Previous Article | Next Article 
Journal of Bacteriology, December 2001, p. 6763-6770, Vol. 183, No. 23
Environmental Engineering and Science,
Department of Civil and Environmental
Engineering,1 and Department of
Biological Sciences,2 Stanford University,
Stanford, California 94305-4020
Received 18 May 2001/Accepted 23 August 2001
Biochemical studies in Azoarcus sp. strain T have
demonstrated that anaerobic oxidation of both toluene and
m-xylene is initiated by addition of the aromatic
hydrocarbon to fumarate, forming benzylsuccinate and 3-methyl
benzylsuccinate, respectively. Partially purified benzylsuccinate
synthase was previously shown to catalyze both of these addition
reactions. In this study, we identified and sequenced the genes
encoding benzylsuccinate synthase from Azoarcus sp.
strain T and examined the role of this enzyme in both anaerobic toluene
and m-xylene mineralization. Based on reverse
transcription-PCR experiments and transcriptional start site mapping,
we found that the structural genes encoding benzylsuccinate synthase,
bssCAB, together with two additional genes,
bssD and bssE, were organized in an
operon in the order bssDCABE. bssD is believed to encode an activating enzyme, similar in function to pyruvate formate-lyase activase. bssE shows homology to tutH
from Thauera aromatica strain T1, whose function is
currently unknown. A second operon that is upstream of
bssDCABE and divergently transcribed contains two genes,
tdiS and tdiR. The predicted amino acid
sequences show similarity to sensor kinase and response regulator
proteins of prokaryotic two-component regulatory systems. A chromosomal
null bssA mutant was constructed (the bssA
gene encodes the Azoarcus sp.
strain T is a facultative microorganism capable of mineralizing both
toluene and m-xylene anaerobically with nitrate as the
electron acceptor. Based on biochemical studies, a pathway for
anaerobic oxidation of toluene has been proposed (2, 6).
In this pathway, a novel enzyme, benzylsuccinate synthase, catalyzes
the addition of the methyl group of toluene to fumarate to form
benzylsuccinate (Fig. 1). Benzylsuccinate is then oxidized to benzoyl-coenzyme A (CoA), a central intermediate in
anaerobic aromatic hydrocarbon metabolism. Other studies have shown
that this fumarate addition reaction is found in a wide range of
microorganisms capable of anaerobic toluene mineralization, including
other denitrifying bacteria, Thauera aromatica strain K172
and strain EbN1 (6, 27), several sulfate-reducing bacteria (3, 27), an anoxygenic phototrophic bacterium
(35), and a methanogenic mixed culture (1).
Detection of benzylsuccinate in cultures of the toluene-degrading
Azoarcus tolulyticus Tol-4 and Thauera aromatica
strain T1 suggests that a fumarate addition reaction may also be
involved in anaerobic toluene mineralization in these microorganisms
(7, 13). In addition, recent work has suggested that
m-xylene (16), m-cresol
(24), p-cresol (25), and the
aliphatic hydrocarbons n-hexane (28) and
n-dodecane (18) are also activated
anaerobically by a fumarate addition reaction. Thus, it appears that
the formation of benzylsuccinate, or a corresponding succinate
derivative, is a common mode for initiating anaerobic mineralization of
methylbenzenes, methylphenols, and long-chain n-alkanes.
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.23.6763-6770.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Benzylsuccinate Synthase of Azoarcus
sp. Strain T: Cloning, Sequencing, Transcriptional Organization, and
Its Role in Anaerobic Toluene and m-Xylene
Mineralization
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
-subunit of benzylsuccinate synthase). This
bssA null mutant strain was unable to grow under
denitrifying conditions on either toluene or m-xylene,
while growth on benzoate was unaffected. The growth phenotype of the
bssA mutant could be rescued by reintroducing bssA in trans. These results demonstrate
that benzylsuccinate synthase catalyzes the first step in anaerobic
mineralization of both toluene and m-xylene.
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
View larger version (7K):
[in a new window]
FIG. 1.
Addition of toluene and m-xylene to
fumarate catalyzed by benzylsuccinate synthase. R = H for toluene
and R = CH3 for m-xylene.
Benzylsuccinate synthase has been purified from Thauera
aromatica strain K172 and Azoarcus sp. strain T and
shown to have an
2
2
2
composition (5, 22). The enzyme was shown to be irreversibly inactivated in the presence of molecular oxygen by oxygenolytic cleavage of the subunit of benzylsuccinate synthase (22). Furthermore, toluene addition to fumarate is
believed to occur by a radical mechanism because the H atom abstracted from the methyl group of toluene during addition to fumarate is retained in the succinyl moiety of benzylsuccinate (2).
These observations, in conjunction with the sequence similarity of the subunit of benzylsuccinate synthase to glycyl radical proteins, suggested that benzylsuccinate synthase may be a glycyl radical enzyme.
In addition, recent electron paramagnetic resonance studies have shown
the presence of a glycyl radical in samples of active benzylsuccinate
synthase purified from Azoarcus sp. strain T, demonstrating
experimentally that benzylsuccinate synthase is a glycyl radical enzyme
(17).
The genes encoding benzylsuccinate synthase have been independently
identified in two microorganisms, T. aromatica strains T1
and K172, by a genetic and a reverse genetic approach, respectively. In
T. aromatica strain T1, mutants defective in toluene
utilization and benzylsuccinate formation were isolated
(10). Complementation studies with these mutants led to
the identification of several open reading frames, including
tutE, tutFDGH, tutCB, and
tutC1B1 (9, 10, 21). Based on N-terminal amino
acid sequences of benzylsuccinate synthase purified from T. aromatica strain K172, bssDCAB and tdiSR
were cloned and sequenced in this microorganism (22). The
bssCAB genes show similarity to the tutFDG genes, which encode the , , and subunits of benzylsuccinate
synthase, respectively. The predicted amino acid sequence of
bssA shows similarity to the anaerobic glycyl radical
enzymes pyruvate formate-lyase (PFL) and anaerobic ribonucleotide
reductase (ARNR) (9, 22). The glycyl radical in PFL
and ARNR is posttranslationally generated by PFL
activase and ARNR activase, respectively. The predicted translation products of bssD and tutE show
homology to these activases and have been proposed to perform a similar
function. tutCB, tutC1B1, and tdiSR
encode proteins with homology to sensor kinase and response regulator
proteins of bacterial two-component regulatory systems.
Although the predicted amino acid sequences of the benzylsuccinate
synthases from T. aromatica strains K172 and T1 are almost identical, several differences exist in the organization of the genes
in the bss/tut regions in these two strains (Fig.
2B). In T. aromatica strain
T1, the tdiSR homologs tutC1B1 are separated from
the bssDCAB homologs, tutE and tutFDG,
by genes encoding another sensor kinase/response regulator pair, called
tutCB (21). tutCB is transcribed
divergently from both tutC1B1 and tutE. The gene
products of tutCB more closely resemble the sensor
kinases/response regulators believed to control aerobic toluene
oxidation, including TodST, than the gene products of tdiSR
(21). Since T. aromatica strain T1 is capable
of both aerobic and anaerobic toluene oxidation, Leuthner et al. have
proposed that TutC1B1 may be responsible for control of anaerobic
toluene oxidation, while TutCB controls aerobic toluene oxidation
(21). Notably, tutCB homologs are not observed
in the vicinity of the bss operon in T. aromatica strain K172. Instead, tdiSR and bssDCAB are
transcribed in the same direction and are not separated by any
additional open reading frames (21).
|
The transcriptional organization of the bss/tut genes also appears to be different in T. aromatica strains K172 and T1. In T. aromatica strain K172, Northern blot studies of toluene-grown cells showed that bssDCAB are cotranscribed. No bssDCAB mRNA was observed when the cells were grown on benzoate (22). In contrast, in T. aromatica strain T1, Northern blot and primer extension studies suggested that the bssD homolog tutE is transcribed independently from the bssCAB homologs tutFDG. tutFDG are cotranscribed with tutH, a gene downstream of tutG whose predicted amino acid sequence is similar to that of the NorQ/NirQ family of proteins. No tutFDGH mRNA was observed when cells were grown on pyruvate (8). No sequence data downstream of bssDCAB have been reported for T. aromatica strain K172, and it is unknown if a tutH homolog exists in T. aromatica strain K172.
In contrast to T. aromatica strains K172 and T1, Azoarcus sp. strain T is able to mineralize both toluene and m-xylene anaerobically. Furthermore, the specific activity of purified benzylsuccinate synthase from Azoarcus sp. strain T is relatively high compared to the enzyme purified from T. aromatica strain K172 (5). As a result, several studies of the benzylsuccinate synthase from Azoarcus sp. strain T have led to insights into this enzyme's reaction mechanism, including H atom retention in the benzylsuccinate product (2), stereoselectivity and substrate specificity of the benzylsuccinate synthase reaction (4, 5), and demonstration of a glycyl radical signal (17). However, the genes encoding benzylsuccinate synthase, their genetic organization, regulation, and function in anaerobic toluene and m-xylene mineralization have not been studied in Azoarcus sp. strain T.
In this study, we report the cloning and sequencing of the
bssDCAB and tdiSR homologs from
Azoarcus sp. strain T. Operon structures were determined by
reverse transcription-PCR (RT-PCR) and primer extension studies.
Transcriptional start sites were used to determine putative promoter
regions. Analysis of the growth phenotype of a bssA
mutant demonstrated that BssA is essential for both toluene and
m-xylene mineralization in Azoarcus sp. strain T.
| |
MATERIALS AND METHODS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
|
|---|
Growth conditions.
The bacterial strains, plasmids, and
phages used in this study are described in Table
1. Azoarcus sp. strain T (DSM
9506) was grown at 30°C aerobically with benzoate (12)
or at room temperature under denitrifying conditions with benzoate,
toluene, or m-xylene, as described before (16).
Escherichia coli was grown at 37°C in Luria-Bertani (LB)
medium. Growth was monitored as absorbance at 600 nm. Antibiotics were
used at the following concentrations: E. coli,
oxytetracycline, 25 µg/ml; carbenicillin, 100 µg/ml; and kanamycin,
50 µg/ml; Azoarcus sp. strain T, kanamycin, 50 µg/ml;
and oxytetracycline, 10 µg/ml.
|
Cloning and DNA manipulations.
Standard protocols were used
for cloning and transformations of E. coli
(29). The DNA packaging kit from Boehringer-Mannheim, Indianapolis, Ind., was used to prepare the cosmid library. Plasmids were introduced into Azoarcus sp. strain T by
electroporation. Briefly, cells of Azoarcus sp. strain T
were grown aerobically to an optical density at 600 nm
(OD600) of 
0.3, centrifuged at 4°C, washed
twice with cold distilled water, and then resuspended to an
OD600 of >200. Cells were mixed with DNA in a
cold cuvette and exposed to 2 µF, 1.5 kV, and 200 
. Time constants
were about 4.5 ms. Cells were outgrown at 30°C for 10 h in
aerobic growth medium (12) augmented with 0.2% yeast
extract and 0.5% Casamino Acids (see reference 11) before
plating on selective medium.
Construction of a DNA library.
Chromosomal DNA from
Azoarcus sp. strain T was partially digested with
Sau3A and size fractionated by ultracentrifugation in a
linear 10 to 40% sucrose gradient. Fractions containing DNA fragments
in the size range of 18 to 28 kb were pooled and dephosphorylated. DNA
fragments were then ligated to pLAFR5-SK1 digested with
BamHI. The ligated DNA was packaged into 
bacteriophage
with the DNA packaging kit obtained from Boehringer Mannheim
Biochemicals (Indianapolis, Ind.). The phage particles were transduced
into E. coli DH10B, and colonies were grown on LB agar
containing oxytetracycline (25 µg/ml). Microtiter wells were filled
with LB and inoculated with single colonies, and after an overnight
incubation, they were augmented with 20% glycerol and stored at
80°C.
Plasmid constructions. p810F is a cosmid clone containing an approximately 25-kb insert of Azoarcus sp. strain T chromosomal DNA, of which 9.5 kb was sequenced in this study. Subclones of this cosmid were constructed in pBluescript II KS+. pGA1 contains a 5.3-kb HindIII insert encoding the 3' end of bssD, bssCABE, and the 5' end of orf2. pGA11 contains a 4.2-kb HindIII/XbaI fragment encoding tdiSR and the 5' end of bssD. pGA5 is a deletion subclone of pGA1 (see below). pGA6 contains the insert of pGA5 in pBJ113. pGA14 contains the insert of pGA1 in pRK415 (15).
DNA sequencing and sequence analysis. Plasmid DNA for sequencing was purified using Qiagen Plasmid Kits (Qiagen Inc., Chatsworth, Calif.). The insert of pGA1 was sequenced by Bio 101, La Jolla, Calif. All other DNA sequencing was performed by the Stanford University Protein and Nucleic Acid (PAN) facility using Big Dye terminator cycle sequencing (Perkin Elmer, Foster City, Calif.). DNA sequences were analyzed with the University of Wisconsin Genetics Computer Group software package, version 10.0. Similar sequences were identified using the Blast network service at the National Center for Biotechnology Information (NCBI; version 2.1.2, 13 November 2000) (Bethesda, Md.).
Construction of a bssA null mutant.
An
in-frame deletion of bssA was constructed by the method of
Link et al. (23). PCR deletion products were constructed
in two steps. In the first step, two different PCRs generated fragments to the left and right of the bssA sequence targeted for
deletion. In the second step, the left and right fragments were
annealed at the overlapping region included in the internal primers and amplified by PCR as a single fragment using external primers. Internal
primers were bssNi,
5'CCCATCCACTAAACTTAAACACARCAYTTNCCYTTRTARTC3', and bssCi,
5'TGTTTAAGTTTAGTGGATGGGAAYACNAUHAUHGCNCG3' (H is A, C, or T; N is A, C, G, or T; R is A or G; and Y is C or T). Universal primers were used as external primers. The internal primers were designed so that only 116 bp of the 2.6-kb bssA gene remain
in the final bssA mutant. The final PCR product was
digested with HindIII and cloned into pBluescript KS+ to
form pGA5. The disrupted region was sequenced to confirm the in-frame
deletion and then cloned into pBJ113. pBJ113 contains a
positive-negative KG (Kmr/galK) cassette
for creating the two-step integration-excision events during gene
replacement (32).
bssA was grown in nonselective liquid medium and plated
on 1% galactose basal medium. Several segregants were isolated. PCR
and Southern blot analyses of these segregant strains were used to
distinguish between the wild-type and deletion allele by testing for
the presence of bssA and the absence of bssA. One bssA strain was selected for further studies and
designated AST2. The bssA mutant was complemented with
pGA14, which was introduced by electroporation.
RT-PCR. Total RNA was prepared from cells in mid-log phase by the hot phenol method of von Gabain et al. (33). DNA was removed from the RNA by two treatments with RNase-free DNase (Boehringer-Mannheim, Indianapolis, Ind.). RT-PCRs were performed using the Access RT-PCR kit from Promega Corp. (Madison, Wis.). Primers were chosen to produce fragments less than 500 bp in length. Negative control reactions in which reverse transcriptase was omitted from the reaction mixture ensured that DNA products resulted from amplification of cDNA rather than of chromosomal DNA contamination.
Primer extension of mRNA transcripts. The avian myeloblastosis virus reverse transcriptase primer extension system was used to determine the transcriptional start sites of tdiSR, bssDCABE, and orf2 (Promega Corp., Madison, Wis.). Primer extension products were resolved on a 6% polyacrylamide gel containing 7 M urea next to a DNA sequence generated with the same primer (fmol DNA sequencing system; Promega Corp., Madison, Wis.). The oligonucleotides used in these studies included bssDpe (5'TGAACCTCTGTATTTCGGTAACAACA3'), orf2pe2 (5'ACCTTAGGCGGCAATGTACTGAACGT3'), tdiSpe (5'TCCACCGCGACCACGTCATTCTTCAT3'), tdiRpe (5'TCATCGACGACGAACACGGTCGGCGA3'), orf1pe (5'ACAAGCCATTTGTGCTAGGAGAGGT3'), orf1pe2 (5'ATATCTTGGCGAATTTATCGAGAAGCT3'), orf1pe3 (5'ATGATCTATCGTCAACGCGGT3'), bssbpe (5'CCGCTTCCATGTTATGG3'), and bssCpe (5'CCAAAGGTATCTACTCAG3').
Northern blotting. Hybridization was performed in RapidHyb buffer at 70°C according to the manufacturer's instructions (Amersham Pharmacia Biotech, Piscataway, N.J.). An RNA probe for the 3' end of bssD, approximately 800 bp in size and called bssD3, was produced using the Riboprobe T3 system from Promega Corp. (Madison, Wis.). pGA10 digested with SmaI was the template.
Nucleotide sequence accession number. All sequence data have been assigned GenBank accession number AY032676.
| |
RESULTS AND DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
|
|---|
Cloning of benzylsuccinate synthase and neighboring genes. In a genetic approach to identifying genes involved in anaerobic toluene utilization in T. aromatica strain T1, several mutants defective in anaerobic toluene mineralization and benzylsuccinate formation were identified (P. W. Coschigano, Abstr. 97th Annu. Meet. Am. Soc. Microbiol. 1997, p. 493). One of the mutations mapped to a gene, tutD, whose predicted amino acid sequence showed homology to pyruvate formate-lyase. Based on two regions of amino acid identity in TutD and pyruvate formate-lyase, GNDDD (Gly568 in E. coli pyruvate formate-lyase) and RVSGY (Gly734 in E. coli pyruvate formate-lyase), we designed degenerate primers, and a 162-bp fragment, called bss1, was amplified from Azoarcus sp. strain T chromosomal DNA.
The bss1 fragment was cloned and sequenced. The predicted amino acid sequence of bss1 showed homology to both pyruvate formate-lyase and TutD (data not shown). Using the bss1 fragment to probe a colony blot containing approximately 1,050 clones of a cosmid library of chromosomal DNA from Azoarcus sp. strain T identified a single hybridizing cosmid clone, p810F. A 5.3-kb HindIII fragment and a 4.2-kb XbaI/HindIII fragment from p810F were cloned into pBluescript KS+ and sequenced. Eight open reading frames were identified and, based on similarity to genes identified in T. aromatica strain K172 (22), were named tdiR, tdiS, bssD, bssC, bssA, bssB, bssE, and orf2 (Fig. 2A). The open reading frames designated bssC, bssA, and bssB from Azoarcus sp. strain T, encoding the, , and subunits of benzylsuccinate synthase, respectively,
have predicted translational start codons at
A4344TG, A4550TG, and
A7221TG, respectively. The start codons of
bssC, bssA, and bssB are preceded by
likely ribosome-binding sites, A4331GGAG,
A4539GGAG, and T7209GGAG,
respectively. bssC, bssA, and bssB
have predicted stop codons at T4524AA,
T7142GA, and T7449GA,
respectively. The encoded proteins BssA, BssB, and BssC have calculated
molecular masses of 97,483 Da, 8,808 Da, and 6,964 Da, respectively.
These masses are similar to published data on the benzylsuccinate
synthase subunits from Azoarcus sp. strain T and T. aromatica K172 (5, 22). The predicted translation products of bssC, bssA, and bssB show
about 90% identity to TutF, TutD, and TutG, respectively, from
T. aromatica strain T1 and between 60 and 80% identity to
BssC, BssA, and BssB, respectively, from T. aromatica strain
K172. Sequence analysis using Terminator (University of Wisconsin
Genetics Computer Group software package, version 10.0) shows a
potential weak rho-independent terminator 22 bp downstream of the
predicted translational stop site for bssB.
The bssD gene, predicted to encode the activating enzyme for
benzylsuccinate synthase, begins at G3327TG and
ends at T4323AA. BssD has a predicted molecular
mass of 37,764 Da and shows approximately 70% identity to BssD and
TutE from T. aromatica strains K172 and T1, respectively.
The motif CX3CX2C, proposed to coordinate a [4Fe-4S] cluster at the N termini of pyruvate formate-lyase-activating enzymes (19) and anaerobic
ribonucleotide reductase activating-enzymes (31), is
present, with sequence CPLRCPWC, at the N termini of all three
benzylsuccinate synthase-activating proteins, beginning at
Cys29 in Azoarcus sp. strain T. These
proteins also contain two additional cysteine clusters of the form
CX2CX2CX3C,
C55VGCGRCMAVC, and
C89QRCMRCVAAC in the predicted amino acid
sequence of BssD in Azoarcus sp. strain T, a motif conserved
in ferredoxins with two [4Fe-4S] clusters (34). This
ferredoxin motif is not found in either the pyruvate formate-lyase
activating enzyme or the anaerobic ribonucleotide reductase activating enzyme.
The bssE gene of Azoarcus sp. T is predicted to
start at A7499TG and end at
T8357AA. BssE has a predicted molecular mass of
31,818 Da and is 97% identical to the gene product of tutH
from T. aromatica strain T1. Currently, the function of TutH
is unknown, although it shows homology to the NorQ/NirQ family of
proteins. No obvious ribosome-binding site is observed upstream of the
predicted translational start of bssE. orf2 is predicted to
start at A8368TG. There is a potential
ribosome-binding site before the translational start site of
orf2, T8357AAGG. No translational stop
for orf2 was identified in the present nucleotide sequence,
but the predicted gene product would be larger than 59,578 Da. An NCBI
Blast search in the nonredundant GenBank, PDB, SwissProt, PIR, and PRF
databases revealed no significant similarity between the deduced
incomplete amino acid sequence of orf2 and any other known protein.
The predicted gene products of tdiSR show homology to sensor
kinase and response regulator proteins of bacterial two-component regulatory systems. tdiS and tdiR are predicted
to start at A3021TG and
A1314TG and end at T1386AG
and T660GA, respectively. TdiS and TdiR have
predicted molecular masses of 61,694 Da and 24,220 Da, respectively,
and show approximately 95% identity to TdiS and TdiR of T. aromatica strain K172 and about 80% identity to TutC1 and TutB1
from T. aromatica strain T1, respectively. The
tdiSR genes are oriented in the direction opposite that of
the bssDCABE and orf2 genes. The predicted ATG start codon of tdiS is 305 bp upstream of the predicted GTG
start codon of bssD. tdiS and tdiR are preceded
by excellent ribosome-binding sites, A3036GGAGG
and A1325GGAGG, respectively. There is a
potential strong rho-independent terminator 22 bp downstream of the
predicted translational stop site of tdiR.
Since benzylsuccinate synthase is a glycyl radical-containing enzyme
which is irreversibly inactivated in the presence of molecular oxygen,
we considered that its expression might be controlled by regulatory
elements similar to those that control expression of pyruvate
formate-lyase. Expression of pfl is controlled by several
regulators, including FNR (fumarate-nitrate reduction regulator), ArcA, NarL, and IHF (integration host factor) in response to oxygen, nitrate, and pyruvate (see review in reference
30). We searched the sequenced region for consensus
binding sites for these regulatory molecules, but no perfect matches
were found. Further studies will be necessary to determine if any of
these regulatory proteins play a role in the control of expression of the bss operon.
The organization of the bss and tdi genes in
Azoarcus sp. strain T is quite different from the
organization of homologous genes in Thauera aromatica
strains. In T. aromatica strains K172 and T1,
tdiSR and tutB1C1 are transcribed in the same
direction as bssDCAB and tutEFGH, respectively
(21) (Fig. 2B). In contrast, in Azoarcus sp.
strain T, a putative sensor kinase/response regulator system, closely
related to tdiSR and tutB1C1, is encoded upstream of the bssDCABE genes, but is transcribed divergently to
bssDCABE.
Transcriptional organization of tdiSR and
bssDCABE operons.
RT-PCR experiments using total
RNA harvested from toluene-grown cells of Azoarcus sp.
strain T were used to determine which open reading frames are
cotranscribed. Amplification products were obtained using primers
complementary to neighboring open reading frames to amplify the
intergenic regions between tdiS and tdiR
(expected size, 320 bp), bssD and bssC (expected
size, 340 bp), bssC and bssA (expected size, 553 bp), bssA and bssB (expected size, 240 bp),
bssB and bssE (expected size, 265 bp), and
bssE and orf2 (expected size, 310 bp). Controls
without reverse transcriptase were negative, indicating the absence of
chromosomal DNA (Fig. 3). The RT-PCR
fragments obtained were of the expected sizes. The presence of these
RT-PCR products suggests that the tdiS and tdiR
genes, as well as the bssDCABE genes, are each cotranscribed as an operon.
|
70 promoter, including two sequences, TTAAAT
and TAAATT, which lie 5 and 6 bp upstream of the +1 transcriptional
start site, respectively, and match the E. coli
70 10 consensus sequence (TATAAT) at four of
the six positions. A sequence (TGGTCA) starting at 29 matches the
E. coli 70 35 consensus sequence
(TTGACA) at four of the six positions. The same transcriptional start
site was observed when total RNA from m-xylene-grown cells
was used. No primer extension product was observed when total RNA from
benzoate-grown cells was used as the template for reverse transcription
reactions. Therefore, bssDCABE is probably controlled in the
same way when Azoarcus sp. strain T is growing in the
presence of either toluene or m-xylene. No extension product
was observed when primers (names in parentheses) were used from
bssC (bssCpe), bssB (bssBpe), or bssE
(orf1pe, orf1pe2, and orf1pe3).
|
70
promoter, including a sequence (TAACAC) 8 bp upstream of the +1
transcriptional start site that matched the E. coli
70 10 consensus sequence (TATAAT) at three
of the six positions. However, there is no obvious 35 sequence. No
extension product was observed when a primer (tdiRpe) from within the
tdiR gene was used.
Although RT-PCR experiments are consistent with orf2 being
cotranscribed with bssDCABE, a transcriptional start site of
orf2 was mapped 84 bp upstream of the putative ATG
initiation codon of orf2 at a thymine residue (Fig.
5). Further inspection of this region
revealed that the putative orf2 promoter region contains a
sequence (AAGAAG) 13 bp upstream of the +1 transcriptional start site
that matches the E. coli 70 10
consensus sequence (TATAAT) at three of the six positions. A sequence
(GTGACG) starting at 34 matches the E. coli
70 35 consensus sequence (TTGACA) at four of
the six positions. While there is some sequence similarity, the spacing
of these potential promoter sequences is not ideal. Typically, the
canonical 10 sequence begins 5 to 9 bp before the transcriptional
start, and the 35 sequence begins 17 bp after the 10 region. The
same transcriptional start site was observed when total RNA from
m-xylene-grown cells was used. No primer extension product
was observed when total RNA from benzoate-grown cells was used.
|
Phenotype of a bssA mutant.
Azoarcus sp. strain T is able to grow anaerobically with
either toluene or m-xylene as the sole carbon source and
electron donor. Biochemical studies have established that the
conversion of toluene and m-xylene to benzoyl-CoA and
3-methylbenzoyl-CoA, respectively, occurs by similar pathways
(16). Notably, the addition of both toluene and
m-xylene to fumarate has been observed at almost equal rates
in studies with permeabilized cells of Azoarcus sp. strain
T, regardless of whether the cells were grown on toluene or
m-xylene (16). Furthermore, only a single copy
of a bssA-like gene was observed in Southern blot studies of
the chromosomal DNA of Azoarcus sp. strain T (data not
shown). These observations suggested that the benzylsuccinate synthase
and 3-methylbenzylsuccinate synthase reactions may be catalyzed by the
same enzyme in vivo. In order to test this hypothesis, we constructed a
bssA mutant and analyzed its growth phenotype.
|
70 consensus sequence.
Primer extension studies and Northern blots show that the expression
pattern of the bssDCABE operon is the same under toluene and
m-xylene growth conditions. The growth phenotype of a
bssA mutant, AST2, provided the first genetic evidence in
Azoarcus sp. strain T that benzylsuccinate synthase is
required for growth on both toluene and m-xylene, but not on benzoate.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by NSF Career Award 9733535 and NSF MCB grant 9723312 to A.M.S. G.R.A. was the recipient of a Stanford Graduate Fellowship, and A.M.R. was supported by a postdoctoral fellowship (EX9411417811) from the Ministerio de Educación y Ciencia, Spain.
We thank Dale Kaiser and Bryan Julien for providing strains and plasmids. We also thank Jimmy Jakobsen, Cynthia Krieger, Dale Pelletier, and Mandy Ward for technical advice and useful discussions.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Environmental Engineering and Science, Department of Civil and Environmental Engineering, Stanford University, Stanford, CA 94305-4020. Phone: (650) 723-3668. Fax: (650) 725-3164. E-mail: spormann{at}stanford.edu.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
|
|---|
| 1. |
Beller, H. R., and E. A. Edwards.
2000.
Anaerobic toluene activation by benzylsuccinate synthase in a highly enriched methanogenic culture.
Appl. Environ. Microbiol.
66:5503-5505 |
| 2. |
Beller, H. R., and A. M. Spormann.
1997.
Anaerobic activation of toluene and o-xylene by addition to fumarate in denitrifying strain T.
J. Bacteriol.
179:670-676 |
| 3. | Beller, H. R., and A. M. Spormann. 1997. Benzylsuccinate formation as a means of anaerobic toluene activation by sulfate-reducing strain PRTOL1. Appl. Environ. Microbiol. 63:3729-3731[Abstract]. |
| 4. |
Beller, H. R., and A. M. Spormann.
1998.
Analysis of the novel benzylsuccinate synthase reaction for anaerobic toluene activation based on structural studies of the product.
J. Bacteriol.
180:5454-5457 |
| 5. | Beller, H. R., and A. M. Spormann. 1999. Substrate range of benzylsuccinate synthase from Azoarcus sp. strain T. FEMS Microbiol. Lett. 178:147-153[CrossRef][Medline]. |
| 6. | Biegert, T., G. Fuchs, and J. Heider. 1996. Evidence that anaerobic oxidation of toluene in the denitrifying bacterium Thauera aromatica is initiated by formation of benzylsuccinate from toluene and fumarate. Eur. J. Biochem. 238:661-668[Medline]. |
| 7. | Chee-Sanford, J. C., J. W. Frost, M. R. Fries, J. Zhou, and J. M. Tiedje. 1996. Evidence for acetyl coenzyme A and cinnamoyl coenzyme A in the anaerobic toluene mineralization pathway in Azoarcus tolulyticus Tol-4. Appl. Environ. Microbiol. 62:964-973[Abstract]. |
| 8. |
Coschigano, P. W.
2000.
Transcriptional analysis of the tutE tutFDGH gene cluster from Thauera aromatica strain T1.
Appl. Environ. Microbiol.
66:1147-1151 |
| 9. |
Coschigano, P. W.,
T. S. Wehrman, and L. Y. Young.
1998.
Identification and analysis of genes involved in anaerobic toluene metabolism by strain T1: putative role of a glycine free radical.
Appl. Environ. Microbiol.
64:1650-1656 |
| 10. | Coschigano, P. W., and L. Y. Young. 1997. Identification and sequence analysis of two regulatory genes involved in anaerobic toluene metabolism by strain T1. Appl. Environ. Microbiol. 63:652-660[Abstract]. |
| 11. |
Dispensa, M.,
C. T. Thomas,
M.-K. Kim,
J. A. Perrotta,
J. Gibson, and C. S. Harwood.
1992.
Anaerobic growth of Rhodopseudomonas palustris on 4-hydroxybenzoate is dependent on AadR, a member of the cyclic AMP receptor protein family of transcriptional regulators.
J. Bacteriol.
174:5803-5813 |
| 12. | Dolfing, J., J. Zeyer, E. P. Binder, and R. P. Schwarzenbach. 1990. Isolation and characterization of a bacterium that mineralizes toluene in the absence of molecular oxygen. Arch. Microbiol. 154:336-341[Medline]. |
| 13. |
Evans, P. J.,
W. Ling,
B. Goldschmidt,
E. R. Ritter, and L. Y. Young.
1992.
Metabolites formed during anaerobic transformation of toluene and o-xylene and their proposed relationship to the initial steps of toluene mineralization.
Appl. Environ. Microbiol.
58:496-501 |
| 14. |
Julien, B.,
A. D. Kaiser, and A. Garza.
2000.
Spatial control of cell differentiation in Myxococcus xanthus.
Proc. Natl. Acad. Sci. USA
97:9098-9103 |
| 15. | Keen, N. T., S. Tamaki, D. Kobayashi, and D. Trollinger. 1988. Improved broad-host-range plasmids for DNA cloning in Gram-negative bacteria. Gene 70:191-198[CrossRef][Medline]. |
| 16. |
Krieger, C. J.,
H. R. Beller,
M. Reinhard, and A. M. Spormann.
1999.
Initial reactions in anaerobic oxidation of m-xylene by the denitrifying bacterium Azoarcus sp. strain T.
J. Bacteriol.
181:6403-6410 |
| 17. |
Krieger, C. J.,
W. Roseboom,
S. P. J. Albracht, and A. M. Spormann.
2001.
A stable organic free radical in anaerobic benzylsuccinate synthase of Azoarcus sp. strain T.
J. Biol. Chem.
276:12924-12927 |
| 18. |
Kropp, K. G.,
I. A. Davidova, and J. M. Suflita.
2000.
Anaerobic oxidation of n-dodecane by an addition reaction in a sulfate-reducing bacterial enrichment culture.
Appl. Environ. Microbiol.
66:5393-5398 |
| 19. |
Kulzer, R.,
T. Pils,
R. Kappl,
J. Hutterman, and J. Knappe.
1998.
Reconstitution and characterization of the polynuclear iron-sulfur cluster in pyruvate formate-lyase-activating enzyme.
J. Biol. Chem.
273:4897-4903 |
| 20. | Lee, S. W., and G. Edlin. 1985. Expression of tetracycline resistance in pBR322 derivatives reduces the reproductive fitness of plasmid-containing Escherichia coli. Gene 39:173-180[CrossRef][Medline]. |
| 21. | Leuthner, B., and J. Heider. 1998. A two-component system involved in regulation of anaerobic toluene metabolism in Thauera aromatica. FEMS Microbiol. Lett. 166:35-41[CrossRef][Medline]. |
| 22. | Leuthner, B., C. Leutwein, H. Schulz, P. Hörth, W. Haehnel, E. Schiltz, H. Schägger, and J. Heider. 1998. Biochemical and genetic characterization of benzylsuccinate synthase from Thauera aromatica: a new glycyl radical enzyme catalysing the first step in anaerobic toluene metabolism. Mol. Microbiol. 28:615-628[CrossRef][Medline]. |
| 23. |
Link, A. J.,
D. Phillips, and G. M. Church.
1997.
Methods for generating precise deletions and insertions in the genome of wild-type Escherichia coli: application to open reading frame characterization.
J. Bacteriol.
179:6228-6237 |
| 24. | Muller, J. A., A. S. Galushko, A. Kappler, and B. Schink. 1999. Anaerobic degradation of m-cresol by Desulfobacterium cetonicum is initiated by formation of 3-hydroxybenzylsuccinate. Arch. Microbiol. 172:287-294[CrossRef][Medline]. |
| 25. |
Muller, J. A.,
A. S. Galushko,
A. Kappler, and B. Schink.
2001.
Initiation of anaerobic degradation of p-cresol by formation of 4-hydroxybenzylsuccinate in Desulfobacterium cetonicum.
J. Bacteriol.
183:752-757 |
| 26. | Nguyen, T. N. M., Q. G. Phan, L. P. Duong, K. P. Bertrand, and R. E. Lenski. 1989. Effects of carriage and expression of the Tn10 tetracycline-resistance operon on the fitness of Escherichia coli K12. Mol. Biol. Evol. 6:213-225[Abstract]. |
| 27. | Rabus, R., and J. Heider. 1998. Initial reactions of anaerobic metabolism of alkylbenzenes in denitrifying and sulfate-reducing bacteria. Arch. Microbiol. 170:377-384[CrossRef]. |
| 28. |
Rabus, R.,
H. Wilkes,
A. Behrends,
A. Armstroff,
T. Fischer,
A. J. Pierik, and F. Widdel.
2001.
Anaerobic initial reaction of n-alkanes in a denitrifying bacterium: evidence for (1-methylpentyl)succinate as initial product and for involvement of an organic radical in n-hexane metabolism.
J. Bacteriol.
183:1707-1715 |
| 29. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 30. | Sawers, G. 1999. Biochemistry, physiology and molecular biology of glycyl radical enzymes. FEMS Microbiol. Rev. 22:543-551[CrossRef]. |
| 31. |
Tamarit, J.,
C. Gerez,
C. Meier,
E. Mulliez,
A. Trautwein, and M. Fontecave.
2000.
The activating component of the anaerobic ribonucleotide reductase from Escherichia coli.
J. Biol. Chem.
275:15669-15675 |
| 32. | Ueki, T., S. Inouye, and M. Inouye. 1996. Positive-negative KG cassettes for construction of multigene deletions using a single drug marker. Gene 183:153-157[CrossRef][Medline]. |
| 33. |
von Gabain, A.,
J. G. Belasco,
J. L. Schottel,
A. C. Y. Chang, and S. N. Cohen.
1983.
Decay of mRNA in Escherichia coli: investigation of the fate of specific segments of transcripts.
Proc. Natl. Acad. Sci. USA
80:653-657 |
| 34. | Yasonobu, K. T., and M. Tanaka. 1973. The types, distribution in nature, structure-function, and evolutionary data of the iron-sulfur proteins, p. 27-130. In W. Lovenberg (ed.), Iron-sulfur proteins. Academic Press, New York, N.Y. |
| 35. | Zengler, K., J. Heider, R. Rossello-Mora, and F. Widdel. 1999. Phototrophic utilization of toluene under anoxic conditions by a new strain of Blastochloris sulfoviridis. Arch. Microbiol. 172:204-212[CrossRef][Medline]. |
Journal of Bacteriology, December 2001, p. 6763-6770, Vol. 183, No. 23
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.23.6763-6770.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Carmona, M., Zamarro, M. T., Blazquez, B., Durante-Rodriguez, G., Juarez, J. F., Valderrama, J. A., Barragan, M. J. L., Garcia, J. L., Diaz, E.
(2009). Anaerobic Catabolism of Aromatic Compounds: a Genetic and Genomic View. Microbiol. Mol. Biol. Rev.
73: 71-133
[Abstract] [Full Text] -
Washer, C. E., Edwards, E. A.
(2007). Identification and Expression of Benzylsuccinate Synthase Genes in a Toluene-Degrading Methanogenic Consortium. Appl. Environ. Microbiol.
73: 1367-1369
[Abstract] [Full Text] -
Callaghan, A. V., Gieg, L. M., Kropp, K. G., Suflita, J. M., Young, L. Y.
(2006). Comparison of Mechanisms of Alkane Metabolism under Sulfate-Reducing Conditions among Two Bacterial Isolates and a Bacterial Consortium.. Appl. Environ. Microbiol.
72: 4274-4282
[Abstract] [Full Text] -
Kuhner, S., Wohlbrand, L., Fritz, I., Wruck, W., Hultschig, C., Hufnagel, P., Kube, M., Reinhardt, R., Rabus, R.
(2005). Substrate-Dependent Regulation of Anaerobic Degradation Pathways for Toluene and Ethylbenzene in a Denitrifying Bacterium, Strain EbN1. J. Bacteriol.
187: 1493-1503
[Abstract] [Full Text] -
Tropel, D., van der Meer, J. R.
(2004). Bacterial Transcriptional Regulators for Degradation Pathways of Aromatic Compounds. Microbiol. Mol. Biol. Rev.
68: 474-500
[Abstract] [Full Text] -
Da Silva, M. L. B., Alvarez, P. J. J.
(2004). Enhanced Anaerobic Biodegradation of Benzene-Toluene-Ethylbenzene-Xylene-Ethanol Mixtures in Bioaugmented Aquifer Columns. Appl. Environ. Microbiol.
70: 4720-4726
[Abstract] [Full Text] -
Takeda, H., Yamada, A., Miyauchi, K., Masai, E., Fukuda, M.
(2004). Characterization of Transcriptional Regulatory Genes for Biphenyl Degradation in Rhodococcus sp. Strain RHA1. J. Bacteriol.
186: 2134-2146
[Abstract] [Full Text] -
Shinoda, Y., Sakai, Y., Uenishi, H., Uchihashi, Y., Hiraishi, A., Yukawa, H., Yurimoto, H., Kato, N.
(2004). Aerobic and Anaerobic Toluene Degradation by a Newly Isolated Denitrifying Bacterium, Thauera sp. Strain DNT-1. Appl. Environ. Microbiol.
70: 1385-1392
[Abstract] [Full Text] -
Van Hamme, J. D., Singh, A., Ward, O. P.
(2003). Recent Advances in Petroleum Microbiology. Microbiol. Mol. Biol. Rev.
67: 503-549
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»