and
AY054373 (pLA2). GenBank accession numbers for the CRIM helper plasmids
are AY048715 (pAH57), AY048718 (pAH69), AY048720 (pAH83), AY048724 (pAH121), AY048725 (pAH122), AY048726 (pAH123), AY048727 (pAH129),
AY048728 (pAH130), AY048729 (pAH131), and AY048741 (pINT-ts).
 |
RESULTS AND DISCUSSION |
General description.
Our basic CRIM plasmids are shown in Fig.
1. Each has four general regions in common: a polylinker or a cloning
region consisting of a promoter for ectopic expression with or without
a regulatory gene, a phage attachment (attP) site, a
conditional-replication origin (oriR
),
and a selectable marker. Several already contain an E. coli
gene (lacZ, phoB, phoR,
pstS, or uidAf) within the cloning region;
however, these genes act solely as replaceable ("stuffer")
fragments in new constructions. In addition, all CRIM plasmids have
bacterial (rgnB) and phage
(t0, tL3) terminators flanking their cloning region to protect other segments from
transcriptional readthrough. The CRIM plasmids were designed so that
standard cloning methods can be used for making new ones with various
combinations of these and other features, as necessary.
CRIM plasmid integration.
CRIM plasmids can be simply
integrated into the chromosome by direct transformation of normal
(non-pir) hosts carrying a CRIM helper plasmid synthesizing
the respective Int (Fig. 2; Table 2). Int synthesis from the helper
plasmids is induced at elevated temperatures. Since the helper plasmids
are also temperature sensitive for replication (see Materials and
Methods), the resulting transformants are nearly always simultaneously
cured of the helper plasmid. Upon integration at the respective
attB site, all CRIM plasmids lie in the same relative
orientation on the E. coli chromosome (Fig.
3). Therefore, even though they have
sequences in common (tL3, oriR
, and
rgnB), homologous recombination among them does not lead to
instability because essential chromosomal genes lie between these
attB sites. Due to the high efficiency of site-specific recombination, these homologies also do not interfere with integrating multiple CRIM plasmids at different attB sites in the same
strain.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 3.
Locations of chromosomal attB sites.
Wild-type E. coli K-12 contains the prophage element e14
adjacent (clockwise) to attP21
(6). Sites are based on the linkage map (3)
and the positions of the appropriate attB core sequences
(for att , gCTTttTtatActAA; for
attHK022, CTTTaggtgaa; for
attP21, tGCtGCgcCATAT; for
attP22, ATTcgtAATGcGAAG; for
att 80, AACAcTTTcttAAAt; lowercase letters
indicate bases that differ from the consensus
[6]), in the E. coli K-12 genome sequence
(4). E. coli K-12 has two
attP22 sites separated by ca. 34 kb (at
nucleotides 262125 and 296433 of the genome), which is consistent with
their being separated by an uncharacterized phage. Furthermore, by
using PCR and P22(EcoB) primers (Table 2), we have shown that the
intervening sequences is absent from E. coli B, so it
lacks this phage (data not shown).
|
|
To test for single-copy integration, we routinely use a single PCR with
four primers (P1, P2, P3, and P4 in Fig.
4A; see Materials
and Methods).
Single-copy integrants are revealed as integrants
that have lost the
fragment corresponding to the respective
attB site (the P1
to P4 fragment) and simultaneously gained two new
fragments that are
characteristic of the
attL (BOP'; the P1-to-P2
fragment) and
attR (POB'; the P3-to-P4 fragment) junctions. Recombinants
with two (or more) CRIM plasmids at the
attB site are also
easily
distinguishable. Such multiple integrants also gain a third
fragment
characteristic of the
attP site of the integrating
plasmid (the
P2-to-P3 fragment). Recombinants resulting from
integration elsewhere
on the chromosome yield instead PCR products for
both the
attB (the P1-to-P4 fragment) and
attP
(the P2-to-P3 fragment) sites,
provided that such integration occurs
via homologous recombination
or otherwise outside the
attP
region. Based on these criteria,
we have shown that integration occurs
primarily at the respective
attB site and always requires
the corresponding Int. The most
common undesirable events are the
occurrence of multiple-copy
integrants; however, these integrants
seldom represent more than
a few percentages of the
antibiotic-resistant transformants. With
one exception, this is true
for all CRIM plasmids (data not shown).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 4.
Integration (A), excision (B), and retrieval (C) of CRIM
plasmids from attHK022. POP' and BOB'
are sites for phage site-specific recombination according to the
Campbell model (7, 41). P1, P2, P3, and P4 are priming
sites used in PCR tests (see Materials and Methods).
|
|
The exception concerns the
attP22 CRIM
plasmids. These plasmids differ in two ways. First, the
attP22 plasmids integrate ca.
100-fold less
efficiently than the others. Second, one-half or
more of the resulting
attP22 plasmid integrants are often
incorrect
and appear to occur via recombination events that do not
involve
the
attP22 site. Since wild-type
E. coli K-12 apparently has an
uncharacterized prophage
occupying the chromosomal
attP22 site
(unpublished results), we considered the possibility that this
prophage
interferes with site-specific integration at this site.
However, we
obtained similar results with an otherwise isogenic
host lacking this
prophage, suggesting that an additional factor
or sequence is required
for efficient
attP22 recombination.
Nevertheless,
attP22 CRIM plasmids have
still been quite useful for constructing
strains that have multiple
CRIM plasmids. In these cases, we have
usually integrated
attP22 CRIM plasmids before integrating
others
to prevent the
attP22 plasmid from
recombining with others via
homologous recombination, which can also
occur at low frequency.
The
attP22 CRIM
plasmids are therefore less valuable as vectors
for library
construction or other uses requiring high integration
efficiency.
CRIM plasmid excision.
Integrated CRIM plasmids can also be
excised very efficiently. CRIM plasmid excision is carried out by using
CRIM helper plasmids encoding both Xis and Int (Fig. 4B). We found that
all CRIM plasmids were easily eliminated from a specific
attP site when using the respective Xis/Int helper plasmid
but not when using an Xis/Int helper plasmid for a different
attP site. In most cases, 100% of the transformants were
cured of the respective CRIM plasmid after a single colony
purification step (see Materials and Methods). No aberrant
(nonspecific) excision events were detected when we used cells
containing multiple CRIM plasmids integrated at different sites (data
not shown). We have used excision as a simple way to verify that novel
phenotypes result from the presence of particular CRIM plasmids. We
have also found excision to be useful in certain strain constructions.
For example, when studying complex metabolic or regulatory pathways, it
has often been necessary to make strains containing multiple CRIM
plasmids in various combinations. In such cases, it has occasionally
been more convenient to excise a single CRIM plasmid from a strain
containing a combination of different CRIM plasmids in order to
introduce an alternative one than to construct an entirely new strain
containing most of the same CRIM plasmids by integrating each individually.
CRIM plasmid retrieval.
The ease of retrieving CRIM plasmids
from the chromosome is an especially valuable attribute. Because Xis
and Int catalyze the excision and circularization of molecules from the
corresponding att sites, CRIM plasmids can be retrieved
simply by introducing chromosomal DNAs from an integrant into
permissive (pir+) hosts that
synthesize Xis and Int from a helper plasmid. We have usually
done this by using the generalized transducing phage P1kc in
a process that we have called PIX cloning (Fig. 4C) (16).
PIX cloning is done using recipients that are
pir+ for replication of the CRIM plasmids
and
recA to avoid homologous-recombination
events and carry
the appropriate Xis/Int CRIM helper plasmid.
We measured PIX cloning
efficiencies by determining the number
of antibiotic-resistant
transductants per infectious phage in
standard phage P1 crosses (Table
5). We assayed the transducing
titer of
the same P1
kc lysates by determining the number of
Ilv
+ transductants. As shown in Table
5, PIX
cloning is an extremely
efficient process. Efficient retrieval occurs
only in the presence
of the proper CRIM helper plasmid (data not
shown). The recovered
plasmids have always been correct, based on
restriction enzyme
analysis of plasmid DNAs isolated from several
representative
transductants in numerous such crosses. We have also
used PIX
cloning to recover plasmids for direct DNA sequence analysis
(
16;
unpublished results). In addition, we have shown that
CRIM plasmids
can be recovered following transformation of a
recD
pir+ host carrying the appropriate helper
plasmids with chromosomal
DNA (Materials and Methods). Accordingly,
CRIM plasmids are also
retrievable from bacteria that are insensitive
to phage P1
kc.
Using CRIM plasmids.
Although CRIM plasmids can be used with
most ordinary (non-pir) E. coli strains, we have
made standard hosts for their use. These hosts have defined deletions
of araBAD, rhaBAD, and lacZ and are
lacIq. Hence, they cannot catabolize
arabinose or rhamnose and yet encode the regulatory proteins (AraC,
RhaR, and RhaS) required for ectopic expression of foreign genes from
the corresponding promoters (ParaB,
PrhaB, and
PrhaS, also called
PBAD or araBp, PrhaB, and
PrhaS, respectively). These hosts provide tight regulation of these and LacI-controlled promoters. They can also be used with
lacZ fusions generated using our standard CRIM
lacZ transcriptional fusion vector pAH125 (Fig.
5). Expression levels of
ParaB in pLA2, PrhaB in pAH120, and
PrhaS in pAH152 were similar to those
reported elsewhere (14). We have also shown elsewhere that
PrhaB is an especially tightly regulated
promoter (14). The synthetic
(Psyn1 and
Psyn4) promoters provide for low-level
unregulated gene expression. These promoters are juxtaposed to a
ribosome binding site and AUG start codon that is contained within an
NdeI site for convenient construction purposes. With the
exception of plasmids carrying attP21, the
NdeI site is unique (14).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 5.
CRIM reporter plasmid for construction of
lacZ transcriptional fusions. Primer sites routinely
used to sequence inserts are indicated as "up"
(TTGTCGGTGAACGCTCTCCT, same as rgnB-f in Fig. 1) and
"dn" (down) (AAGTTGGGTAACGCCAGG).
|
|
Unexpectedly, we have recently found that
ParaB expression is much lower in pAH150
than in pLA2, which shows a normal level
of expression
(
14; L. Avramova and B. L. Wanner, unpublished).
Lower expression in pAH150 results from interference by an N-terminal
AraC' fusion protein that is encoded by the
ParaB segment in pAH150
but not in pLA2.
Nevertheless, both of these
ParaB CRIM
plasmids
have been useful as they both show arabinose-regulated
promoter
expression. pAH150 has been especially useful for conditional
expression of regulatory genes, such as
phoB, requiring
low-level
expression, while pLA2 has been more useful for expression of
structural genes requiring high-level expression. Elsewhere, we
have
recently described
E. coli hosts that show homogeneous
expression
of genes under
ParaB control
which constitutively synthesize the
low-affinity AraE transporter from
the chromosome (
21).
We have also shown that
attP22 and
att
CRIM plasmids integrate into the
appropriate
attB sites of
Salmonella enterica serovar Typhimurium. Others were not tested. Since phages tend
to
exploit highly conserved and sometimes essential genes (e.g.,
tRNA
genes) as sites for integration (
8), several CRIM plasmids
can probably integrate into chromosomes of other bacteria, especially
in other members of the family
Enterobacteriaceae and
related
families. CRIM plasmids should therefore be useful in many
applications
involving bacteria other than common laboratory
strains.
 |
ACKNOWLEDGMENTS |
We thank M. Koob and A. S. Lynch for communicating
unpublished results, individuals cited in the text for providing
strains and plasmids, Jill Hutchcroft for reading the manuscript, and lab members for helpful discussions. We also thank Cynthia Walchle for
technical assistance while B.L.W. was on sabbatical leave with J. J. Mekalanos at Harvard Medical School.
Research was supported by NSF award DMB9108005 to B.L.W., NIH award
AI8045 to J. J. Mekalanos, and NIH senior fellowship F33AI10093 to
B.L.W.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biological Sciences, Purdue University, West Lafayette, IN 47907. Phone: (765) 494-8034. Fax: (765) 494-0876. E-mail:
BLW{at}bilbo.bio.purdue.edu.
Present address: ARPIDA, 4142 Münchenstein, Switzerland.
 |
REFERENCES |
| 1.
|
Anderson, S.
1981.
Shotgun DNA sequencing using cloned DNase I-generated fragments.
Nucleic Acids Res.
9:3015-3027[Abstract/Free Full Text].
|
| 2.
|
Bachmann, B. J.
1996.
Derivations and genotypes of some mutant derivatives of Escherichia coli K-12, p. 2460-2488.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. ASM Press, Washington, D.C.
|
| 3.
|
Berlyn, M. K. B.
1998.
Linkage map of Escherichia coli K-12: edition 10. The traditional map.
Microbiol. Mol. Biol. Rev.
62:814-984[Abstract/Free Full Text].
|
| 4.
|
Blattner, F. R.,
G. Plunkett III,
C. A. Bloch,
N. T. Perna,
V. Burland,
M. Riley,
J. Collado-Vides,
J. D. Glasner,
C. K. Rode,
G. F. Mayhew,
J. Gregor,
N. W. Davis,
H. A. Kirkpatrick,
M. A. Goeden,
D. J. Rose,
B. Mau, and Y. Shao.
1997.
The complete genome sequence of Escherichia coli K-12.
Science
277:1453-1462[Abstract/Free Full Text].
|
| 5.
|
Boyd, D.,
D. S. Weiss,
J. C. Chen, and J. Beckwith.
2000.
Towards single-copy gene expression systems making gene cloning physiologically relevant: lambda InCh, a simple Escherichia coli plasmid-chromosome shuttle system.
J. Bacteriol.
182:842-847[Abstract/Free Full Text].
|
| 6.
|
Campbell, A.,
S. J. Schneider, and B. Song.
1992.
Lambdoid phages as elements of bacterial genomes (integrase/phage21/Escherichia coli K-12/icd gene).
Genetica
86:259-267[CrossRef][Medline].
|
| 7.
|
Campbell, A. M.
1962.
Episomes
Adv. Genet.
11:101-145.
|
| 8.
|
Campbell, A. M.
1992.
Chromosomal insertion sites for phages and plasmids.
J. Bacteriol.
174:7495-7499[Free Full Text].
|
| 9.
|
Cherepanov, P. P., and W. Wackernagel.
1995.
Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant.
Gene
158:9-14[CrossRef][Medline].
|
| 10.
|
Datsenko, K. A., and B. L. Wanner.
2000.
One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.
Proc. Natl. Acad. Sci. USA
97:6640-6645[Abstract/Free Full Text].
|
| 11.
|
DeShazer, D., and D. E. Woods.
1996.
Broad-host-range cloning and cassette vectors based on the R388 trimethoprim resistance gene.
BioTechniques
20:762-764[Medline].
|
| 12.
|
Fisher, S. L.,
W. Jiang,
B. L. Wanner, and C. T. Walsh.
1995.
Cross-talk between the histidine protein kinase VanS and the response regulator PhoB: characterization and identification of a VanS domain that inhibits activation of PhoB.
J. Biol. Chem.
270:23143-23149[Abstract/Free Full Text].
|
| 13.
|
Guzman, L.-M.,
D. Belin,
M. J. Carson, and J. Beckwith.
1995.
Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter.
J. Bacteriol.
177:4121-4130[Abstract/Free Full Text].
|
| 14.
|
Haldimann, A.,
L. L. Daniels, and B. L. Wanner.
1998.
Use of new methods for construction of tightly regulated arabinose and rhamnose promoter fusions in studies of the Escherichia coli phosphate regulon.
J. Bacteriol.
180:1277-1286[Abstract/Free Full Text].
|
| 15.
|
Haldimann, A.,
S. L. Fisher,
L. L. Daniels,
C. T. Walsh, and B. L. Wanner.
1997.
Transcriptional regulation of the Enterococcus faecium BM4147 vancomycin resistance gene cluster by the VanS-VanR two-component regulatory system in Escherichia coli.
J. Bacteriol.
179:5903-5913[Abstract/Free Full Text].
|
| 16.
|
Haldimann, A.,
M. K. Prahalad,
S. L. Fisher,
S.-K. Kim,
C. T. Walsh, and B. L. Wanner.
1996.
Altered recognition mutants of the response regulator PhoB: a new genetic strategy for studying protein-protein interactions.
Proc. Natl. Acad. Sci. USA
93:14361-14366[Abstract/Free Full Text].
|
| 17.
|
Hasan, N.,
M. Koob, and W. Szybalski.
1994.
Escherichia coli genome targeting, I. Cre-lox-mediated in vitro generation of ori plasmids and their in vivo chromosomal integration and retrieval.
Gene
150:51-56[CrossRef][Medline].
|
| 18.
|
Huang, L. C.,
E. A. Wood, and M. M. Cox.
1997.
Convenient and reversible site-specific targeting of exogenous DNA into a bacterial chromosome by use of the FLP recombinase: the FLIRT system.
J. Bacteriol.
179:6076-6083[Abstract/Free Full Text].
|
| 19.
|
Jensen, K. F.
1993.
The Escherichia coli K-12 "wild types" W3110 and MG1655 have an rph frameshift mutation that leads to pyrimidine starvation due to low pyrE expression levels.
J. Bacteriol.
175:3401-3407[Abstract/Free Full Text].
|
| 20.
|
Kaasen, I.,
P. Falkenberg,
O. B. Styrvold, and A. R. Strøm.
1992.
Molecular cloning and physical mapping of the otsBA genes, which encode the osmoregulatory trehalose pathway of Escherichia coli: evidence that transcription is activated by KatF (AppR).
J. Bacteriol.
174:889-898[Abstract/Free Full Text].
|
| 21.
| Khlebnikov, A., K. A. Datsenko, T. Skaug, B. L. Wanner, and J. D. Keasling. Homogeneous expression of the
PBAD promoter in Escherichia
coli by constitutive expression of the low-affinity high-capacity
AraE transporter. Microbiology, in press.
|
| 22.
|
Kovach, M. E.,
P. H. Elzer,
D. S. Hill,
G. T. Robertson,
M. A. Farris,
R. M. Roop II, and K. M. Peterson.
1995.
Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes.
Gene
166:175-176[CrossRef][Medline].
|
| 23.
|
Leong, J. M.,
S. Nunes-Düby,
C. F. Lesser,
P. Youderian,
M. M. Susskind, and A. Landy.
1985.
The 80 and P22 attachment sites. Primary structure and interaction with Escherichia coli integration host factor.
J. Biol. Chem.
260:4468-4477[Abstract/Free Full Text].
|
| 24.
|
Lessard, I. A. D.,
S. D. Pratt,
D. G. McCafferty,
D. E. Bussiere,
C. Hutchins,
B. L. Wanner,
L. Katz, and C. T. Walsh.
1998.
Homologs of the vancomycin resistance D-ala-D-ala dipeptidase VanX in Streptomyces toyocaensis, Escherichia coli, and Synechocystis: attributes of catalytic efficiency, stereoselectivity, and regulation with implications for function.
Chem. Biol.
5:489-504[CrossRef][Medline].
|
| 25.
|
Lu, F.,
M. A. Schumacher,
D. N. Arvidson,
A. Haldimann,
B. L. Wanner,
H. Zalkin, and R. G. Brennan.
1997.
Structure-based redesign of corepressor specificity of the Escherichia coli purine repressor by substitution of residue 190.
Biochemistry
37:971-982[CrossRef].
|
| 26.
|
Lynch, A. S., and J. C. Wang.
1994.
Use of an inducible site-specific recombinase to probe the structure of protein-DNA complexes involved in F plasmid partition in Escherichia coli.
J. Mol. Biol.
236:679-684[CrossRef][Medline].
|
| 27.
|
Martinez-Morales, F.,
A. C. Borges,
K. Martinez,
K. T. Shanmugam, and L. O. Ingram.
1999.
Chromosomal integration of heterologous DNA in Escherichia coli with precise removal of markers and replicons used during construction.
J. Bacteriol.
181:7143-7148[Abstract/Free Full Text].
|
| 28.
|
Metcalf, W. W.,
W. Jiang, and B. L. Wanner.
1994.
Use of the rep technique for allele replacement to construct new Escherichia coli hosts for maintenance of R6K origin plasmids at different copy numbers.
Gene
138:1-7[CrossRef][Medline].
|
| 29.
|
Metcalf, W. W., and B. L. Wanner.
1993.
Construction of new -glucuronidase cassettes for making transcriptional fusions and their use with new methods for allele replacement.
Gene
129:17-25[CrossRef][Medline].
|
| 30.
|
Miller, J. H.
1992.
A short course in bacterial genetics: a laboratory manual and handbook for Escherichia coli and related bacteria.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 31.
|
Müller, J.,
S. Oehler, and B. Müller-Hill.
1996.
Repression of lac promoter as a function of distance, phase and quality of an auxiliary lac operator.
J. Mol. Biol.
257:21-29[CrossRef][Medline].
|
| 32.
|
Pósfai, G.,
M. Koob,
Z. Hradecná,
N. Hasan,
M. Filutowicz, and W. Szybalski.
1994.
In vivo excision and amplification of large segments of the Escherichia coli genome.
Nucleic Acids Res.
22:2392-2398[Abstract/Free Full Text].
|
| 33.
|
Shevell, D. E.,
A. M. Abou-Zamzam,
B. Demple, and G. C. Walker.
1988.
Construction of an Escherichia coli K-12 ada deletion by gene replacement in a recD strain reveals a second methyltransferase that repairs alkylated DNA.
J. Bacteriol.
170:3294-3296[Abstract/Free Full Text].
|
| 34.
|
Silva, J. C.,
A. Haldimann,
M. K. Prahalad,
C. T. Walsh, and B. L. Wanner.
1998.
In vivo characterization of the type A and B vancomycin-resistant enterococci (VRE) VanRS two-component systems in Escherichia coli: a nonpathogenic model for studying the VRE signal transduction pathways.
Proc. Natl. Acad. Sci. USA
95:11951-11956[Abstract/Free Full Text].
|
| 35.
|
Wang, H.,
C. H. Yang,
G. Lee,
F. Chang,
H. Wilson,
A. Del Campillo-Campbell, and A. Campbell.
1997.
Integration specificities of two lambdoid phages (21 and e14) that insert at the same attB site.
J. Bacteriol.
179:5705-5711[Abstract/Free Full Text].
|
| 36.
|
Wanner, B. L.
1983.
Overlapping and separate controls on the phosphate regulon in Escherichia coli K-12.
J. Mol. Biol.
166:283-308[CrossRef][Medline].
|
| 37.
|
Wanner, B. L.
1987.
Molecular cloning of Mud(bla lacZ) transcriptional and translational fusions.
J. Bacteriol.
169:2026-2030[Abstract/Free Full Text].
|
| 38.
|
Wanner, B. L.
1994.
Gene expression in bacteria using TnphoA and TnphoA' elements to make and switch phoA gene, lacZ (op), and lacZ (pr) fusions.
Methods Mol. Genet.
3:291-310.
|
| 39.
|
Wanner, B. L., and J. A. Boline.
1990.
Mapping and molecular cloning of the phn (psiD) locus for phosphonate utilization in Escherichia coli.
J. Bacteriol.
172:1186-1196[Abstract/Free Full Text].
|
| 40.
|
Wanner, B. L., and R. McSharry.
1982.
Phosphate-controlled gene expression in Escherichia coli using Mud1-directed lacZ fusions.
J. Mol. Biol.
158:347-363[CrossRef][Medline].
|
| 41.
|
Weisberg, R. A., and A. Landy.
1983.
Site-specific recombination in phage lambda, p. 211-250.
In
R. W. Hendrix, J. W. Roberts, F. W. Stahl, and R. A. Weisberg (ed.), Lambda II. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 42.
|
Yagil, E., and S. Dolev.
1989.
Determinants of site-specific recombination in the lambdoid coliphage HK022. An evolutionary change in specificity.
J. Mol. Biol.
207:695-717[CrossRef][Medline].
|
| 43.
|
Yagil, E.,
L. Dorgai, and R. A. Weisberg.
1995.
Identifying determinants of recombination specificity: construction and characterization of chimeric bacteriophage integrases.
J. Mol. Biol.
252:163-177[CrossRef][Medline].
|
| 44.
|
Yanisch-Perron, C.,
J. Vieira, and J. Messing.
1985.
Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors.
Gene
33:103-119[CrossRef][Medline].
|
Journal of Bacteriology, November 2001, p. 6384-6393, Vol. 183, No. 21
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.21.6384-6393.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Uehara, T., Dinh, T., Bernhardt, T. G.
(2009). LytM-Domain Factors Are Required for Daughter Cell Separation and Rapid Ampicillin-Induced Lysis in Escherichia coli. J. Bacteriol.
191: 5094-5107
[Abstract]
[Full Text]
-
Arends, S. J. R., Kustusch, R. J., Weiss, D. S.
(2009). ATP-Binding Site Lesions in FtsE Impair Cell Division. J. Bacteriol.
191: 3772-3784
[Abstract]
[Full Text]
-
Saini, S., Pearl, J. A., Rao, C. V.
(2009). Role of FimW, FimY, and FimZ in Regulating the Expression of Type I Fimbriae in Salmonella enterica Serovar Typhimurium. J. Bacteriol.
191: 3003-3010
[Abstract]
[Full Text]
-
Guss, A. M., Kulkarni, G., Metcalf, W. W.
(2009). Differences in Hydrogenase Gene Expression between Methanosarcina acetivorans and Methanosarcina barkeri. J. Bacteriol.
191: 2826-2833
[Abstract]
[Full Text]
-
Socias, S. B., Vincent, P. A., Salomon, R. A.
(2009). The Leucine-Responsive Regulatory Protein, Lrp, Modulates Microcin J25 Intrinsic Resistance in Escherichia coli by Regulating Expression of the YojI Microcin Exporter. J. Bacteriol.
191: 1343-1348
[Abstract]
[Full Text]
-
Bodero, M. D., Munson, G. P.
(2009). Cyclic AMP Receptor Protein-Dependent Repression of Heat-Labile Enterotoxin. Infect. Immun.
77: 791-798
[Abstract]
[Full Text]
-
Pope, S. D., Chen, L.-L., Stewart, V.
(2009). Purine Utilization by Klebsiella oxytoca M5al: Genes for Ring-Oxidizing and -Opening Enzymes. J. Bacteriol.
191: 1006-1017
[Abstract]
[Full Text]
-
Tamae, C., Liu, A., Kim, K., Sitz, D., Hong, J., Becket, E., Bui, A., Solaimani, P., Tran, K. P., Yang, H., Miller, J. H.
(2008). Determination of Antibiotic Hypersensitivity among 4,000 Single-Gene-Knockout Mutants of Escherichia coli. J. Bacteriol.
190: 5981-5988
[Abstract]
[Full Text]
-
Hansen, S., Lewis, K., Vulic, M.
(2008). Role of Global Regulators and Nucleotide Metabolism in Antibiotic Tolerance in Escherichia coli. Antimicrob. Agents Chemother.
52: 2718-2726
[Abstract]
[Full Text]
-
Helbig, K., Grosse, C., Nies, D. H.
(2008). Cadmium Toxicity in Glutathione Mutants of Escherichia coli. J. Bacteriol.
190: 5439-5454
[Abstract]
[Full Text]
-
Saini, S., Brown, J. D., Aldridge, P. D., Rao, C. V.
(2008). FliZ Is a Posttranslational Activator of FlhD4C2-Dependent Flagellar Gene Expression. J. Bacteriol.
190: 4979-4988
[Abstract]
[Full Text]
-
Rhee, J. E., Sheng, W., Morgan, L. K., Nolet, R., Liao, X., Kenney, L. J.
(2008). Amino Acids Important for DNA Recognition by the Response Regulator OmpR. J. Biol. Chem.
283: 8664-8677
[Abstract]
[Full Text]
-
Ellermeier, J. R., Slauch, J. M.
(2008). Fur Regulates Expression of the Salmonella Pathogenicity Island 1 Type III Secretion System through HilD. J. Bacteriol.
190: 476-486
[Abstract]
[Full Text]
-
Lin, D., Rao, C. V., Slauch, J. M.
(2008). The Salmonella SPI1 Type Three Secretion System Responds to Periplasmic Disulfide Bond Status via the Flagellar Apparatus and the RcsCDB System. J. Bacteriol.
190: 87-97
[Abstract]
[Full Text]
-
Campbell, C. S., Mullins, R. D.
(2007). In vivo visualization of type II plasmid segregation: bacterial actin filaments pushing plasmids. JCB
179: 1059-1066
[Abstract]
[Full Text]
-
Schubert, R. A., Dodd, I. B., Egan, J. B., Shearwin, K. E.
(2007). Cro's role in the CI Cro bistable switch is critical for {lambda}'s transition from lysogeny to lytic development. Genes Dev.
21: 2461-2472
[Abstract]
[Full Text]
-
Taliaferro, D. L., Farabaugh, P. J.
(2007). Testing constraints on rRNA bases that make nonsequence-specific contacts with the codon*anticodon complex in the ribosomal A site. RNA
13: 1279-1286
[Abstract]
[Full Text]
-
Pilonieta, M. C., Bodero, M. D., Munson, G. P.
(2007). CfaD-Dependent Expression of a Novel Extracytoplasmic Protein from Enterotoxigenic Escherichia coli. J. Bacteriol.
189: 5060-5067
[Abstract]
[Full Text]
-
Bjedov, I., Dasgupta, C. N., Slade, D., Le Blastier, S., Selva, M., Matic, I.
(2007). Involvement of Escherichia coli DNA Polymerase IV in Tolerance of Cytotoxic Alkylating DNA Lesions in Vivo. Genetics
176: 1431-1440
[Abstract]
[Full Text]
-
Ho, T. D., Waldor, M. K.
(2007). Enterohemorrhagic Escherichia coli O157:H7 gal Mutants Are Sensitive to Bacteriophage P1 and Defective in Intestinal Colonization. Infect. Immun.
75: 1661-1666
[Abstract]
[Full Text]
-
Bodero, M. D., Pilonieta, M. C., Munson, G. P.
(2007). Repression of the Inner Membrane Lipoprotein NlpA by Rns in Enterotoxigenic Escherichia coli. J. Bacteriol.
189: 1627-1632
[Abstract]
[Full Text]
-
Longstaff, D. G., Larue, R. C., Faust, J. E., Mahapatra, A., Zhang, L., Green-Church, K. B., Krzycki, J. A.
(2007). A natural genetic code expansion cassette enables transmissible biosynthesis and genetic encoding of pyrrolysine. Proc. Natl. Acad. Sci. USA
104: 1021-1026
[Abstract]
[Full Text]
-
Golubeva, Y. A., Slauch, J. M.
(2006). Salmonella enterica Serovar Typhimurium Periplasmic Superoxide Dismutase SodCI Is a Member of the PhoPQ Regulon and Is Induced in Macrophages. J. Bacteriol.
188: 7853-7861
[Abstract]
[Full Text]
-
Fischbach, M. A., Lin, H., Zhou, L., Yu, Y., Abergel, R. J., Liu, D. R., Raymond, K. N., Wanner, B. L., Strong, R. K., Walsh, C. T., Aderem, A., Smith, K. D.
(2006). The pathogen-associated iroA gene cluster mediates bacterial evasion of lipocalin 2. Proc. Natl. Acad. Sci. USA
103: 16502-16507
[Abstract]
[Full Text]
-
Iram, S. H., Cronan, J. E.
(2006). The {beta}-Oxidation Systems of Escherichia coli and Salmonella enterica Are Not Functionally Equivalent. J. Bacteriol.
188: 599-608
[Abstract]
[Full Text]
-
Wright, K. J., Seed, P. C., Hultgren, S. J.
(2005). Uropathogenic Escherichia coli Flagella Aid in Efficient Urinary Tract Colonization. Infect. Immun.
73: 7657-7668
[Abstract]
[Full Text]
-
Johannes, T. W., Woodyer, R. D., Zhao, H.
(2005). Directed Evolution of a Thermostable Phosphite Dehydrogenase for NAD(P)H Regeneration. Appl. Environ. Microbiol.
71: 5728-5734
[Abstract]
[Full Text]
-
Gurvich, O. L., Baranov, P. V., Gesteland, R. F., Atkins, J. F.
(2005). Expression Levels Influence Ribosomal Frameshifting at the Tandem Rare Arginine Codons AGG_AGG and AGA_AGA in Escherichia coli. J. Bacteriol.
187: 4023-4032
[Abstract]
[Full Text]
-
Egler, M., Grosse, C., Grass, G., Nies, D. H.
(2005). Role of the Extracytoplasmic Function Protein Family Sigma Factor RpoE in Metal Resistance of Escherichia coli. J. Bacteriol.
187: 2297-2307
[Abstract]
[Full Text]
-
Ikeda, J. S., Janakiraman, A., Kehres, D. G., Maguire, M. E., Slauch, J. M.
(2005). Transcriptional Regulation of sitABCD of Salmonella enterica Serovar Typhimurium by MntR and Fur. J. Bacteriol.
187: 912-922
[Abstract]
[Full Text]
-
Blodgett, J. A. V., Zhang, J. K., Metcalf, W. W.
(2005). Molecular Cloning, Sequence Analysis, and Heterologous Expression of the Phosphinothricin Tripeptide Biosynthetic Gene Cluster from Streptomyces viridochromogenes DSM 40736. Antimicrob. Agents Chemother.
49: 230-240
[Abstract]
[Full Text]
-
Batchelor, E., Silhavy, T. J., Goulian, M.
(2004). Continuous Control in Bacterial Regulatory Circuits. J. Bacteriol.
186: 7618-7625
[Abstract]
[Full Text]
-
White, A. K., Metcalf, W. W.
(2004). The htx and ptx Operons of Pseudomonas stutzeri WM88 Are New Members of the Pho Regulon. J. Bacteriol.
186: 5876-5882
[Abstract]
[Full Text]
-
Yang, X. F., Ji, Y., Schneider, B. L., Reitzer, L.
(2004). Phosphorylation-independent Dimer-Dimer Interactions by the Enhancer-binding Activator NtrC of Escherichia coli: A THIRD FUNCTION FOR THE C-TERMINAL DOMAIN. J. Biol. Chem.
279: 36708-36714
[Abstract]
[Full Text]
-
Yang, K., Metcalf, W. W.
(2004). A new activity for an old enzyme: Escherichia coli bacterial alkaline phosphatase is a phosphite-dependent hydrogenase. Proc. Natl. Acad. Sci. USA
101: 7919-7924
[Abstract]
[Full Text]
-
Schmidt, K. L., Peterson, N. D., Kustusch, R. J., Wissel, M. C., Graham, B., Phillips, G. J., Weiss, D. S.
(2004). A Predicted ABC Transporter, FtsEX, Is Needed for Cell Division in Escherichia coli. J. Bacteriol.
186: 785-793
[Abstract]
[Full Text]
-
Wissel, M. C., Weiss, D. S.
(2004). Genetic Analysis of the Cell Division Protein FtsI (PBP3): Amino Acid Substitutions That Impair Septal Localization of FtsI and Recruitment of FtsN. J. Bacteriol.
186: 490-502
[Abstract]
[Full Text]
-
Ellermeier, C. D., Slauch, J. M.
(2004). RtsA Coordinately Regulates DsbA and the Salmonella Pathogenicity Island 1 Type III Secretion System. J. Bacteriol.
186: 68-79
[Abstract]
[Full Text]
-
Lai, C.-Y., Cronan, J. E.
(2003). {beta}-Ketoacyl-Acyl Carrier Protein Synthase III (FabH) Is Essential for Bacterial Fatty Acid Synthesis. J. Biol. Chem.
278: 51494-51503
[Abstract]
[Full Text]
-
Furushita, M., Shiba, T., Maeda, T., Yahata, M., Kaneoka, A., Takahashi, Y., Torii, K., Hasegawa, T., Ohta, M.
(2003). Similarity of Tetracycline Resistance Genes Isolated from Fish Farm Bacteria to Those from Clinical Isolates. Appl. Environ. Microbiol.
69: 5336-5342
[Abstract]
[Full Text]
-
Hove-Jensen, B., Rosenkrantz, T. J., Haldimann, A., Wanner, B. L.
(2003). Escherichia coli phnN, Encoding Ribose 1,5-Bisphosphokinase Activity (Phosphoribosyl Diphosphate Forming): Dual Role in Phosphonate Degradation and NAD Biosynthesis Pathways. J. Bacteriol.
185: 2793-2801
[Abstract]
[Full Text]
-
Hao, J.-J., Yarmolinsky, M.
(2002). Effects of the P1 Plasmid Centromere on Expression of P1 Partition Genes. J. Bacteriol.
184: 4857-4867
[Abstract]
[Full Text]