Previous Article | Next Article 
Journal of Bacteriology, November 2001, p. 6394-6403, Vol. 183, No. 21
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.21.6394-6403.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Homologues of Neisserial Heme Oxygenase in
Gram-Negative Bacteria: Degradation of Heme by the Product of the
pigA Gene of Pseudomonas aeruginosa
Melanie
Ratliff,1
Wenming
Zhu,1
Rahul
Deshmukh,2
Angela
Wilks,2 and
Igor
Stojiljkovic1,*
Department of Microbiology and Immunology,
Emory School of Medicine, Atlanta, Georgia
30322,1 and Department of Pharmaceutical
Sciences, School of Pharmacy, University of Maryland, Baltimore,
Maryland 212012
Received 18 June 2001/Accepted 3 August 2001
 |
ABSTRACT |
The oxidative cleavage of heme to release iron is a mechanism by
which some bacterial pathogens can utilize heme as an iron source. The
pigA gene of Pseudomonas aeruginosa is shown to
encode a heme oxygenase protein, which was identified in the genome
sequence by its significant homology (37%) with HemO of
Neisseria meningitidis. When the gene encoding the
neisserial heme oxygenase, hemO, was replaced with
pigA, we demonstrated that pigA could
functionally replace hemO and allow for heme utilization by
neisseriae. Furthermore, when pigA was disrupted by
cassette mutagenesis in P. aeruginosa, heme utilization was
defective in iron-poor media supplemented with heme. This defect could
be restored both by the addition of exogenous FeSO4,
indicating that the mutant did not have a defect in iron metabolism,
and by in trans complementation with pigA from
a plasmid with an inducible promoter. The PigA protein was purified by
ion-exchange chromotography. The UV-visible spectrum of PigA
reconstituted with heme showed characteristics previously reported for
other bacterial and mammalian heme oxygenases. The heme-PigA complex
could be converted to ferric biliverdin in the presence of ascorbate,
demonstrating the need for an exogenous reductant. Acidification and
high-performance liquid chromatography analysis of the ascorbate
reduction products identified a major product of biliverdin IX-
.
This differs from the previously characterized heme oxygenases in which
biliverdin IX-
is the typical product. We conclude that PigA is a
heme oxygenase and may represent a class of these enzymes with novel regiospecificity.
 |
INTRODUCTION |
Many pathogenic microorganisms
possess specific heme uptake systems that use heme-iron for metabolic
needs. The common finding in bacterial heme assimilation is that the
intact heme molecule is internalized into the cell (32).
While the transport pathways of heme have been well described, little
was known about the fate of heme in bacteria until recently. The
discovery of heme oxygenases, enzymes that degrade heme to biliverdin,
iron, and carbon monoxide, in corynebacteriae and neisseriae
established heme degradation as one of the pathways of heme processing
in the bacterial cytoplasm (21, 34, 39, 40). However, it
is not clear whether the finding of heme oxygenases in these
microorganisms represents an unusual mechanism shared by only a few
organisms or a common mechanism likely to be present in other
pathogens. The list of microorganisms that are able to use heme as a
source of iron is expanding constantly, while the mechanisms by which
these bacteria utilize iron from heme are still poorly understood.
One heme-assimilating bacteria is the soil bacterium Pseudomonas
aeruginosa (15). This microorganism is carried by
approximately 10% of the healthy human population, but when it is
found in certain types of patients, such as burn victims and those
inflicted with cystic fibrosis, it presents a formidable challenge to
treatment and eradication. Although pseudomonads produce and secrete
extremely efficient siderophores, they are also able to utilize heme
and heme-containing proteins as sole sources of iron (16, 18, 31). P. aeruginosa cells produce at least two
fur-regulated systems of heme transport across the outer
membrane, Has and Phu (16). These systems are similar to
heme assimilation pathways in other gram-negative bacteria, such as
Serratia marcescens and Yersinia enterocolitica
(11, 26, 35).
In this communication, we characterize the product of the
pigA gene of P. aeruginosa. We show that this
gene can complement for Neisseria meningitidis heme
oxygenase in vivo. PigA mutants are unable to use heme as a source of
iron, which together with biochemical data showing the ability of PigA
to catalyze heme degradation in vitro indicate that the PigA protein is
a heme oxygenase. Quite unexpectedly, we found that biliverdin produced by the PigA-catalyzed reaction is structurally different from biliverdins produced by other, previously characterized heme
oxygenases. These data provide another example of heme degradation by
heme oxygenase in distantly related bacteria, suggesting that this is a
common mechanism of iron acquisition in bacteria.
 |
MATERIALS AND METHODS |
Bacteria, media, and antibiotics.
Strains and plasmids used
in this study are listed in Table 1.
Luria agar (Difco) was routinely used for the growth and maintenance of
Escherichia coli strains. Minimal A (MinA) agar was
routinely used for the growth and maintenance of P. aeruginosa strains. MinA agar was prepared as described by Kagami
et al. (10). Gonococcal broth (GCB) agar (Difco) was
routinely used for the growth and maintenance of neisseriae. All
neisseriae were incubated at 36.5°C under 5% CO2 in the
atmosphere. GCB agar plates lacking iron supplements but containing 50 µM the iron chelator desferoxamine mesylate (Desferal; Ciba Geigy)
were used for heme utilization plate assays for neisseriae. Succinate
minimal medium was used for all growth curves of P. aeruginosa and was supplemented with various concentrations of
hemin (ferriprotoporphyrin IX-Cl; Aldrich) prepared fresh in 100%
dimethyl sulfoxide (DMSO) or FeSO4 · 7H2O (Sigma) in the presence or absence of dipyridyl.
Succinate medium was prepared as described by Meyer and Abdallah
(13). Antibiotics were used at the following
concentrations for the maintenance of E. coli strains:
ampicillin, 100 µg/ml; kanamycin, 50 µg/ml; gentamicin, 20 µg/ml.
Antibiotics were used at the following concentrations for the
maintenance of P. aeruginosa strains: carbenicillin, 200 µg/ml; gentamicin, 50 µg/ml.
Isopropyl-1-thiol-
-D-galactopyranoside (IPTG; Fisher)
was used at a final concentration of 1 mM for E. coli and
N. meningitidis and 20 mM for P. aeruginosa.
Construction of strains and plasmids.
Plasmid pWMZ1635
carrying an ermC-lacIOP cassette (23) inserted
upstream of the putative ribosome binding site of a cloned hemO gene was previously described (40). The
hemO sequence was removed by EcoRI digestion and
replaced with the pigA gene sequence from pWMZ1605 to
generate plasmid pWMZ1639a. This construct now carried an
IPTG-inducible pigA gene. pWMZ1639a was transformed into
IR2855 (wild-type N. meningitidis), and replacement of the hemO sequence with pigA was confirmed by Southern
blot analysis of chromosomal DNA from the mutant by using both a
pigA probe and a hemO probe.
The structural gene for
pigA was disrupted by cassette
mutagenesis in
P. aeruginosa. A 600-bp PCR fragment encoding
PigA was
generated with the following primers containing engineered
BamHI
restriction sites:
5'CGATCCCTTTTCTGGTCAATGGCAGTCGGT and
3'GGATCCCCCCTCAGGCGAAGGTACGTCCA.
The
BamHI
fragment was cloned into the
BamHI site of pBluescript
II
SK(+). A
HindIII-
SacI fragment containing
pigA was then subcloned
into pUC18. A gentamicin cassette of
850 bp was inserted into
a central
KpnI site within the
pigA sequence by blunt-end ligation
to disrupt the
pigA gene (
23). An
EcoRI fragment
was cloned
into pGP704, which was then used to clone an
XbaI-
SmaI restriction
fragment containing the
disrupted
pigA gene into pCVD442, a vector
conferring
sucrose sensitivity and ampicillin resistance (
5,
14).
This plasmid, pWMZ1637, was transformed into S17.1 (IR747),
an
E. coli strain carrying a chromosomal copy of the
pir
gene,
for recombination into
P. aeruginosa
(
25). Upon selection and
screening for Carb
s,
Suc
r, and Gen
r ex-conjugates, IR1648, a
P. aeruginosa pigA knockout, was isolated.
The disruption
was confirmed by Southern blot hybridization using
a
pigA
probe and a gentamicin cassette probe (data not
shown).
A
pigA-complementing plasmid was generated by cloning the
EcoRI fragment from pWMZ1605 carrying
pigA into
the
EcoRI site of
pMMB66HE. The resultant construct,
pMCR2050, carries
pigA under
an IPTG-inducible
promoter.
pWMZ1656 and pWMZ1666 were generated by cloning
pigA
carrying a carboxy-terminal, six-histidine tag or native
pigA, respectively.
The genes were cloned by PCR
amplification using Pfx DNA polymerase
(Promega) and the following
primers containing the listed restriction
sites:
NdeI,
5'CGCGCAT ATGGATACCCTGGCCCCTGAATCC, and
XhoI,
3'CGCGCTCGAGGGCGAAGGTACGCTCCAGCAG.
Poly(A) overhangs
were generated by the addition of 1 µM dATP
and 1 µl of
Taq polymerase to the completed PCR mixture and incubation
at 72°C for 15 min. The 600-bp PCR products were cloned into the
pCR
2.1-TOPO II vector (Invitrogen) to generate pWMZ1655 and pWMZ1665.
The
resultant PCR fragments containing native and His-tagged versions
of
pigA were subcloned into pET21a expression vector by
NdeI-
XhoI
digestion and religation, generating
pWMZ1656 and
pWMZ1666.
Chromosomal DNA preparations.
A 100-µl aliquot of an
overnight Luria broth culture was pelleted by centrifugation for 1 min
at 6,000 × g. The cell pellet was resuspended in 50 mM
Tris-EDTA, pH 8.0, and 50 µl of lysozyme (10 mg/ml). The cells were
allowed to incubate at room temperature for 10 min followed by the
addition of 25 µl of proteinase K (100 mg/ml) and 5 µl of 10%
sodium dodecyl sulfate (SDS) and incubation at 65°C for 1 h. To
each lysate, 200 µl of phenol-chloroform-alcohol was added, and it
was vortexed and then centrifuged at 12,000 × g for 5 min. The supernatant was transferred to a new tube, and the DNA was
precipitated with a 1:10 (vol/vol) volume of 4 M LiCl and 2.5 volumes
of 100% ethanol. The DNA pellet was resuspended in 400 µl of
Tris-EDTA and 2 µl of RNase (10 mg/ml) and incubated for 1 h at
37°C. The DNA was again precipitated and resuspended in 100 µl of
Tris-EDTA and stored at
20°C.
PCR, DNA sequencing, and Southern blot hybridization.
Standard procedures for plasmid DNA preparation and restriction
analysis were used as described by Sambrook et al. (20). A
600-bp fragment containing pigA was amplified using primers 5'CGATCCCTTTTCTGGTCAATGGCAGTCGGT and
3'GGATCCCCCCTCAGGCGAAGGTACGTCCA with the following reaction
cycle: 94°C, 30 s; 50°C, 1 min; 72°C, 1 min (28 cycles). The
PCR product was sequenced by dye terminator cycle sequencing on an ABI
model 377 automated sequencer with M13 forward and M13 reverse primers
to obtain the nucleotide sequences of both strands. Southern blot
analysis procedure was performed as described by Sambrook et al.
(20). The pigA-specific probe and
gentamicin-specific probe were generated by digoxigenin nonradioactive DNA labeling (Genius system; Boehringer GmbH, Mannheim, Germany) during
PCR with the pigA primers listed above.
Heme utilization assays (for N. meningitidis) and
growth studies (for P. aeruginosa).
To determine the
ability of the N. meningitidis
hemO::pigA mutant to utilize heme, filter
disc assays were performed as described by Zhu et al.
(39). Growth studies and heme utilization of the
Pseudomonas strains were carried out by seeding 1 ml of succinate medium with a single colony for each strain. A 100-µl aliquot of the cell suspensions was used to inoculate 100 µl of succinate media present in a sterile, round-bottom, microtiter plate
well. The plate was incubated with vigorous shaking at 38°C for
18 h in a Biotek 808 ELx incubator and plate reader. When specified, various concentrations of a freshly prepared hemin-DMSO solution were added to the culture wells. Iron-restricted media were
achieved with the addition of 0.5 mM dipyridyl. Iron-rich media were
prepared by the addition of various concentrations of
FeSO4 · 7H2O. For the complementation
assays, IPTG was added to a final concentration of 20 mM in each well,
regardless of hemin concentration.
Expression, purification, and characterization of PigA heme
oxygenase.
The overexpression of PigA from vector pET21a and
purification were done as described previously (39). The
heme-PigA heme oxygenase [heme-PigA(HO)] complex was prepared as
described previously (33). The millimolar extinction
coefficient (
405) for the heme-PigA(HO) complex was
determined as previously described (7). The absorbance of
a purified heme-PigA(HO) sample at 405 nm was measured. An excess of
dithionite was added, and the spectrum of the reduced ferrous pyridine
hemochrome was then recorded. The concentration was calculated from the
absorbance maxima at 418.5, 526, and 555 nm using millimolar extinction
coefficient values of 170, 17.5, and 34.4, respectively. The reaction
of the heme-PigA(HO) complex in presence of NADPH reductase was carried
out as described previously (34, 39). Following completion
of the reaction, the product was extracted for high-performance liquid
chromatography (HPLC) analysis as described below.
The ascorbic acid-dependent conversion of heme to biliverdin was also
monitored. Ascorbic acid at a final concentration of
5 mM was added
directly to the heme-PigA(HO) complex (10 µM) in
20 mM Tris-HCl
buffer (pH 7.5). The spectral changes between 300
and 750 nm were
recorded over a 20-min time period. The products
of the reaction were
extracted and subjected to HPLC analysis
as described
below.
The reaction of the heme-PigA(HO) complex with
H
2O
2 was monitored as previously described
(
39) except that 10 equivalents
of 10 mM
H
2O
2 (10 µl) in Tris-HCl (pH 7.5) were added
to the heme-PigA(HO)
complex (10 µM) in the same
buffer.
HPLC analysis of the heme-PigA(HO) reaction products was performed as
described previously (
39).
 |
RESULTS |
Homologues of neisserial heme oxygenase in gram-negative
bacteria.
It has been previously demonstrated that the
hemO gene of N. meningitidis encodes a protein
capable of catalytic degradation of heme to iron, CO, and
-biliverdin (39). Analysis of several bacterial genomes
for open reading frames similar to that of the HemO protein did not
reveal many homologues: only Pseudomonas spp. contained
potential heme oxygenases (Fig. 1). An
iron-inducible protein of unknown function in P. aeruginosa,
PigA, was 37% identical in its amino acid sequence to the HemO
protein. Further, the genome of another pseudomonad, Pseudomonas
putida, contained two open reading frames with a high homology to
HemO and PigA proteins HemO-PP and PigA-PP, respectively (Fig. 1). The
two putative P. putida heme oxygenases shared 41% identical
amino acid residues. Interestingly, HemO-PP was more homologous to
the neisserial heme oxygenase (51% identity) than to the P. aeruginosa PigA (44% identity). Conversely, two
Pseudomonas PigA homologues shared 56% identity at the
amino acid level. All four heme oxygenases shown in Fig. 1 possess a
highly conserved histidine residue that serves as the proximal ligand
to the heme in all heme oxygenases characterized thus far (2, 22,
22a, 27, 39).

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 1.
An amino acid sequence alignment of the N. meningitidis heme oxygenase (HemO-MC) and putative P. aeruginosa and P. putida heme oxygenases (HemO-PP,
PigA-PP, and PigA-PA). *, identical residues; dot, similar residues.
The alignment was performed using the ClustalW 1.8 program on the
Baylor College of Medicine Search Launcher.
|
|
Replacement of neisserial hemO with P. aeruginosa
pigA.
To determine if the pigA gene of P. aeruginosa encodes a protein with similar function,
pigA was cloned under an IPTG-regulatable promoter between
flanking regions of hemO. The resultant plasmid construct
was homologously recombined into the chromosome of N. meningitidis to replace hemO, and the replacement was
confirmed by Southern blot analysis (Fig.
2A). The replacement strain has a
complete pigA gene and no longer contains the
hemO gene sequence. Heme utilization of the pigA
replacement mutant of neisseriae was assayed on GCB-Desferal plates. A
50-µg aliquot of a fresh hemin-DMSO solution was applied to a sterile
filter disk, and the plates were incubated for 24 h under 5%
CO2 in the presence and absence of IPTG. As shown in Fig.
2B, wild-type N. meningitidis can utilize heme on these
plates whereas a hemO deletion mutant cannot. Additionally,
the pigA replacement mutant can utilize heme on these plates
only in the presence of IPTG, indicating that the expression of
pigA is under the control of the lac promoter as
intended (see Materials and Methods).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 2.
Chromosomal complementation of the N. meningitidis
hemO deletion mutant with pigA gene from P. aeruginosa. (A) Southern blot analysis was performed on
chromosomal DNA from the wild type and the mutant; hybridization and
detection were achieved with either a hemO probe (panel 1)
or a pigA probe (panel 2). (B) For each construct,
complementation is shown by growth around a heme disk on GCB-Desferal
media in the presence of IPTG.
|
|
Characterization of P. aeruginosa pigA knockout
mutant.
To study the role of PigA in heme catabolism, the
pigA gene was disrupted by the insertion of a gentamicin
antibiotic cassette in the siderophore-deficient P. aeruginosa IA614 strain. The insertion was confirmed by Southern
blot analysis using probes specific to pigA and the cassette
(data not shown). Heme utilization was assayed by determining growth of
the mutants in iron-restricted succinate medium in the absence and
presence of heme (free iron was chelated with 0.5 mM dipyridyl). Both
strains grew well in normal succinate medium and did not grow in the
succinate medium supplemented with dipyridyl (Fig.
3). The IA614 cells were capable of
growth above an optical density at 600 nm (OD600) of 1.0 with heme supplementation, whereas the mutant reached an
OD600 of only 0.2. The growth observed with IA614 appears
to correlate directly with the increasing concentrations of heme. To
determine that the defect in the pigA mutant affected heme
utilization and not iron metabolism or sensitivity of the mutant to
dipyridyl, the cells were grown in the dipyridyl-succinate media made
iron rich by the addition of FeSO4 · 7H2O. Both IA614 and the pigA mutant demonstrated growth near an OD600 of 1.0 (data not shown).

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 3.
Growth analysis of P. aeruginosa PAO1 versus
PAO1 pigA insertion mutant under various culture conditions.
Aliquots of 106 cells were incubated with aeration at
38°C in succinate minimal medium in the presence of absence of 0.5 mM
dipyridyl. Where indicated, cells were grown in succinate-dipyridyl
medium supplemented with increasing concentrations of heme for 18 h. Cultures were grown in the presence or absence of 20 mM IPTG. Strain
IA614, PAO1sid ; strain IR1648, PAO1sid
pigA::Gen; strain 4311, PAO1sid
pigA::Gen + pMCR2050 (pigA). S,
succinate medium; S+D, succinate medium with dipyridyl only.
|
|
Complementation of pigA knockout mutant.
As
demonstrated above, iron-restricted minimal medium supplemented with
heme was unable to support growth of the pigA knockout mutant. To demonstrate that the heme utilization defect is due to the
loss of PigA, the pigA gene was cloned onto an
IPTG-inducible plasmid, pMMB66HE, and conjugated into the mutant. The
growth of the complemented pigA mutant was tested in the
presence of heme and the inducer (Fig. 3). In comparison with the
controls, pMMB66HEpigA (pMCR2050) was able to restore heme
utilization capability (growth in iron-poor media supplemented with
heme) to near-wild-type levels only in the presence of the inducer.
These data suggest that the product of the pigA gene is
essential for the ability of P. aeruginosa to use heme as a
source of iron. The high level of amino acid identity and the ability
of the pigA gene to complement the heme oxygenase mutant of
N. meningitidis indicate strongly that the pigA
gene product may be a heme oxygenase.
Characterization of the putative P. aeruginosa heme
oxygenase.
The wild-type PigA(HO) was expressed as a soluble
catalytically active protein, evidenced from the accumulation of
biliverdin within the cells. Purification of PigA(HO) by ion-exchange
and gel-filtration chromatography yielded a protein band with a
molecular mass of 23 kDa by SDS-polyacrylamide gel electrophoresis
(PAGE) (Fig. 4, inset). The yield of
purified protein from a liter of cells was in the range of 20 to 30 mg.
Reconstitution of the protein with heme yielded a 1:1 complex with a
Soret maximum at 406 nm (Fig. 4). Reduction of the heme with dithionite
yielded a reduced ferrous-deoxy complex with a Soret maximum at 434 nm;
addition of CO to the reduced complex resulted in a shift of the Soret band to 419 nm, with the appearance of
/
-bands at 537 and 567 nm
(Fig. 4). The spectral properties of the heme-PigA(HO) complex are
similar to those reported for the bacterial and mammalian heme
oxygenases in which the proximal ligand to the heme is a histidine
(2, 33-36, 38). With both the mammalian and bacterial enzymes, it has been shown that a water molecule occupies the sixth
ligand position. With increasing pH, a shift in the Soret and the
appearance of
/
bands on transition from a six-carbon high-spin
(6CHS) to six-carbon low-spin (6CLS) system indicates that the sixth
ligand in the P. aeruginosa HO is also a water molecule. The
transition from a high-spin to low-spin system results from the
deprotonation of an H2O molecule to a hydroxide molecule with pKa of 8.0 (data not shown). This is in agreement with
that previously observed for both C. diphtheriae HmuO
(2) and human HO (28). The millimolar
extinction coefficient of the heme-PigA(HO) complex was calculated to
be 129 mM
1.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 4.
Absorption spectra of the heme-PigA(HO) complexes and
SDS-PAGE gel of the purified PigA(HO) protein (inset). The spectra are
ferric ( ), ferrous deoxy ( ), and ferrous CO bound ( )
heme-PigA(HO). (Inset) SDS-PAGE gel of the purified PigA(HO). Lane 1, markers; lane 2, purified native PigA(HO).
|
|
Catalytic activity of heme-PigA(HO) complex.
The heme-PigA(HO)
complex was converted to ferric-biliverdin in the presence of ascorbate
as an exogenous reductant. The reaction was monitored by UV-visible
spectroscopy, and the products were determined by HPLC analysis
following extraction and methylation. The ferric heme-PigA(HO) complex
was quantitatively converted to ferric-biliverdin (Fig.
5, inset). Initial formation of the ferrous-dioxygen complex was observed with a shift in the Soret from
406 to 410 nm and the appearance of
/
bands at 570 and 540 nm,
respectively. Over a period of 30 min, the reaction proceeded with a
decrease in the Soret and a shift back to 404 nm and the disappearance
of the
/
bands on further conversion of the ferrous-dioxygen complex to ferric-biliverdin. Acidification of the product resulted in
a spectrum with maxima at 380 nm and 680 nm, indicative of iron-free
biliverdin (Fig. 5, inset).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 5.
Conversion of heme-PigA(HO) to biliverdin in the
presence of ascorbate. Spectra were taken at 10-min intervals after the
addition of ascorbate (5 mM) to the ferric heme-HemO complex. (Inset)
The UV/visible spectra of a final biliverdin product after
acidification.
|
|
HPLC analysis of the products yielded a major and a minor peak with
retention times identical to those of biliverdin IX-
and -

,
respectively (Fig.
6). The reaction
products eluted with
biliverdin IX-

and -

on coinjection with the
known standards
(data not shown). The biliverdin standards for
comparison are
shown in Fig.
6 (inset).

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 6.
HPLC chromatogram of the product of the heme-pigA(HO)
reaction with ascorbate following extraction and methylation. (Inset)
An HPLC chromatogram of a mixture of all four biliverdin dimethyl
esters as standards is shown. The UV-visible spectra and the HPLC
product analysis conclude that oxidative cleavage of heme by PigA(HO)
is regiospecific with the biliverdin IX- and that small amounts of
biliverdin IX- isomers are formed.
|
|
Reaction of heme-PigA(HO) complex with
H2O2.
The reaction of the heme-PigA(HO)
complex with 10 equivalents of H2O2 resulted in
the formation of verdoheme, as previously described for the bacterial
and mammalian HO enzymes (30, 34). A decrease in the Soret
band at 404 nm and an increase in the visible absorption in the 640- to
680-nm region were observed (data not shown). Addition of pyridine to a
final concentration of 20% and extraction into chloroform yielded a
spectrum typical of a pyridine-verdohemochrome (data not shown).
Hydrolytic conversion of the product to biliverdin and subsequent HPLC
analysis verified that the initial
H2O2-dependent hydroxylation occurred solely at
the
-meso carbon (data not shown).
 |
DISCUSSION |
How widespread are heme oxygenases in bacterial genomes?
The
identification of a heme oxygenase (HmuO) in corynebacteriae and more
recently in neisseriae (HemO) provide evidence that oxidative cleavage
of heme is a mechanism by which pathogenic bacteria can acquire iron
(21, 32, 39, 40). However, the analysis of 83 completed
and uncompleted bacterial genomes for HmuO and HemO homologues
identified an unexpectedly small number of orthologs: only
Pseudomonas spp. and legionellae contained potential heme
oxygenases. Another possible homologue was found in the genome of
Deinococcus radiodurans (data not shown). This finding
raises the argument that not all microorganisms use heme oxygenases to
obtain iron for metabolic needs. Alternatively, the enzymes that
degrade heme in these microorganisms might not share significant
homology with currently identified heme oxygenases or they may employ a
different mechanism of extracting iron from heme. It can be concluded
that the currently characterized or identified bacterial heme
oxygenases group into two subfamilies, those characterized by HemO-PigA
of neisseriae and Pseudomonas and by HmuO of
corynebacteriae. When compared, the members of these two subfamilies do
not share significant amino acid identity apart from the histidine
residue, which functions as the proximal ligand to the heme, and a
conserved motif (G-S-X-L-G) in which both a serine and leucine are
conserved (Fig. 1). The conserved glycine motif, as evidenced from the
crystal structures of both the human HO-1 and the neisserial HemO,
introduces a kink in the distal helix directly above the heme,
presumably to allow binding of the substrate and release of the product
(22, 22a). Similarly, the human and neisserial heme
oxygenases show low sequence identity but still retain the same overall
fold (22, 40). Thus, although the prevalence of heme
oxygenases in bacterial genomes seems very low, this is probably a
result of search tool limitations and not the rarity of
oxygen-dependent degradation of heme in prokaryotes.
Product of the pigA gene is a heme oxygenase.
The
current study was aimed at characterizing the putative heme oxygenase
of P. aeruginosa. Four independent results lend strong
support to the claim that the product of the pigA gene is
involved in heme catabolism: (i) a high degree of amino acid homology
(37% identity) with a known heme oxygenase, HemO, (ii) the ability to
complement the heme utilization defect of a hemO mutant of
N. meningitidis, (iii) the inability of a P. aeruginosa pigA mutant to use heme as a source of iron, and (iv)
the complementation of the growth defect of a pigA mutant by
functional copy of pigA or by inorganic iron supplementation
of growth media. A previous study by Ochsner and Vasil established that
the pigA gene is negatively regulated by Fur and iron, which
is consistent with the role of PigA in iron assimilation
(17).
The biochemical characterization of the protein provides further
evidence that PigA possesses heme oxygenase activity and
can catalyze
the final step in the utilization of heme by
P. aeruginosa.
The UV-visible spectra of the
P. aeruginosa heme-HO
complexes
are similar to those reported for the bacterial and mammalian
enzymes, in which the proximal ligand to the heme is a histidine,
with
a water bound in the sixth ligand position (
3,
27,
28,
33,
34,
39). In the presence of ascorbate, the heme-PigA(HO)
complex is
quantitatively converted to ferric-biliverdin which
remains associated
with the protein. It has been reported for
the
C. diphtheriae heme oxygenase that both the ascorbate-driven
and
NADPH cytochrome P450 reductase-driven reactions yield biliverdin
as
the product (
2,
21). However, it must be
noted that in
the ascorbate-driven reaction, free biliverdin was
observed only
following a 2-h incubation (
2). Indeed, the
product of the
reaction catalyzed by the human HO-1 in the presence of
ascorbate
is ferric-biliverdin, which yields free biliverdin only after
the addition of iron chelators (
12). In contrast to the
C. diphtheriae and
N. meningitidis enzymes,
P. aeruginosa PigA(HO) on reconstitution
with the human
NADPH cytochrome P450 reductase yielded very little
ferric-biliverdin
under the same conditions as used previously
for the bacterial heme
oxygenases (data not
shown).
PigA(HO)-catalyzed reaction yields novel biliverdin isomer
pattern.
HPLC analysis of the product from the ascorbate dependent
reaction yielded biliverdin IX-
as the primary product with a minor peak due to the
-isomer (Fig. 6). The appearance of the
-isomer most likely arises from the 180° rotation around the
/
axis previously observed in nuclear magnetic resonance studies of the human
HO-1 protein (9). In contrast to the isozymes with
-selectivity, the rotation around the
/
-axis does not alter
the regiospecificity, whereas in the P. aeruginosa heme
oxygenase, the
- and
-meso-carbons would be exchanged. It is not
known if the rotation around the
/
-axis is of relevance in vivo,
as the heme may be delivered to heme oxygenase in a concerted manner
from an as-yet-unidentified transport protein, which may preclude
rotation around the
/
-axis. It is reasonable to assume that
physiological oxidative cleavage of heme by P. aeruginosa
occurs at the
-meso-edge (Fig. 7). This is the first
report of a heme oxygenase with regiospecificity other than that for
the
-meso-carbon. The physiological relevance of the
-selectivity is unknown given that both the C. diphtheriae and N. meningitidis enzymes retain
regiospecificity for the
-meso-edge as previously
observed for the eukaryotic heme oxygenases. Reaction of the heme-HO
complex with H2O2 in the presence of oxygen
yields verdoheme as the final product. Hydrolytic conversion of the
verdoheme product to biliverdin and subsequent HPLC analysis again
identified biliverdin-IX-
as the final product. The ability of
H2O2 to substitute for NADPH and oxygen in the
initial hydroxylation of heme, which in the presence of oxygen rapidly
reacts to verdoheme, is consistent with that previously reported for
the human (36, 37) and bacterial (3, 39) enzymes.
These data taken together clearly identify PigA(HO) as a heme oxygenase
enzyme with a novel regiospecificity. This is the
first report of a
heme oxygenase from any organism that displays
selectivity for a
meso-carbon other than the

-
meso-carbon (Fig.
7). This not only has interesting
physiological ramifications
but also provides us with an opportunity to
study heme oxygenases
with two different regiospecificities, and
perhaps we can gain
a better understanding of the steric and electronic
factors controlling
the regiospecificity of heme cleavage.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 7.
Chemical steps in heme degradation as defined by the
studies of eukaryotic heme oxygenases and C. diphtheriae
HmuO. Me, methyl side chain; V, vinyl side chain; Pr, propionic side
chain. All thus far characterized heme oxygenases cleave the porphyrin
ring at the -carbon atom, whereas PigA(HO) cleaves at the
-carbon.
|
|
 |
ACKNOWLEDGMENTS |
Melanie Ratliff and Wenming Zhu contributed equally to this work.
We thank K. Poole and H. Schweizer for strains. We thank Heather
Alexander, Donna Balding-Perkins, and Anthony Richardson for reading
the manuscript and for helpful suggestions.
This work is supported by the Public Service grant AI42870 to I.S.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, Emory School of Medicine, 3001 Rollins
Research Center, Atlanta, GA 30322. Phone: (404) 727-1322. Fax: (404)
727-3659. E-mail: stojiljk{at}microbio.emory.edu.
 |
REFERENCES |
| 1.
|
Ankenbauer, R. G., and C. D. Cox.
1998.
Isolation and characterization of Pseudomonas aeruginosa mutants requiring salicylic acid for pyochelin biosynthesis.
J. Bacteriol.
170:5364-5367.
|
| 2.
|
Chu, G. C.,
K. Katakura,
X. Zhang,
T. Yoshida, and M. Ikeda-Saito.
1999.
Heme degradation as catalyzed by a recombinant bacterial heme oxygenase (HmuO) from Corynebacterium diphtheriae.
J. Biol. Chem.
274:21319-21325[Abstract/Free Full Text].
|
| 3.
|
Chu, G. C.,
T. Tomita,
F. D. Sonnichsen,
T. Yoshida, and M. Ikeda-Saito.
1999.
The heme complex of HmuO, a bacterial heme degradation enzyme from Corynebacterium diphtheriae. Structure of the catalytic site.
J. Biol. Chem.
274:24490-24496[Abstract/Free Full Text].
|
| 4.
|
Crusats, J.,
A. Suzuki,
A. Mizutani, and T. H. Ogoshi.
1998.
Regioselective porphyrin bridge cleavage controlled by electronic effects coupled oxidation of 3-demethyl-3-(trifluoromethyl)mesohemin IX and identification of its four biliverdin isomers.
J. Org. Chem.
63:602-607[CrossRef][Medline].
|
| 5.
|
Donnenberg, M. S., and J. B. Kaper.
1991.
Construction of an eae deletion mutant of enteropathogenic Escherichia coli by using a positive-selection suicide vector.
Infect. Immun.
59:4310-4317[Abstract/Free Full Text].
|
| 6.
|
Figurski, D. H., and D. R. Helinski.
1979.
Replication on an origin-containing derivative of plasmid RK2 dependent on a plasmid function in trans.
Proc. Natl. Acad. Sci. USA
76:1648-1652[Abstract/Free Full Text].
|
| 7.
|
Fuhrhop, J. H. K., and M. Smith.
1975.
In
K. M. Smith (ed.), Porphyrins and metalloporphyrins, p. 804-807.
Elsevier, Amsterdam, The Netherlands.
|
| 8.
|
Fürste, J. P.,
W. Pansegrau,
R. Frank,
H. Bloeker,
P. Scholtz,
M. Bagdasarian, and E. Lanka.
1986.
Molecular cloning of the plasmid RP4 primase region in a multi-host range tac expresion vector.
Gene
48:119-131[CrossRef][Medline].
|
| 9.
|
Hernandez, G.,
A. Wilks,
R. Paolesse,
K. M. Smith,
P. R. Ortiz de Montellano, and G. N. La Mar.
1994.
Proton NMR investigation of substrate-bound heme oxygenase: evidence for electronic and steric contributions to stereoselective heme cleavage.
Biochemistry
33:6631-6641[CrossRef][Medline].
|
| 10.
|
Kagami, Y.,
M. Ratliff,
M. Surber,
A. Martinez, and D. N. Nunn.
1998.
Type II protein secretion in Pseudomonas aeruginosa: genetic suppression of a conditional mutation in the pilin-like component XcpT by the cytoplasmic component XcpR.
Mol. Microbiol.
27:221-233[CrossRef][Medline].
|
| 11.
|
Letoffe, S.,
J. M. Ghigo, and C. Wandersman.
1994.
Iron acquisition from heme and hemoglobin by a Serratia marcescens extracellular protein.
Proc. Natl. Acad. Sci. USA
91:9876-9880[Abstract/Free Full Text].
|
| 12.
|
Liu, Y., and P. R. Ortiz de Montellano.
2000.
Reaction intermediates and single turnover rate constants for the oxidation of heme by human heme oxygenase-1.
J. Biol. Chem.
275:5297-5307[Abstract/Free Full Text].
|
| 13.
|
Meyer, J. M., and M. A. Abdallah.
1978.
The fluorescent pigment of Pseudomonas fluorescens: biosynthesis, purification, and physicochemical properties.
J. Gen. Microbiol.
107:319-328.
|
| 14.
|
Miller, V. L., and J. J. Mekalanos.
1988.
A novel suicide vector and its use in construction of insertion mutants: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR.
J. Bacteriol.
170:2575-2583[Abstract/Free Full Text].
|
| 15.
|
Noya, F.,
A. Arias, and E. Fabiano.
1997.
Heme compounds as iron sources for nonpathogenic Rhizobium bacteria.
J. Bacteriol.
179:3076-3078[Abstract/Free Full Text].
|
| 16.
|
Ochsner, U. A.,
Z. Johnson, and M. L. Vasil.
2000.
Genetics and regulation of two distinct haem-uptake systems, phu and has, in Pseudomonas aeruginosa.
Microbiology
146:185-198[Abstract/Free Full Text].
|
| 17.
|
Ochsner, U. A., and M. L. Vasil.
1996.
Gene repression by the ferric uptake regulator in Pseudomonas aeruginosa: cycle selection of iron-regulated genes.
Proc. Natl. Acad. Sci. USA
93:4409-4414[Abstract/Free Full Text].
|
| 18.
|
Poole, K.,
D. E. Heinrichs, and S. Neshat.
1993.
Cloning and sequence analysis of an EnvCD homologue in Pseudomonas aeruginosa: regulation by iron and possible involvement in the secretion of the siderophore pyoverdine.
Mol. Microbiol.
10:529-544[CrossRef][Medline].
|
| 19.
|
Saito, S., and H. A. Itano.
1982.
Verdohemochrome IX alpha: preparation and oxidoreductive cleavage to biliverdin IX alpha.
Proc. Natl. Acad. Sci. USA
79:1393-1397[Abstract/Free Full Text].
|
| 20.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 21.
|
Schmitt, M. P.
1997.
Utilization of host iron sources by Corynebacterium diphtheriae: identification of a gene whose product is homologous to eukaryotic heme oxygenases and is required for acquisition of iron from heme and hemoglobin.
J. Bacteriol.
179:838-845[Abstract/Free Full Text].
|
| 22.
|
Schuller, D. J.,
A. Wilks,
P. R. Ortiz de Montellano, and T. L. Poulos.
1999.
Crystal structure of human heme oxygenase-1.
Nat. Struct. Biol.
6:860-867[CrossRef][Medline].
|
| 22a.
| Schuller, D. I., W. Zhu, A. Wilks, I. Stojiljkovic, and
T. L. Poulos. Crystal structure of heme oxygenase from the
Gram-negative pathogen Nesseria meningitidis and a
comparison with mammalian heme oxygenase-1. Biochemistry, in press.
|
| 23.
|
Schweizer, H. P.
1993.
Small broad-host range gentamycin resistance gene cassettes for site-specific insertion and deletion mutagenesis.
BioTechniques
15:852-853[Medline].
|
| 24.
|
Seifert, H. S.
1997.
Insertionally inactivated and inducible recA alleles for use in Neisseria.
Gene
188:215-220[CrossRef][Medline].
|
| 25.
|
Simon, R.,
U. Priefer, and A. Puhler.
1983.
A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram-negative bacteria.
Bio/Technology
1:784-791[CrossRef].
|
| 26.
|
Stojiljkovic, I., and K. Hantke.
1992.
Haemin uptake system of Yersinia enterocolitica: similarities with other TonB-dependent systems in Gram-negative bacteria.
EMBO J.
11:4359-4367[Medline].
|
| 27.
|
Sugishima, M.,
Y. Omata,
T. Kakuta,
H. Sakamoto,
M. Noguchi, and M. K. Fukuyama.
2000.
Crystal structure of rat heme oxygenase-1 in complex with heme.
FEBS Lett.
471:61-66[CrossRef][Medline].
|
| 28.
|
Sun, J.,
A. Wilks,
P. R. Ortiz de Montellano, and T. M. Loehr.
1993.
Resonance Raman and EPR spectroscopic studies on heme-heme oxygenase complexes.
Biochemistry
32:14151-14157[CrossRef][Medline].
|
| 29.
|
Tabor, S., and C. C. Richardson.
1985.
A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes.
Proc. Natl. Acad. Sci. USA
82:1074-1078[Abstract/Free Full Text].
|
| 30.
|
Takahashi, S.,
J. Wang,
D. L. Rousseau,
K. Ishikawa,
T. Yoshida,
J. R. Host, and M. Ikeda-Saito.
1994.
Heme-heme oxygenase complex: structure of the catalytic site and its implication for oxygen activation.
J. Biol. Chem.
269:1010-1014[Abstract/Free Full Text].
|
| 31.
|
Vasil, M. L., and U. A. Oschner.
1999.
The response of Pseudomonas aeruginosa to iron: genetics, biochemistry, and virulence.
Mol. Microbiol.
34:399-413[CrossRef][Medline].
|
| 32.
|
Wandersman, C., and I. Stojiljkovic.
2000.
Bacterial heme sources.
Curr. Opin. Microbiol.
3:215-220[CrossRef][Medline].
|
| 33.
|
Wilks, A., and P. Moenne-Loccoz.
2000.
Identification of the proximal ligand His-20 in heme oxygenase (HmuO) from Corynebacterium diphtheriae: oxidative cleavage of the heme macrocycle does not require the proximal histidine.
J. Biol. Chem.
275:11686-11692[Abstract/Free Full Text].
|
| 34.
|
Wilks, A., and M. P. Schmitt.
1998.
Expression and characterization of a heme oxygenase (HmuO) from Corynebacterium diphtheriae.
J. Biol. Chem.
273:837-841[Abstract/Free Full Text].
|
| 35.
|
Wilks, A.,
J. Sun,
T. M. Loehr, and P. R. Ortiz de Montellano.
1995.
Heme oxygenase His25Ala mutant: replacement of the proximal iron ligand by exogenous bases restores catalytic activity.
J. Am. Chem. Soc.
117:2925-2926[CrossRef].
|
| 36.
|
Wilks, A.,
J. Torpey, and P. R. Ortiz de Montellano.
1994.
Heme oxygenase (HO 1). Evidence for electrophilic oxygen addition to the porphyrin ring in the formation of alpha meso-hydroxyheme.
J. Biol. Chem.
269:29553-29556[Abstract/Free Full Text].
|
| 37.
|
Wilks, A., and P. R. Ortiz de Montellano.
1993.
Rat liver heme oxygenase. High level expression of a truncated soluble form and nature of the meso-hydroxylating species.
J. Biol. Chem.
268:22357-22362[Abstract/Free Full Text].
|
| 38.
|
Yoshida, T., and G. Kikuchi.
1979.
Purification and properties of heme oxygenase from rat liver microsomes.
J. Biol. Chem.
254:4487-4491[Abstract/Free Full Text].
|
| 39.
|
Zhu, W.,
A. Wilks, and I. Stojiljkovic.
2000.
Degradation of heme in gram-negative bacteria: the product of the hemO gene of Neisseriae is a heme oxygenase.
J. Bacteriol.
182:6783-6790[Abstract/Free Full Text].
|
| 40.
|
Zhu, W.,
D. J. Hunt,
A. R. Richardson, and I. Stojiljkovic.
2000.
Use of heme compounds as iron sources by pathogenic Neisseriae requires the product of the hemO gene.
J. Bacteriol.
182:439-447[Abstract/Free Full Text].
|
Journal of Bacteriology, November 2001, p. 6394-6403, Vol. 183, No. 21
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.21.6394-6403.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kaur, A. P., Lansky, I. B., Wilks, A.
(2009). The Role of the Cytoplasmic Heme-binding Protein (PhuS) of Pseudomonas aeruginosa in Intracellular Heme Trafficking and Iron Homeostasis. J. Biol. Chem.
284: 56-66
[Abstract]
[Full Text]
-
Bianchetti, C. M., Yi, L., Ragsdale, S. W., Phillips, G. N. Jr.
(2007). Comparison of Apo- and Heme-bound Crystal Structures of a Truncated Human Heme Oxygenase-2. J. Biol. Chem.
282: 37624-37631
[Abstract]
[Full Text]
-
Kunkle, C. A., Schmitt, M. P.
(2007). Comparative Analysis of hmuO Function and Expression in Corynebacterium Species. J. Bacteriol.
189: 3650-3654
[Abstract]
[Full Text]
-
Friedman, J., Meharenna, Y. T., Wilks, A., Poulos, T. L.
(2007). Diatomic Ligand Discrimination by the Heme Oxygenases from Neisseria meningitidis and Pseudomonas aeruginosa. J. Biol. Chem.
282: 1066-1071
[Abstract]
[Full Text]
-
Puri, S., O'Brian, M. R.
(2006). The hmuQ and hmuD Genes from Bradyrhizobium japonicum Encode Heme-Degrading Enzymes.. J. Bacteriol.
188: 6476-6482
[Abstract]
[Full Text]
-
Paiva-Silva, G. O., Cruz-Oliveira, C., Nakayasu, E. S., Maya-Monteiro, C. M., Dunkov, B. C., Masuda, H., Almeida, I. C., Oliveira, P. L.
(2006). A heme-degradation pathway in a blood-sucking insect. Proc. Natl. Acad. Sci. USA
103: 8030-8035
[Abstract]
[Full Text]
-
Lansky, I. B., Lukat-Rodgers, G. S., Block, D., Rodgers, K. R., Ratliff, M., Wilks, A.
(2006). The Cytoplasmic Heme-binding Protein (PhuS) from the Heme Uptake System of Pseudomonas aeruginosa Is an Intracellular Heme-trafficking Protein to the {delta}-Regioselective Heme Oxygenase. J. Biol. Chem.
281: 13652-13662
[Abstract]
[Full Text]
-
Skaar, E. P., Gaspar, A. H., Schneewind, O.
(2006). Bacillus anthracis IsdG, a Heme-Degrading Monooxygenase. J. Bacteriol.
188: 1071-1080
[Abstract]
[Full Text]
-
Bibb, L. A., King, N. D., Kunkle, C. A., Schmitt, M. P.
(2005). Analysis of a Heme-Dependent Signal Transduction System in Corynebacterium diphtheriae: Deletion of the chrAS Genes Results in Heme Sensitivity and Diminished Heme-Dependent Activation of the hmuO Promoter. Infect. Immun.
73: 7406-7412
[Abstract]
[Full Text]
-
Ducey, T. F., Carson, M. B., Orvis, J., Stintzi, A. P., Dyer, D. W.
(2005). Identification of the Iron-Responsive Genes of Neisseria gonorrhoeae by Microarray Analysis in Defined Medium. J. Bacteriol.
187: 4865-4874
[Abstract]
[Full Text]
-
Wang, J., Lad, L., Poulos, T. L., de Montellano, P. R. O.
(2005). Regiospecificity Determinants of Human Heme Oxygenase: DIFFERENTIAL NADPH- AND ASCORBATE-DEPENDENT HEME CLEAVAGE BY THE R183E MUTANT. J. Biol. Chem.
280: 2797-2806
[Abstract]
[Full Text]
-
Wegele, R., Tasler, R., Zeng, Y., Rivera, M., Frankenberg-Dinkel, N.
(2004). The Heme Oxygenase(s)-Phytochrome System of Pseudomonas aeruginosa. J. Biol. Chem.
279: 45791-45802
[Abstract]
[Full Text]
-
Wang, J., Niemevz, F., Lad, L., Huang, L., Alvarez, D. E., Buldain, G., Poulos, T. L., de Montellano, P. R. O.
(2004). Human Heme Oxygenase Oxidation of 5- and 15-Phenylhemes. J. Biol. Chem.
279: 42593-42604
[Abstract]
[Full Text]
-
Wyckoff, E. E., Schmitt, M., Wilks, A., Payne, S. M.
(2004). HutZ Is Required for Efficient Heme Utilization in Vibrio cholerae. J. Bacteriol.
186: 4142-4151
[Abstract]
[Full Text]
-
Hirotsu, S., Chu, G. C., Unno, M., Lee, D.-S., Yoshida, T., Park, S.-Y., Shiro, Y., Ikeda-Saito, M.
(2004). The Crystal Structures of the Ferric and Ferrous Forms of the Heme Complex of HmuO, a Heme Oxygenase of Corynebacterium diphtheriae. J. Biol. Chem.
279: 11937-11947
[Abstract]
[Full Text]
-
Perkins-Balding, D., Ratliff-Griffin, M., Stojiljkovic, I.
(2004). Iron Transport Systems in Neisseria meningitidis. Microbiol. Mol. Biol. Rev.
68: 154-171
[Abstract]
[Full Text]
-
Skaar, E. P., Gaspar, A. H., Schneewind, O.
(2004). IsdG and IsdI, Heme-degrading Enzymes in the Cytoplasm of Staphylococcus aureus. J. Biol. Chem.
279: 436-443
[Abstract]
[Full Text]
-
Perkins-Balding, D., Baer, M. T., Stojiljkovic, I.
(2003). Identification of functionally important regions of a haemoglobin receptor from Neisseria meningitidis. Microbiology
149: 3423-3435
[Abstract]
[Full Text]
-
Friedman, J., Lad, L., Deshmukh, R., Li, H., Wilks, A., Poulos, T. L.
(2003). Crystal Structures of the NO- and CO-bound Heme Oxygenase from Neisseriae meningitidis: IMPLICATIONS FOR O2 ACTIVATION. J. Biol. Chem.
278: 34654-34659
[Abstract]
[Full Text]
-
Muramoto, T., Tsurui, N., Terry, M. J., Yokota, A., Kohchi, T.
(2002). Expression and Biochemical Properties of a Ferredoxin-Dependent Heme Oxygenase Required for Phytochrome Chromophore Synthesis. Plant Physiol.
130: 1958-1966
[Abstract]
[Full Text]