Previous Article | Next Article 
Journal of Bacteriology, December 2001, p. 6885-6897, Vol. 183, No. 23
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.23.6885-6897.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Ancestral Divergence, Genome Diversification, and Phylogeographic
Variation in Subpopulations of Sorbitol-Negative,
-Glucuronidase-Negative Enterohemorrhagic Escherichia
coli O157
Jaehyoung
Kim,1
Joseph
Nietfeldt,1
Jingliang
Ju,1
John
Wise,1
Narelle
Fegan,2
Patricia
Desmarchelier,2 and
Andrew
K.
Benson1,*
Department of Food Science and Technology,
University of Nebraska, Lincoln, Nebraska
68583-0919,1 and Food Safety and Quality
Group, Food Science Australia, Cannon Hill, Queensland, Australia,
41702
Received 21 May 2001/Accepted 4 September 2001
 |
ABSTRACT |
The O157:H7 lineage of enterohemorrhagic Escherichia
coli is a geographically disseminated complex of highly related
genotypes that share common ancestry. The common clone that is found
worldwide carries several markers of events in its evolution, including markers for acquisition of virulence genes and loss of physiological characteristics, such as sorbitol fermentation ability and
-glucuronidase production. Populations of variants that are distinct
with respect to motility and the sorbitol and
-glucuronidase markers
appear to have diverged at several points along the inferred
evolutionary pathway. In addition to these variants, distinct
subpopulations of the contemporary non-sorbitol-fermenting,
-glucuronidase-negative O157:H7 clone were recently detected among
bovine and human clinical isolates in the United Stares by using
high-resolution genome comparison. In order to determine if these
recently described subpopulations were derived from a regional or
ancestral divergence event, we used octamer-based genome scanning,
marker sorting, and DNA sequence analysis to examine their phylogenetic
relationship to populations of non-sorbitol-fermenting,
-glucuronidase negative O157:H7 and O157:H
strains from Australia.
The inferred phylogeny is consistent with the hypothesis that
subpopulations on each continent resulted from geographic spread of an
ancestral divergence event and subsequent expansion of distinct
subpopulations. Marker sorting and DNA sequence analyses identified
sets of monophyletic markers consistent with the pattern of divergence
and demonstrated that phylogeographic variation occurred through
emergence of regional subclones and concentration of regional
polymorphisms among distinct subpopulations. DNA sequence analysis of
representative polyphyletic markers showed that genome diversity
accrued through random drift and bacteriophage-mediated events.
 |
INTRODUCTION |
Hemorrhagic colitis is caused
by a number of serotypes of Shiga toxin-producing Escherichia
coli (STEC) (14). Among the clinical STEC strains
that have been isolated, a subset of enterohemorrhagic E. coli (EHEC) strains has been found which carry common sets of
virulence genes that encode factors for attachment to host cells,
elaboration of effector molecules, and production of two different
types of Shiga toxins (22). The sets of virulence genes
are found in the locus of enterocyte effacement (LEE) pathogenicity island, lambdoid bacteriophages, and a large virulence-associated plasmid (8, 9, 23, 25, 26, 31, 32). Population genetic
analysis of EHEC and STEC strains has shown that EHEC strains comprise
two divergent lineages, termed EHEC 1 and EHEC 2, that are only
distantly related but apparently experienced similar pathways of
virulence gene acquisition (24, 28, 38). The EHEC 1 lineage is comprised solely of a geographically disseminated cluster of
strains with related genotypes bearing O157:H7 and O157:H
serotypes,
while the EHEC 2 lineage is serotypically and genotypically more diverse.
The O157 serotype can be found in genetically diverse populations of
E. coli, apparently as a consequence of transfer of a common
allele combination in the gnd-rfb region that encodes the O157 antigen (36). Among the populations bearing the O157
serotype, only the genetically related populations in the serotype
O157:H7 EHEC 1 lineage, including the derived nonmotile O157:H
populations (collectively referred to as O157 EHEC), carry the
combination of virulence genes that includes the genes found in the LEE
island, the large virulence plasmid, and the Shiga toxin-converting
phages (38). A reconstruction of the evolutionary history
of this lineage suggests that it arose from transfer of the O157
gnd-rfb region into an O55:H7 enteropathogenic E. coli host bearing the LEE island and an stx2-converting
prophage (11, 28, 36, 38, 39). In subsequent steps, this
ancestral population lost the ability to ferment sorbitol, was
lysogenized by an stx1-converting phage, and finally
acquired a mutation that inactivated the uidA gene, which
resulted in a loss of
-glucuronidase activity (11, 39).
The contemporary non-sorbitol-fermenting,
-glucuronidase-negative
O157:H7 clone is the EHEC that is most frequently isolated from
hemorrhagic colitis patients in the United States, Canada, Japan, and
the United Kingdom. Significant numbers of nonmotile O157 EHEC strains
have been recovered from samples from continental Europe and Australia
(6, 15, 19, 29). The nonmotile strains found in
continental Europe are sorbitol positive and
-glucuronidase positive, and phylogenetic analysis suggests that they comprise a
population that diverged from an ancestral intermediate of the contemporary O157:H7 clone prior to loss of the sorbitol fermentation and
-glucuronidase production traits (11, 19). In
contrast, nonmotile O157 EHEC strains that are commonly isolated in
Australia are sorbitol negative and
-glucuronidase negative
(29), suggesting that they are members of a more recently
derived population that diverged from the lineage after loss of the
sorbitol fermentation and
-glucuronidase production traits.
In addition to populations of nonmotile variants, two distinct
subpopulations of the widespread non-sorbitol-fermenting,
-glucuronidase-negative O157:H7 clone have been detected in the
United States by high-resolution genome comparison (20).
Strains belonging to these two subpopulations, termed lineages I and
II, appeared to be nonrandomly distributed among the bovine and human
clinical isolates examined and could be distinguished by octamer-based
genome scanning (OBGS) and by restriction fragment length polymorphism
analysis with lambdoid phage probes. Since these studies were conducted
exclusively with United States strains, it was not clear whether one or
both of the subpopulations are regional subclones or whether they
resulted from a more ancestral divergence event.
To determine the ancestry of the lineage I and II subpopulations, we
studied the phylogenetic relationships of representative lineage I and
II O157:H7 strains from the United States to O157 EHEC strains from the
geographically isolated continent Australia. The phylogeny inferred
from cladistic and statistical analyses of OBGS data shows that
populations of O157 EHEC strains isolated from the two continents
comprise two lineages corresponding to the distribution of lineage I
and II United States strains, indicating that the divergence of the two
lineages was ancestral and predated the arrival of the lineages on one
or both continents. Results obtained by sorting polymorphic OBGS
markers relative to the inferred phylogeny of the strains are
consistent with this conclusion and were used to identify sets of
monophyletic markers that distinguished divergence of the lineages and
emergence of three independent lineage II subpopulations. Two
mechanisms of phylogeographic variation were also detected, and these
mechanisms corresponded to expansion of regional subclones and
accumulation of regional polymorphisms in a lineage-independent
fashion. DNA sequence analysis of monophyletic markers provided a set
of specific genome alterations that marked divergence of the lineages
and subpopulations. Sequencing of polyphyletic markers suggested that
random drift in the populations is frequently a result of common
alterations that randomly create or destroy OBGS priming sties and
events associated with movement and recombination among lambdoid prophages.
 |
MATERIALS AND METHODS |
Bacterial strains and growth conditions.
Strains used in
this study and their known characteristics are shown in Table
1. United States isolates have been
described previously (10, 13, 20, 21, 33) and were chosen
because they represent the genetic diversity of the strains in the
United Stares that have been examined by OBGS analysis. Strains from Australia and New Zealand were chosen on the basis of temporal and
spatial representation of strain collections. The set of 15 human
isolates included 2 isolates from patients with hemolytic-uremic syndrome in New Zealand and 13 clinical isolates from patients with
diarrhea or hemolytic-uremic syndrome in Australia (kindly supplied by
R. Robins-Browne and D. Lightfoot, University of Melbourne, Parkville,
Victoria, Australia). Isolates of animal origin were obtained from
bovine or ovine sources in Australia during various pre- and
postharvest surveys of animals. All strains were maintained as frozen
stock preparations and were minimally propagated on Luria-Bertani agar or broth.
OBGS analysis.
DNA was prepared from 10-ml cultures of each
strain by standard methods, and 50 ng was used for each OBGS reaction.
Reactions were primed with combinations of decamer primers, each of
which had a 5' AT dinucleotide followed by a skewed octamer sequence (20). The 5' AT dinucleotide, which was added to limit
steric effects of the 5' fluorophore on annealing of the octamers, was also included in the sequences of the unlabeled octamers. For each
reaction, a labeled primer (containing a leading strand-biased octamer)
was combined with a cold primer (containing a lagging strand-biased
octamer). The following primers were labeled at their 5' ends with the
fluorophore IRD800 (Li-Cor, Inc., Lincoln, Nebr.): OCT3B
(ATGCTGGTGG), OCT4B (ATGCTGGCGG), OCT21
(ATGCGCTGGA), and OCT22 (ATCTGCGCAA). The
following unlabeled primers were used with the fluorescent primers:
OCT4C (ATCCGCCAGC), OCT6C (ATGCCAGCGC), OCT12C
(ATGCCGCCAG), OCT13C (ATTGCGCCAG), and OCT19C
(ATCTTCCAGC). The combinations OCT3B-OCT4C, OCT3B-OCT12C,
OCT4B-OCT19C, OCT21-OCT13C, and OCT22-OCT6C were used for OBGS studies.
The fluorescent OBGS products were resolved by fragment analysis with
Li-Cor 4200 automated DNA sequencers, and data were collected with the
Global IR2 system (Li-Cor, Inc.). Strain MC1061, a
K-12 derivative, and a distantly related bovine STEC strain, AU133c,
were included in the analyses to assess the ancestral condition of the
markers. Band patterns were printed with an Alden 9315 thermal printer and scored as described previously (20).
OBGS data analysis.
Binary strings, representing the
presence or absence of OBGS products ranging from 200 to 1,500 bases
long for each strain, were constructed in Microsoft Excel spreadsheets
from gel images of products obtained with individual OBGS primer
combinations. The binary strings for each of the primer combinations
were then added head to tail for each strain with FORMATALL, a
Perl-based program that creates composite files from fragment analysis
and microarray data files and generates output files compatible with PAUP and other clustering programs (Wise and Benson, unpublished data).
Genetic distance was calculated by determining the mean number of
character differences from all pairwise alignments of taxa, and
phylogenetic trees were resolved by neighbor joining (NJ) and
statistical (bootstrap) sampling of the data using algorithms in PAUP,
version 4.0 (34). Trees generated from binary strings resulting from individual primer combinations were in general agreement
with the tree generated from the composite binary strings resulting
from all primer combinations by both NJ and bootstrap methods.
Polymorphic OBGS markers were sorted by using macro functions in
Microsoft Excel spreadsheets. The binary data were first
rendered in
columns for each strain by the FORMATALL program and
output into a
single Excel spreadsheet. The data were sorted in
phylogenetic order by
ranking the columns of binary data for each
strain according to the
position of the strain in the phylogenetic
tree. When the columns were
sorted in this order, polymorphic
characters exhibited one of four
general patterns of distribution
relative to phylogeny; class I
characters were lineage specific
and conserved, class II characters
were lineage specific and not
conserved but were clustered in
monophyletic groups, class III
characters were lineage specific and not
conserved but were distributed
in polyphyletic groups, and class IV
characters were lineage independent
and distributed in polyphyletic
groups. In sequential steps, the
macro functions identified polymorphic
characters, classified
them in the four general patterns of
distribution, rendered them
as cells with different colors by
conditional formatting, and
grouped the polymorphisms belonging to each
class for enumeration.
A similar set of macro functions was
iterated to identify geographical
markers, except that the
strains were sorted primarily by geography
and were grouped secondarily
on the basis of phylogeny and distribution
class. The macros are
available from us upon
request.
OBGS band isolation and sequencing.
Polymorphic OBGS
products that indicated divergence of the lineages and clades were
identified from images of gels in which the samples were loaded in
phylogenetic order. Representative bands for each class were excised
from automated sequencing gels in which electrophoresis was halted
immediately after elution of the appropriate molecular weight markers
past the scanning optical unit of the sequencer. The bands of interest
were then localized in a gel by drying the gel on filter paper and
scanning the dried gel with an Odyssey near-infrared fluorescence
scanner (Li-Cor, Inc.). After localization and excision, fluorescently labeled DNA was eluted from a gel slice by boiling for 5 min in water,
followed by phenol extraction and ethanol precipitation. The
precipitated pellet was redissolved in 50 µl of water, and 10 µl
was used as a template in a 20-µl OBGS reaction mixture containing
the primer combination and reagents that were present in the original
mother reaction mixture. The reamplification products were then
electrophoresed alongside the mother reaction mixtures to check band
purity and efficiency of reamplification. The reamplified products were
then used as templates in a second round of reamplification performed
with the following OBGS primers tailed with M13 forward (M13F) and
reverse (M13R) primer sequences: M13FOCT3B
(CACGACGTTGTAAAACGACATGCTGGTGG), M13FOCT21
(CACGACGTTGTAAAACGACATGCGCTGGA), M13FOCT22
(CACGACGTTGTAAAACGACATCTGCGCAA), M13ROCT4C
(GGATAACAATTTCACACAGGGCCGCCAGCT), M13ROCT6C
(GGATAACAATTTCACACAGGATGCCAGCGC), M13ROCT12C
(GGATAACAATTTCACACAGGATGCCGCCAG), and M13ROCT13C
(GGATAACAATTTCACACAGGATTGCGCCAG). Tailed PCR products
were purified from agarose gels with a QIAquick gel extraction kit
(Qiagen, Inc., Valencia, Calif.). Purified products were cloned into
pTOPO (Invitrogen, Carlsbad, Calif.) and sequenced with T7 and T3
sequencing primers. DNA sequence analysis was performed for both strands.
Nucleotide sequence accession numbers.
The GenBank accession
numbers for the DNA sequences determined in this study are AF368044
(226C-3), AF368045 (226C-4), AF368046 (3B4C-5), AF368047 (226C-13),
AF368048 (226C-14), AF368049 (2212C-1), AF368050 (3B12C-2), AF368051
(3B4C-2), AF368052 (2113C-1), and AY036017 (3B4C-1).
 |
RESULTS |
OBGS analysis of United States and Australian O157:H7
isolates.
To examine the genetic relationships of Australian O157
EHEC strains and United States lineage I and II O157:H7 strains, we used OBGS to analyze a set of 37 isolates obtained from cattle and
humans in Australia and eight representative United States isolates
belonging to each of the two lineages (Table 1). The Australian strains
were chosen because they represented broad ranges of temporal and
spatial diversity with respect to origin and source. The United States
isolates belonging to lineages I and II represented the spectrum of
genetic diversity observed for strains derived from these lineages
(20). Five different OBGS primer combinations were used
for each strain, and OBGS products obtained with each primer
combination were converted to binary characters. Binary strings for
each primer combination were added head to tail, which resulted in
composite binary strings consisting of 1,159 characters for each
strain. Strain AU133c, a bovine-derived STEC strain that is distantly
related to O157:H7 based on the distribution of OBGS polymorphisms, was
included in the strain set as an outgroup.
Of the 1,159 characters scored, 258 (23%) were variable in the O157
strains tested, indicating that significant diversity
was detected in
the strain set. A total of 163 of these polymorphic
characters were
informative. As shown in Fig.
1, NJ
analysis resolved
two main clusters corresponding to the distribution
of lineage
I and II O157:H7 strains obtained from the United States.
Bootstrap
values indicated that assignment of the strains to these
lineages
was statistically significant. Australian O157:H7 and O157:H
EHEC isolates occurred in both lineages, and the majority of the
strains (31 of the 37 strains) exhibited higher levels of genetic
relatedness to the lineage II United States isolates.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 1.
Genetic relationships of E. coli O157:
H7 strains from the United States and Australia. The dendrogram was
produced by NJ analysis of binary files representing 1,159 OBGS
products from each strain obtained with five OBGS primer combinations
(tree length, 1,261; consistency index, 0.6772; retention index,
0.7573; 328 characters). Bootstrap percentages, derived from 1,000 replications of an NJ search, are indicated at the nodes for which the
percentages are more than 50%. The tree was rooted by using strain
AU133c, a bovine STEC isolate, as the outgroup. The designations of
strains originating from Australia and New Zealand begin with AU and
NZ, respectively. Human clinical isolates are indicated by boldface
type, and their designations end with H.
|
|
Based on a 50% cutoff for significance, each of the major clusters was
significant, suggesting that the two lineages could
be divided into
five clades (clades A to E) that were segregated
primarily by lineage
and secondarily by geography. This pattern
of inferred phylogeny
suggests that the two lineages previously
detected in the United States
(
20) are not regional subpopulations
but instead are
descendants resulting from an ancestral divergence
event that preceded
geographic dissemination. The presence of
the H

character state in
most strains in clade B and all strains
in clade D implies that loss of
motility is associated with divergence
of these clades from their
lineage I and II
ancestors.
Genetic markers and phylogeny of United States and Australian
O157:H7 and O157:H
EHEC strains.
If the clades inferred from the
phylogenetic analysis indeed constitute distinct subpopulations, then
signatures that indicate their phylogeny and diversification should be
present and observable in polymorphic OBGS products. To mine the
putative signatures from the OBGS data, we developed a marker-sorting
method that identified and quantified polymorphisms with monophyletic
and polyphyletic distributions. This method required classification of
polymorphisms into four classes, classes I to IV, based on four
possible patterns of distribution relative to user-specified groups.
Relative to phylogeny, the four distribution classes are shown in Fig.
2; to obtain the data, the OBGS samples
were loaded in inferred phylogenetic order on the gel.

View larger version (117K):
[in this window]
[in a new window]
|
FIG. 2.
Distribution of different classes of polymorphisms.
Segments of OBGS images illustrating polymorphic bands of the four
distribution classes (classes I to IV) are shown in the four panels.
The samples were loaded in phylogenetic order, as listed across the
top. Each image segment was reduced fivefold vertically, and the
molecular weights for the top and bottom regions of each image segment
are indicated on the right. The image segments were obtained by using
the following primer combinations: class I, OCT22-OCT6C; class II,
OCT22-OCT12C; class III, OCT3B-OCT4C; and class IV, OCT3B-OCT4C.
The bands of interest are indicated by arrows.
|
|
The first three classes of polymorphisms, classes I to III, occurred
exclusively in an inferred lineage. Class I bands were
conserved in all
members of the lineage. If the predicted phylogeny
is valid, the
exclusiveness and conservation of class I bands
in all members of a
lineage imply that the bands were derived
from ancestral genome
alterations fixed by periodic selection
during divergence of two
lineages. Class II bands were conserved
in monophyletic groups of
strains in a lineage, and their distribution
relative to the inferred
phylogeny implies that they arose from
genome alterations that occurred
after lineages diverged. The
class III bands were lineage specific but
were distributed among
polyphyletic groups in a lineage. The simplest
explanations for
the distribution of these bands are that they
originated from
genetic drift among alterations ancestral to the
lineage and that
they originated by lateral spread of common alleles in
members
of a lineage. Lastly, class IV bands were lineage independent.
These bands can be explained by monophyletic alterations that
resulted
in loss of a band and by random drift in sequences that
were ancestral
to both
lineages.
In order to identify and quantify each occurrence of bands marking
class I to IV events in the OBGS data set, we next devised
a method to
identify and sort polymorphic addresses in the composite
binary data
using macro functions in Microsoft Excel to execute
the sorting
process. The columns of binary data for each strain
were first ranked
numerically according to the relative position
of the strain in the NJ
tree in Fig.
1. Polymorphic addresses
were then identified, classified,
and grouped by class. The image
that resulted from sorting polymorphic
characters present in at
least three strains is shown in Fig.
3.

View larger version (68K):
[in this window]
[in a new window]
|
FIG. 3.
Sorting of polymorphic OBGS products by phylogeny.
Binary coding of the presence or absence of bands in five OBGS reaction
mixtures was rendered in phylogenetic order, and the polymorphic
positions were grouped by class of distribution by using sorting
functions in Microsoft Excel. Polymorphic addresses present in three or
more strains were sorted and rendered as cells with different colors
depending on the class of distribution pattern. Occurrences of class I
polymorphisms are red, occurrences of class II polymorphisms are pink,
occurrences of class III polymorphisms are green, and occurrences of
class IV polymorphisms are blue. The order of strains is indicated on
the left.
|
|
Like the pairwise alignments of the binary strings from the NJ
analysis, the sorting functions identified 258 of the 1,159
total
binary addresses that were polymorphic in the O157 strains.
Of the 258 polymorphisms, 148 occurred in at least three strains
and were further
enumerated. Class I characters represented 15
of the 148 polymorphisms.
Assuming that the inferred phylogeny
is valid, the relatively large
number of class I events that marked
divergence of the lineages
suggests that the lineages are significantly
divergent, and the
presence of shared class I polymorphisms in
both Australian and United
States isolates is consistent with
the hypothesis that divergence of
two lineages was an ancestral
event that preceded geographic
dissemination. Of the 22 class
II polymorphisms, 8 were found
exclusively in each member of clade
C, D, or E. These clade-specific
polymorphisms would be expected
if the clades arose through recent
clonal expansion of lineage
II subpopulations. Since clade D is
comprised entirely of O157:H
strains from Australia, the geographic,
phenotypic, and genotypic
similarities suggest that this clade could be
a regional subclone
unique to Australia. In contrast to the lineage II
clades, monophyletic
markers did not distinguish clades A and B. If
OBGS sampling of
the genome was random and if the lineage I strains
were representative
of the populations found on each continent, the
limited genetic
diversity could indicate that lineage I strains arrived
more recently
on one or both of the continents
studied.
Polyphyletic pattern of genome variation and phylogeographic
variation.
Relative to the inferred phylogeny, monophyletic
markers comprised only about one-fourth of the polymorphisms that
were detected and accounted for the phylogenetic signal that
distinguished only three of the five clades. If we excluded three class
III polymorphisms and 11 class IV polymorphisms that could be explained
simply by loss of an OBGS product from monophyletic clusters of
strains, the remaining 97 polymorphic OBGS products were distributed
among polyphyletic groups of strains. The ratio of monophyletic
polymorphisms to polyphyletic polymorphisms implies that genome
diversification occurred rapidly by random drift and accumulation of
common alleles and that selection only periodically fixed alleles in subpopulations.
Since clades A and B are geographically separated and were supported by
significant bootstrap values, we next asked whether
they could be
distinguished by region-specific polymorphisms that
were class III or
IV polymorphisms. This question was examined
by sorting the data first
by geography and then by inferred phylogeny.
The results obtained when
we sorted polymorphic markers that were
present in three or more
strains and were found only in United
States or Australian strains are
shown in Fig.
4. We identified
14 polymorphisms that were found only in United States strains
and 29 polymorphisms that were found only in Australian strains.
Six of the
polymorphisms in the United States strains and five
of the
polymorphisms in the Australian strains were the same class
II
polymorphisms shown in Fig.
3 that distinguished the geographically
separated clusters of strains in clade C and all of the strains
in
clade D. The remaining geographic polymorphisms were class
III and IV
markers; these markers included two class IV markers
that were found
only in all United States strains and four class
IV markers that were
present in all clade B strains and most other
Australian strains. If it
is assumed that the phylogeny is valid,
the mono- and polyphyletic
patterns of geographic distribution
suggest that there are independent
modes of phylogeographic variation.
The first mode can be explained
simply by clonal expansion of
a subpopulation, such as clade D, perhaps
due to its ability to
occupy a unique niche. The second mode appears to
arise from concentration
of geographic alleles in populations derived
from both lineages,
probably as a consequence of the populations
occupying a regional
niche.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 4.
Sorting of polymorphic OBGS products by geography.
Binary coding of the presence or absence of bands in five OBGS reaction
mixtures was rendered in geographic order and secondarily in
phylogenetic order by sorting functions in Microsoft Excel. Only the
geography-specific polymorphic addresses present in three or more
strains are shown. The cells containing geographic bands were rendered
in different colors by conditional formatting functions according to
the class of distribution relative to phylogeny (red, class I; pink,
class II; green, class III; blue, class IV). The order of the strains
is indicated on the left.
|
|
DNA sequence analysis of monophyletic lineage markers and clade
divergence.
In order to identify the nature of the OBGS
polymorphisms that resulted in the inferred patterns of phylogeny, we
purified, cloned, and sequenced representative monophyletic
polymorphisms that distinguished the two lineages and the three lineage
II clades. Bands were purified from OBGS reaction mixtures by using a
two-dimensional y-axis scanner to locate the bands in gels
in which migration had been stopped prior to migration of the bands
past the optical unit of the sequencer. After excision, purification,
and reamplification, the labeled reamplified products were then checked
for purity by electrophoresis alongside the mother reaction mixture
preparations from which they were originally excised (Fig.
5). Once their identities were confirmed,
the reamplified products were tailed, cloned, and sequenced. The DNA
sequences were then compared to the genome sequences of the lineage I
EDL933 O157:H7 strain, (Fig. 1), the Sakai O157:H7 strain (17,
27), and the MG1655 K-12 strain (1a).

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 5.
Purification and reamplification of the class I OBGS
product. The excised class I polymorphic bands obtained with the
OCT22-OCT6C primer combination were purified from the reaction
products of strains 93-001 and FRIK920 and were reamplified (Reamp)
with the same primer combination. The reamplification products were
then electrophoresed alongside the original OBGS reaction mixtures to
check for purity. The arrows indicate the positions of the reamplified
bands that comigrated with the bands in the mother reaction mixture
preparations from which they were excised.
|
|
To identify an event associated with the inferred divergence of the
lineages, a pair of class I polymorphisms was chosen from
the
OCT22-OCT6C combination. The DNA sequences of bands from strains
93-001 (lineage I) and FRIK920 (lineage II) were nearly identical
and spanned
the intergenic region between the divergent
folD and
sfmA genes. The sequence from 93-001 (accession number
AF368044)
was identical for the entire length of the fragment to the
sequences
from the EDL933 and Sakai O157:H7 strains. The lineage II
strain
sequence (accession number
AF368045) had an eight-base
duplication
and a single additional base flanking the duplication. The
duplicated
region began 129 bases upstream of
folD and
apparently was a derived
region in lineage II since the duplication was
not present in
the MG1655 sequence. This polymorphism is a convenient
marker
of the lineage II clone because it has been found in all of the
lineage II strains examined but has not been found in the lineage
I
strains that we have tested to date (Kim and Benson, unpublished
data).
Whether the duplication actually influences transcription
from either
of the promoters or confers a significant phenotype
requires further
study. We designated this marker of lineage divergence
226C-4.
In order to identify events that mark clonal expansion of lineage II
clades C, D, and E, we purified and cloned class II polymorphic
OBGS
products found only in all members of each clade. The clade
C-specific
band, obtained with primer combination OCT3B-OCT4C,
yielded a sequence
(accession number
AF368051) that showed
no significant similarity to
sequences in the EDL933 or Sakai
genome or to any entries in the BLAST
databases. Southern blot
analysis using a labeled PCR product amplified
from the cloned
fragment identified a strongly hybridizing 700-base
EcoRV fragment
that was present in each clade C strain but
not in any other strain
(data not shown). Evidently, this polymorphism,
designated 3B4C-2,
marks a gene acquisition event that was associated
with divergence
of the clade C subpopulation from its lineage II
ancestor, or
it arose by lateral spread in a subpopulation of lineage
II
strains.
Two polymorphic bands obtained with the OCT22-OCT6C primer combination
were selected as clade D markers. These two bands,
approximately 1,100 bases long, had contrasting patterns of distribution.
The DNA sequences
of the band from clade C strain AU6 (accession
number
AF368047) and the
larger band from clade D strain AU1808
(accession number
AF368048) were
sequences from the
leuL-
leuO region. The sequence
obtained from the clade D band had an additional
CTA triplet located in
a conserved region consisting of four tandem
CTA repeats in the clade C
sequence and in the EDL933, Sakai,
and MG1655 genome sequences.
These triplets comprised leucine
codon repeats in the
leuL
leader peptide that are involved in
attenuation of
leuABCD
expression (
37). Expression of this biosynthetic
pathway
is modulated, in part, by attenuation, and minor increases
in the
length of the leucine codon repeats apparently have a modest
effect on
the threshold level of leucine necessary for induction
(
1). We designated this derived clade D marker
leuL(CTA)
5.
DNA sequence analysis of the clade E-specific band, obtained with
primer combination OCT3B-OCT4C, showed that it originated
from the
gatC gene, which encodes enzyme IIC of the dulcitol-specific
phosphotransferase system transporter. The sequence of the band,
designated 3B4C-5 (accession number
AF368046), was identical
to the
EDL933 and Sakai O157:H7 genome sequences for the entire
length of the
cloned fragment, including the OCT3B and OCT4C priming
sites. Since
nucleotides present in the EDL933 and Sakai genome
sequences 5' to the
OCT3B and OCT4C priming sites do not match
the 5' AT spacer
dinucleotide in the OBGS primers, it is possible
that clade E strains
have one or more mutations which bring the
adjacent nucleotides into
complementarity with the 5' AT dinucleotides
of the primers.
Alternatively, it is also possible that some epigenetic
phenomenon,
such as base modification, could prohibit annealing
of the primers to
non-clade E DNA at these
positions.
DNA sequence analysis of polyphyletic genome alterations.
Since clades A and B are distinguished from one another by geographic
polymorphisms, we cloned and sequenced a class IV band obtained with
primer combination OCT3B-OCT12C, designated 3B12C-2 (accession number
AF368050), that was found only in Australian strains except clade D
strains AU1808, AU1809, AU1817, and AU1822. There was no apparent band
obtained with the same primer combination for the opposing pattern of
distribution. The 3B12C-2 sequence aligned with a segment of the EDL933
and Sakai genome sequences spanning the folB and
bacA genes, which encode dihydroneopterin aldolase
(16) and a putative undecaprenol kinase that confers resistance to bacitracin at a high copy number, respectively
(3). Four single-nucleotide polymorphisms (SNPs) were
present in the 3B12C-2 sequence compared to the EDL933 and Sakai
sequences, but six SNPs were conserved in the 3B12C-2, EDL933, and
Sakai sequences compared to the MG1655 sequence, supporting the notion
that unique positions in the 3B12C-2 marker were derived and that the
allele was probably not acquired. Two of the derived SNPs in clade B are silent, while the other two result in an isoleucine-to-threonine substitution at position 26 of the bacA open reading frame
(ORF) and a valine-to-alanine substitution at position 314 of the
folB ORF. In addition to the internal SNPs, sequences
obtained from the 3B12C-3 band and the EDL933 and Sakai genomes also
diverged immediately upstream of the OCT3B and OCT12C binding sites,
suggesting that mismatches with the AT dinucleotide spacers of the
octamer primers are probably the reason why the band did not appear to be amplified from EDL933 and other United States strains or K-12 control strain MC1061 in our OBGS reaction mixtures.
In addition to polyphyletic polymorphisms that distinguished clades A
and B, we also sequenced randomly chosen class IV and
III bands to gain
further insight into the genetic basis for the
seemingly large degree
of random drift detected by OBGS. One of
the class IV OBGS products,
obtained with the OCT21-OCT13C combination,
yielded a 490-base sequence
(accession number
AF368052) that
had a C-T mismatch at position 321 of
the L0079 ORF encoding the
ssb gene of phage 933W. The
mismatch was in the OCT21 octamer
priming site and probably prohibited
binding of the OCT21 primer
in EDL933 and the other 30 strains in our
strain set lacking this
polymorphic band. However, relative to the
Sakai genome, 322 bases
at the 3' end of the band aligned with two
different prophage
elements, but no alignments were observed in the 166 bases at
the 5' end, indicating that several different types of events
could account for the absence of this
band.
The two class III bands that were selected also yielded sequences
homologous to prophage and chromosomal genes. A class III
polymorphism
obtained with the OCT22-OCT12C combination, present
in FRIK920,
FRIK1574, FRIK1988, AU514, AU1820, AU1810, and AU1811,
yielded a
segment from clade C strain FRIK920 (accession number
AF368049) that
was derived from the
ybgH gene of the EDL933,
Sakai, and
MG1655 sequences encoding a putative oligopeptide transport
protein.
Two SNPs were found in the FRIK920 sequence compared
to the O157:H7
genome sequences; one was an A-to-T substitution
at position 351 of the
ybgH coding region, which created a premature
stop codon,
and the other was a C-to-T substitution 43 bases upstream
of the
ybgH start codon that was within the OCT22 primer itself.
In
addition to the SNPs found only in FRIK920, 17 additional SNPs
were
conserved in the FRIK920 sequence and other O157:H7 sequences
compared
to MG1655, indicating that the FRIK920 allele is likely
to be a derived
allele. It is tempting to speculate that the random
occurrence of the
22-12C marker could reflect a propensity for
the

43 C-to-T
substitution, perhaps as a result of frequent cytosine
deamination,
creating an OCT22 priming
site.
An additional class III band, 3B4C-1, was obtained with FRIK1988,
AU1514, AU1811, and AU1820 in clade E, and this band exhibited
a
complex pattern of homology to prophages in the EDL933 and Sakai
genome
sequences. This 311-base fragment, obtained with the OCT3B-OCT4C
combination (accession number
AY036017), showed significant
homology to
a 122-base region of the Z1842 ORF of cryptic prophage
CP933-C in
EDL933 and the corresponding position in the Sakai
O157:H7 genome but
limited homology in the sequences flanking
this segment. An intact
OCT4C priming site was present at the
corresponding end of the CP933-C
sequence but not at the OCT3B
priming site. Evidently, the polymorphic
band originated from
unique prophages residing in the FRIK1988, AU1514,
AU1811, and
AU1820 genomes or from a recombination event that occurred
at
some point in the evolution of some clade E strains. The significant
diversity of the prophage contents of the O157:H7 genome sequences
of
EDL933 and Sakai (
17,
27) and the diversity that can be
determined by restriction fragment length polymorphism analysis
with
lambdoid phage genome probes (
7,
20,
30) suggest that
movement and recombination among prophages are significant mechanisms
of genome diversification. It will be interesting to conduct a
formal
analysis of the frequency at which recombination within
prophages and
insertion-excision of lysogenic bacteriophages participate
in genome
diversification.
 |
DISCUSSION |
Comparative genome analyses of sorbitol-negative,
-glucuronidase-negative E. coli O157:H7 strains
previously showed that two distinct lineages could be detected in the
United States (20). In this study, we found that the
divergence of these lineages was probably an ancestral event that
preceded geographic dissemination. This conclusion was based on
phylogenetic inferences from OBGS data, the distribution of genome
alterations detected by OBGS, and the nature of alterations in
representative loci that mark the pattern of descent.
Because we sorted markers using the inferred phylogeny and identified
conserved polymorphisms using the same phylogeny, the apparent
circularity indicates that it is formally possible that some other
process is responsible for the distribution of markers. For example,
class I and II polymorphisms could be a result of lateral spread of
mobile elements among different populations rather than a result of a
stepwise pattern of vertical descent. However, the nature of the
representative monophyletic alterations that were determined argues
against this hypothesis being the sole explanation for the data since
the class I polymorphism and two of the three class II polymorphisms
are derived states in chromosomal genes and are not linked to mobile
elements. Furthermore, sequence analysis of additional class I markers,
identified in our laboratory as part of a systematic identification of
all conserved markers of lineage divergence, showed that each marker is
in an independent locus (Kim and Benson, unpublished), implying that the markers most likely originated through stepwise descent rather than
convergent evolution. Although each of the additional class I markers
represents an independent event, nearly one-half of them resulted from
gene acquisition events, movement of insertion sequences, and movement
or recombination within prophage, implying that the conserved
polymorphisms comprise a mosaic of mutation, recombination, and
acquisition events fixed by one or more selective bottlenecks.
Extended model for evolution of extant O157 EHEC populations.
Based on the inferred phylogeny and the evidence that vertical descent
of conserved markers occurred, we propose extension of the evolutionary
model for contemporary O157:H7 populations (11) to include
additional steps subsequent to the emergence of the sorbitol-negative,
-glucuronidase negative ancestor (Fig. 6). The most recent common ancestor of
contemporary E. coli O157:H7 populations, designated A6 by
Feng et al. (11), is believed to have been derived from an
LEE+ Stx2+ O157:H7
ancestor, designated A3, through a stepwise sequence of events that
included lysogenization by an stx1-converting phage, acquisition of the TAI locus encoding tellurite resistance and the Iha
adhesin, and sequential loss of sorbitol fermentation and
-glucuronidase production (11, 35). Evolution from A3 to A6 can be inferred from multilocus genotyping data, as well as from
cumulative character states in the uidA alleles of A3, A5,
and A6 descendants (11), culminating in a dinucleotide
insertion at position 685 observed in the EDL933 and Sakai genomes that apparently inactivated the gene in A6 descendants (17,
27). Prior to these events, a nonmotile lineage diverged from
A3, leading to ancestor A4 of populations of sorbitol-fermenting,
-glucuronidase-positive O157:H
strains that have been found in
continental Europe (11, 19).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 6.
Stepwise model of the evolution of O157: H7 and O157:H
EHEC strains. The model is based on that of Feng et al.
(11). Each oval represents a progenitor, and evolution
proceeds from left to right from ancestral to contemporary states. The
A3 to A6 ancestors are designated as described by Feng et al.
(11). The markers of events are indicated as follows:
Sor , inability to ferment sorbitol;
uidA , loss of -glucuronidase activity;
TAI, acquisition of the tellurite resistance-adherence island
(35). Specific polymorphisms marking the divergence of A7
and clades A to E are described in the text.
|
|
When our OBGS data are included, an additional population, which
descended from the A6 ancestor, must be included to provide
a simple
explanation for the data. Descendants resulting from
this divergence
event comprise the lineage I (A6) and lineage
II (A7) populations, and
assignment of lineage I and II descendants
to the A6 (ancestral) and A7
(derived) lineages is based on the
DNA sequence of the class I
polymorphism, showing that it is a
derived polymorphism in lineage II.
Consistent with this assignment,
three of eight class I polymorphic
bands found only in lineage
I strains are also obtained with outgroup
strain AU133c, and sorting
of markers obtained from a larger set of
United States strains
identified additional class I bands shared by
lineage I and K-12
(Wise and Benson unpublished). Given the number of
class I OBGS
polymorphisms like 226C-4 that mark this event, the A7
ancestor
emerged either from a highly divergent subpopulation through a
single periodic selection event or descended through sequential
bottlenecks. By understanding the nature of class I alterations,
we
hope to gain further insight into unique physiological and
ecological
characteristics of A6 and A7 descendants and the events
that led to
their
divergence.
After A6 and A7 populations moved to the different continents, several
subpopulations apparently emerged, some of which, such
as clades C, D,
and E, are marked by monophyletic polymorphisms
detected by OBGS. Since
multiple class II markers were detected
in each of these clades (Fig.
3) and since no class II markers
were found only in two of the three
clades, we suggest that each
clade may have arisen independently from
the common A7 ancestor,
perhaps through independent selective
bottlenecks. Clade D may
have arisen through a regional bottleneck
since it comprises only
Australian strains. This clade is distinct from
the populations
of nonmotile O157 EHEC that descended from A4 because
of its sorbitol
and

-glucuronidase phenotypes and the presence of
the TAI island,
which was detected in all descendants of A6 and A7 in
this strain
set (Nietfeldt and Benson, unpublished data). Examining the
distribution
of the clade D markers, such as
leuL(CTA)
5, in
non-sorbitol-fermenting,

-glucuronidase-negative O157 EHEC strains
should provide data
regarding the geographic distribution of
this
clade.
In contrast to the A7 descendants, the A6 descendants in clades A and B
showed only limited genetic diversity and were differentiated
from each
other primarily by sets of polymorphisms that were polyphyletic
but conserved or nearly conserved with respect to geography. We
speculate that this pattern of diversity reflects regional selection
imposed on populations of lineage I strains that recently arrived
on
either or both of the continents studied. Testing this hypothesis,
however, will require analysis of larger sets of
strains.
Distribution of human and bovine isolates.
Although
descendants of both the A6 (lineage I) and A7 (lineage II) ancestors
were detected among the Australian strains, most of the strains tested,
including several human clinical clade D and E strains from Australia,
were derived from the A7 ancestor. This finding is in contrast to the
results of OBGS analysis of human and bovine O157:H7 strains from the
United States, where few human isolates were observed among lineage II
strains (20). There are several possible explanations for
the observed differences. First, although in these studies we used
strains that are temporally and spatially diverse in terms of their
origins, it is possible that the differences reflect bias in the
relatively small sets of strains. A second possibility is that
differences in animal production and food preparation practices between
the two countries studied contribute to bias in transmission.
And finally, it is also possible that clade D and E strains have
virulence properties that are distinct from those of their clade C
counterparts. It is worth noting that most bovine strains from the
United States that have been tested by the OBGS method cluster with the
clade C strains, while the United States clade E strain is closely
related to the few human lineage II isolates identified in the United States studies (20). We are currently devising a multiplex
assay, based on class I and II polymorphisms, which will provide a
rapid method for strain classification that can be used to
statistically evaluate the differential virulence hypothesis.
Generation of genome diversity.
Although the small set of
class III and IV polymorphisms that we sequenced does not allow
quantitative conclusions, the fact that we identified alterations in
two different genomic sequences and two different prophage sequences
implies that variation in each sequence contributed to genome
diversification. The polyphyletic alterations detected in genomic
sequences appear to be SNPs that create or destroy OBGS primer binding
sites, and the results of comparisons of SNPs inside these regions are
consistent with the hypothesis that the alleles are derived. Among the
polyphyletic alterations detected in prophage sequences, we found one
example of a polymorphism that arose either from lysogenization by a
unique phage or by a recombination event that generated a chimeric
segment in a resident cryptic prophage. Due to the high degrees of
similarity among prophages and cryptic prophages that reside in O157:H7
genomes (17, 27), the diversity of prophage contents of
different strains (7, 17, 20, 27, 30), and the modular
nature of phage genomes (2, 4, 5), it is difficult to
determine whether polymorphic OBGS products carrying chimeric prophage
sequences arise from integration and excision of lysogenic phages or by recombination. Several of the class III and IV polymorphisms can be
found in common sets of polyphyletic strains, which supports the view
that the polymorphisms are physically linked and arise from movement of
phages into and out of the genome. On the other hand, recombination
events in prophage sequences could also appear as linked sets of class
III and IV polymorphisms since highly conserved modules of phage
genomes from similar and diverse hosts can vary significantly in length
(2, 4, 5, 12, 18). Regardless of the precise mechanism of
phage-mediated variation, it seems that infection of strains by
bacteriophages is common and offers significant opportunities for
lysogenization and recombination events to occur since the populations
occupy phage-dense environments, such as the rumen.
Whether diversification occurs in prophage or genomic sequences, some
of the drift may not be present in entirely random groups
of strains.
As demonstrated by sorting of the OBGS polymorphisms
primarily by
geography (Fig.
4), we identified different types
of phylogeographic
variation. The apparent clonal expansion of
clade D, which comprises
only Australian strains, is the first
type. In contrast, the
geography-specific class IV polymorphisms
that distinguish clades A and
B may be a second mechanism of phylogeographic
variation, in which
provincial selective pressures concentrate
regional alleles or common
alterations in genetically distinct
populations that occupy a common
niche. Such information is not
readily apparent when data are sorted by
inferred phylogeny alone.
The fact that geographic distributions of
class IV markers can
be detected brings up the possibility that
additional patterns
of selection and/or allele concentration may be
represented among
the class III and IV alterations and may be
previously unrecognized
patterns of selection or common ecological
characteristics. Implementing
additional algorithms for data sorting
and analysis of extensive
OBGS fragment data may provide
additional tools to identify shared
physiological and ecological
characteristics of strain sets and
may ultimately help workers identify
unique signatures of
selection.
 |
ACKNOWLEDGMENTS |
We thank Lawrence Harshman and Robert Hutkins for insightful
discussions and critical reviews of the manuscript. We are indebted to
Roy Robins-Browne and Dianne Lightfoot for sharing human clinical isolates from their collections.
This research was funded by grant 98-35291-6215 from the United States
Department of Agriculture National Research Initiative Competitive
Grants Program to A.K.B. and by Nebraska Legislative Bill LB1206.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Food Science and Technology, University of Nebraska, 330 Food Industry Complex, Lincoln, NE 68583-0919. Phone: (402) 472-5637. Fax: (402) 472-1693. E-mail: abenson1{at}unl.edu.
Journal Series paper 13460 of the Nebraska Agricultural Research
Experimental Station.
 |
REFERENCES |
| 1.
|
Bartkus, J. M.,
B. Tyler, and J. M. Calvo.
1991.
Transcription attenuation-mediated control of leu operon expression: influence of the number of Leu control codons.
J. Bacteriol.
173:1634-1641[Abstract/Free Full Text].
|
| 1a.
|
Blattner, F. R.,
G. Plunkett III,
C. A. Bloch,
N. T. Perna,
V. Burland,
M. Riley,
J. Collado-Vides,
J. D. Glasner,
C. K. Rode,
G. F. Mayhew,
J. Gregor,
N. W. Davis,
H. A. Kirkpatrick,
M. A. Goeden,
D. J. Rose,
B. Mau, and Y. Shao.
1997.
The complete genome sequence of Escherichia coli K-12.
Science
277:1453-1462[Abstract/Free Full Text].
|
| 2.
|
Brussow, H.,
A. Bruttin,
F. Desiere,
S. Lucchini, and S. Foley.
1998.
Molecular ecology and evolution of Streptococcus thermophilus bacteriophages review.
Virus Genes
16:95-109[CrossRef][Medline].
|
| 3.
|
Cain, B. D.,
P. J. Norton,
W. Eubanks,
H. S. Nick, and C. M. Allen.
1993.
Amplification of the bacA gene confers bacitracin resistance to Escherichia coli.
J. Bacteriol.
175:3784-3789[Abstract/Free Full Text].
|
| 4.
|
Campbell, A. M.
1994.
Comparative molecular biology of lambdoid phages.
Annu. Rev. Microbiol.
48:193-222[CrossRef][Medline].
|
| 5.
|
Campbell, A. M.
1988.
Phage evolution and speciation, p. 1-14.
In
R. Calendar (ed.), The bacteriophages. Plenum Press, New York, N.Y.
|
| 6.
|
Caprioli, A., and A. E. Tozzi.
1998.
STEC infections in continental Europe, p. 38-48.
In
J. B. Kaper, and A. D. O'Brien (ed.), Escherichia coli O157:H7 and other Shiga toxin-producing E. coli strains. American Society for Microbiology, Washington, D.C.
|
| 7.
|
Datz, C. M.,
C. Janetzki-Milkman,
S. Franke,
F. Gunzer,
H. Schmidt, and H. Karch.
1996.
Analysis of the enterohemorrhagic Escherichia coli O157 DNA region containing lambdoid phage gene p and Shiga-like toxin structural genes.
Appl. Environ. Microbiol.
62:791-797[Abstract/Free Full Text].
|
| 8.
|
Donnenberg, M. S.,
S. Tzipori,
M. L. McKee,
A. D. O'Brien,
J. Alroy, and J. B. Kaper.
1993.
The role of the eae gene of enterohemorrhagic Escherichia coli in intimate attachment in vitro and in a porcine model.
J. Clin. Invest.
92:1418-1424.
|
| 9.
|
Dytoc, M.,
R. Soni,
F. Cockerill III,
J. De Azavedo,
M. L. Louie,
J. Brunton, and P. Sherman.
1993.
Multiple determinants of verotoxin-producing Escherichia coli O157:H7 attachment-effacement.
Infect. Immun.
61:3382-3391[Abstract/Free Full Text].
|
| 10.
|
Faith, N. G.,
J. A. Shere,
R. Brosch,
K. W. Arnold,
S. E. Ansay,
M.-S. Lee,
J. B. Luchansky, and C. W. Kaspar.
1996.
Prevalence and clonal nature of Escherichia coli O157:H7 on dairy farms in Wisconsin.
Appl. Environ. Microbiol.
62:1519-1525[Abstract/Free Full Text].
|
| 11.
|
Feng, P.,
K. A. Lampel,
H. Karch, and T. S. Whittam.
1998.
Genotypic and phenotypic changes in the emergence of Escherichia coli O157:H7.
J. Infect. Dis.
177:1750-1753[CrossRef][Medline].
|
| 12.
|
Ford, M. E.,
G. J. Sarkis,
A. E. Belanger,
R. W. Hendrix, and G. F. Hatfull.
1998.
Genome structure of mycobacteriophage D29: implications for phage evolution.
J. Mol. Biol.
279:143-164[CrossRef][Medline].
|
| 13.
|
Gouveia, S.,
M. E. Proctor,
M.-S. Lee,
J. B. Luchansky, and C. W. Kaspar.
1998.
Genomic comparisons and Shiga toxin production among Escherichia coli O157:H7 isolates from a day care center outbreak and sporadic cases in southeastern Wisconsin.
J. Clin. Microbiol.
36:727-733[Abstract/Free Full Text].
|
| 14.
|
Griffin, P. M., and R. V. Tauxe.
1991.
The epidemiology of infections caused by Escherichia coli O157:H7, other enterohemorrhagic E. coli, and the associated hemolytic uremic syndrome.
Epidemiol. Rev.
13:60-98[Free Full Text].
|
| 15.
|
Gunzer, F.,
H. Bohm,
H. Russmann,
M. Bitzan,
S. Aleksic, and H. Karch.
1992.
Molecular detection of sorbitol-fermenting Escherichia coli O157 in patients with hemolytic-uremic syndrome.
J. Clin. Microbiol.
30:1807-1810[Abstract/Free Full Text].
|
| 16.
|
Haubmann, C.,
F. Rodich,
E. Schmidt,
A. Bacher, and G. Richter.
1998.
Biosynthesis of pteridines in Escherichia coli.
J. Biol. Chem.
273:17418-17424[Abstract/Free Full Text].
|
| 17.
|
Hayashi, T.,
K. Makino,
M. Onishi,
K. Kurokawa,
K. Ishi,
K. Yokoyama,
C.-G. Han,
E. Ohtsubo,
K. Nakayama,
T. Murata,
M. Tanaka,
T. Tobe,
T. Iida,
H. Takami,
T. Honda,
C. Saskawa,
N. Ogasawara,
T. Yasunaga,
S. Kuhara,
T. Shiba,
M. Hattori, and H. Shinagawa.
2001.
Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory strain.
DNA Res.
8:11-22[Abstract].
|
| 18.
|
Hendrix, R. W.,
M. C. M. Smith,
R. N. Burns,
M. E. Ford, and G. F. Hatfull.
1999.
Evolutionary relationships among diverse bacteriophages and prophages: all the world's a phage.
Proc. Natl. Acad. Sci. USA
96:2192-2197[Abstract/Free Full Text].
|
| 19.
|
Karch, H.,
H. Böhm,
H. Schmidt,
F. Gunzer,
S. Aleksic, and J. Heesemann.
1993.
Clonal structure and pathogenicity of Shiga-like toxin-producing, sorbitol-fermenting Escherichia coli O157:H-.
J. Clin. Microbiol.
31:1200-1205[Abstract/Free Full Text].
|
| 20.
|
Kim, J.,
J. Nietfeldt, and A. K. Benson.
1999.
Octamer based genome scanning distinguishes a unique subpopulation of Escherichia coli O157:H7 strains in cattle.
Proc. Natl. Acad. Sci. USA
96:13288-13293[Abstract/Free Full Text].
|
| 21.
|
Lee, M.-S.,
C. W. Kaspar,
R. Brosch,
J. Shere, and J. B. Luchansky.
1996.
Genomic analysis using pulsed-field gel electrophoresis of Escherichia coli O157:H7 isolated from dairy calves during the United States national dairy heifer evaluation project (1991-1992).
Vet. Microbiol.
48:223-230[CrossRef][Medline].
|
| 22.
|
Levine, M. M.
1987.
Escherichia coli that cause diarrhea: enterotoxigenic, enteropathogenic, enteroinvasive, enterohemorrhagic, and enteroadherent.
J. Infect. Dis.
155:377-389[Medline].
|
| 23.
|
McDaniel, T. K.,
K. G. Jarvis,
M. S. Donnenberg, and J. B. Kaper.
1995.
A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens.
Proc. Natl. Acad. Sci. USA
92:1664-1668[Abstract/Free Full Text].
|
| 24.
|
McGraw, E. A.,
J. Li,
R. K. Selander, and T. S. Whittam.
1999.
Molecular evolution and mosaic structure of alpha, beta, and gamma intimins of pathogenic Escherichia coli.
Mol. Biol. Evol.
16:12-22[Abstract].
|
| 25.
|
Newland, J. W.,
N. A. Stockbrine,
F. F. Miller,
A. D. O'Brien, and R. K. Holmes.
1985.
Cloning of shiga-like toxin genes from a toxin converting phage of Escherichia coli.
Science
230:179-181[Abstract/Free Full Text].
|
| 26.
|
O'Brien, A. D.,
L. R. Marques,
C. F. Kerry,
J. W. Newland, and R. K. Holmes.
1989.
Shiga-like toxin converting phage of enterohemorrhagic Escherichia coli strain 933.
Microb. Pathog.
6:381-390[CrossRef][Medline].
|
| 27.
|
Perna, N. T.,
G. Plunkett III,
V. Burland,
B. Mau,
J. D. Glasner,
D. J. Rose,
G. F. Mayhew,
P. S. Evans,
J. Gregor,
H. A. Kirkpatrick,
G. Posfai,
J. Hackett,
S. Klink,
A. Boutin,
Y. Shao,
L. Miller,
E. J. Grotbeck,
N. W. Davis,
A. Lim,
E. T. Dimalanta,
K. D. Potamousis,
J. Apodaca,
T. S. Anantharaman,
J. Lin,
G. Yen,
D. C. Schwartz,
R. A. Welch, and F. R. Blattner.
2001.
Genome sequence of enterohaemorrhagic Escherichia coli O157:H7.
Nature
409:529-533[CrossRef][Medline].
|
| 28.
|
Reid, S. D.,
C. J. Herbelin,
A. C. Brumbaugh,
R. K. Selander, and T. S. Whittam.
2000.
Parallel evolution of virulence in pathogenic Escherichia coli.
Nature
406:64-67[CrossRef][Medline].
|
| 29.
|
Robins-Browne, R.,
E. Elliott, and P. Desmarchelier.
1998.
Shiga toxin-producing Escherichia coli in Australia, p. 66-72.
In
J. B. Kaper, and A. D. O'Brien (ed.), Escherichia coli O157:H7 and other Shiga toxin-producing E. coli strains. American Society for Microbiology, Washington, D.C.
|
| 30.
|
Samadpour, M.,
L. M. Grimm,
B. Desai,
D. Alfi,
J. E. Ongerth, and P. I. Tarr.
1993.
Molecular epidemiology of Escherichia coli O157:H7 strains by bacteriophage lambda restriction fragment length polymorphism analysis: application to a multistate foodborne outbreak and a day-care center cluster.
J. Clin. Microbiol.
31:3179-3183[Abstract/Free Full Text].
|
| 31.
|
Schmidt, H.,
L. Beutin, and H. Karch.
1995.
Molecular analysis of the plasmid-encoded hemolysin of Escherichia coli O157:H7 strain EDL933.
Infect. Immun.
63:1055-1061[Abstract/Free Full Text].
|
| 32.
|
Schmidt, H.,
B. Henkel, and H. Karch.
1997.
A gene cluster related to type II secretion pathway operons of gram-negative bacteria is located on the large plasmid of enterohemorrhagic Escherichia coli O157 strains.
FEMS Microbiol. Lett.
148:265-272[CrossRef][Medline].
|
| 33.
|
Shere, J. A.,
K. J. Bartlett, and C. W. Kaspar.
1998.
Longitudinal study of Escherichia coli O157:H7 dissemination on four dairy farms in Wisconsin.
Appl. Environ. Microbiol.
64:1390-1399[Abstract/Free Full Text].
|
| 34.
|
Swoford, D. L.
1998.
PAUP, version 4.0, beta 8.
Sinauer and Associates, Sunderland, Mass.
|
| 35.
|
Tarr, P. I.,
S. S. Bilge,
J. C. Vary, Jr.,
S. Jelacic,
R. C. Habeeb,
T. R. Ward,
M. R. Baylor, and T. E. Besser.
2000.
Iha: a novel Escherichia coli O157:H7 adherence-conferring molecule encoded on a recently acquired chromosomal island of conserved structure.
Infect. Immun.
68:1400-1407[Abstract/Free Full Text].
|
| 36.
|
Tarr, P. I.,
L. M. Schoening,
Y.-L. Yea,
T. R. Ward,
S. Jelacic, and T. S. Whittam.
2000.
Acquisition of the rfb-gnd cluster in evolution of Escherichia coli O55 and O157.
J. Bacteriol.
182:6183-6186[Abstract/Free Full Text].
|
| 37.
|
Wessler, S. R., and J. M. Calvo.
1981.
Control of leu operon expression in Escherichia coli by a transcription attenuation mechanism.
J. Mol. Biol.
149:579-597[CrossRef][Medline].
|
| 38.
|
Whittam, T. S.,
M. L. Wolfe,
I. K. Wachsmuth,
F. Orskov,
I. Orskov, and R. A. Wilson.
1993.
Clonal relationships among Escherichia coli strains that cause hemorrhagic colitis and infantile diarrhea.
Infect. Immun.
61:1619-1629[Abstract/Free Full Text].
|
| 39.
|
Whittam, T. S.
1998.
Evolution of STEC strains, p. 195-209.
In
J. B. Kaper, and A. D. O'Brien (ed.), Escherichia coli O157:H7 and other Shiga toxin-producing E. coli strains. American Society for Microbiology, Washington, D.C.
|
Journal of Bacteriology, December 2001, p. 6885-6897, Vol. 183, No. 23
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.23.6885-6897.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Whitworth, J., Zhang, Y., Bono, J., Pleydell, E., French, N., Besser, T.
(2010). Diverse Genetic Markers Concordantly Identify Bovine Origin Escherichia coli O157 Genotypes Underrepresented in Human Disease. Appl. Environ. Microbiol.
76: 361-365
[Abstract]
[Full Text]
-
Lowe, R. M. S., Baines, D., Selinger, L. B., Thomas, J. E., McAllister, T. A., Sharma, R.
(2009). Escherichia coli O157:H7 Strain Origin, Lineage, and Shiga Toxin 2 Expression Affect Colonization of Cattle. Appl. Environ. Microbiol.
75: 5074-5081
[Abstract]
[Full Text]
-
Yang, Z., Kim, J., Zhang, C., Zhang, M., Nietfeldt, J., Southward, C. M., Surette, M. G., Kachman, S. D., Benson, A. K.
(2009). Genomic Instability in Regions Adjacent to a Highly Conserved pch Prophage in Escherichia coli O157:H7 Generates Diversity in Expression Patterns of the LEE Pathogenicity Island. J. Bacteriol.
191: 3553-3568
[Abstract]
[Full Text]
-
Steele, M., Ziebell, K., Zhang, Y., Benson, A., Johnson, R., Laing, C., Taboada, E., Gannon, V.
(2009). Genomic Regions Conserved in Lineage II Escherichia coli O157:H7 Strains. Appl. Environ. Microbiol.
75: 3271-3280
[Abstract]
[Full Text]
-
Whitworth, J. H., Fegan, N., Keller, J., Gobius, K. S., Bono, J. L., Call, D. R., Hancock, D. D., Besser, T. E.
(2008). International Comparison of Clinical, Bovine, and Environmental Escherichia coli O157 Isolates on the Basis of Shiga Toxin-Encoding Bacteriophage Insertion Site Genotypes. Appl. Environ. Microbiol.
74: 7447-7450
[Abstract]
[Full Text]
-
Wong, T.-Y., Fernandes, S., Sankhon, N., Leong, P. P., Kuo, J., Liu, J.-K.
(2008). Role of Premature Stop Codons in Bacterial Evolution. J. Bacteriol.
190: 6718-6725
[Abstract]
[Full Text]
-
Ziebell, K., Steele, M., Zhang, Y., Benson, A., Taboada, E. N., Laing, C., McEwen, S., Ciebin, B., Johnson, R., Gannon, V.
(2008). Genotypic Characterization and Prevalence of Virulence Factors among Canadian Escherichia coli O157:H7 Strains. Appl. Environ. Microbiol.
74: 4314-4323
[Abstract]
[Full Text]
-
Manning, S. D., Motiwala, A. S., Springman, A. C., Qi, W., Lacher, D. W., Ouellette, L. M., Mladonicky, J. M., Somsel, P., Rudrik, J. T., Dietrich, S. E., Zhang, W., Swaminathan, B., Alland, D., Whittam, T. S.
(2008). From the Cover: Variation in virulence among clades of Escherichia coli O157:H7 associated with disease outbreaks. Proc. Natl. Acad. Sci. USA
105: 4868-4873
[Abstract]
[Full Text]
-
Hussein, H. S.
(2007). Prevalence and pathogenicity of Shiga toxin-producing Escherichia coli in beef cattle and their products. J ANIM SCI
85: E63-E72
[Abstract]
[Full Text]
-
Besser, T. E., Shaikh, N., Holt, N. J., Tarr, P. I., Konkel, M. E., Malik-Kale, P., Walsh, C. W., Whittam, T. S., Bono, J. L.
(2007). Greater Diversity of Shiga Toxin-Encoding Bacteriophage Insertion Sites among Escherichia coli O157:H7 Isolates from Cattle than in Those from Humans. Appl. Environ. Microbiol.
73: 671-679
[Abstract]
[Full Text]
-
Steele, M., Ziebell, K., Zhang, Y., Benson, A., Konczy, P., Johnson, R., Gannon, V.
(2007). Identification of Escherichia coli O157:H7 Genomic Regions Conserved in Strains with a Genotype Associated with Human Infection. Appl. Environ. Microbiol.
73: 22-31
[Abstract]
[Full Text]
-
Vidovic, S., Korber, D. R.
(2006). Prevalence of Escherichia coli O157 in Saskatchewan Cattle: Characterization of Isolates by Using Random Amplified Polymorphic DNA PCR, Antibiotic Resistance Profiles, and Pathogenicity Determinants.. Appl. Environ. Microbiol.
72: 4347-4355
[Abstract]
[Full Text]
-
Zhang, W., Qi, W., Albert, T. J., Motiwala, A. S., Alland, D., Hyytia-Trees, E. K., Ribot, E. M., Fields, P. I., Whittam, T. S., Swaminathan, B.
(2006). Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms. Genome Res
16: 757-767
[Abstract]
[Full Text]
-
Nemoy, L. L., Kotetishvili, M., Tigno, J., Keefer-Norris, A., Harris, A. D., Perencevich, E. N., Johnson, J. A., Torpey, D., Sulakvelidze, A., Morris, J. G. Jr., Stine, O. C.
(2005). Multilocus Sequence Typing versus Pulsed-Field Gel Electrophoresis for Characterization of Extended-Spectrum Beta-Lactamase-Producing Escherichia coli Isolates. J. Clin. Microbiol.
43: 1776-1781
[Abstract]
[Full Text]
-
Wick, L. M., Qi, W., Lacher, D. W., Whittam, T. S.
(2005). Evolution of Genomic Content in the Stepwise Emergence of Escherichia coli O157:H7. J. Bacteriol.
187: 1783-1791
[Abstract]
[Full Text]
-
Yang, Z., Kovar, J., Kim, J., Nietfeldt, J., Smith, D. R., Moxley, R. A., Olson, M. E., Fey, P. D., Benson, A. K.
(2004). Identification of Common Subpopulations of Non-Sorbitol-Fermenting, {beta}-Glucuronidase-Negative Escherichia coli O157:H7 from Bovine Production Environments and Human Clinical Samples. Appl. Environ. Microbiol.
70: 6846-6854
[Abstract]
[Full Text]
-
Vali, L., Wisely, K. A., Pearce, M. C., Turner, E. J., Knight, H. I., Smith, A. W., Amyes, S. G. B.
(2004). High-Level Genotypic Variation and Antibiotic Sensitivity among Escherichia coli O157 Strains Isolated from Two Scottish Beef Cattle Farms. Appl. Environ. Microbiol.
70: 5947-5954
[Abstract]
[Full Text]
-
Brussow, H., Canchaya, C., Hardt, W.-D.
(2004). Phages and the Evolution of Bacterial Pathogens: from Genomic Rearrangements to Lysogenic Conversion. Microbiol. Mol. Biol. Rev.
68: 560-602
[Abstract]
[Full Text]
-
Ly, A., Henderson, J., Lu, A., Culham, D. E., Wood, J. M.
(2004). Osmoregulatory Systems of Escherichia coli: Identification of Betaine-Carnitine-Choline Transporter Family Member BetU and Distributions of betU and trkG among Pathogenic and Nonpathogenic Isolates. J. Bacteriol.
186: 296-306
[Abstract]
[Full Text]
-
Zhang, C., Zhang, M., Ju, J., Nietfeldt, J., Wise, J., Terry, P. M., Olson, M., Kachman, S. D., Wiedmann, M., Samadpour, M., Benson, A. K.
(2003). Genome Diversification in Phylogenetic Lineages I and II of Listeria monocytogenes: Identification of Segments Unique to Lineage II Populations. J. Bacteriol.
185: 5573-5584
[Abstract]
[Full Text]
-
Noller, A. C., McEllistrem, M. C., Stine, O. C., Morris, J. G. Jr., Boxrud, D. J., Dixon, B., Harrison, L. H.
(2003). Multilocus Sequence Typing Reveals a Lack of Diversity among Escherichia coli O157:H7 Isolates That Are Distinct by Pulsed-Field Gel Electrophoresis. J. Clin. Microbiol.
41: 675-679
[Abstract]
[Full Text]
-
Krause, D. O., Smith, W. J. M., Conlan, L. L., Gough, J. M., Anna Williamson, M., McSweeney, C. S.
(2003). Diet influences the ecology of lactic acid bacteria and Escherichia coli along the digestive tract of cattle: neural networks and 16S rDNA. Microbiology
149: 57-65
[Abstract]
[Full Text]
-
Taylor, D. E., Rooker, M., Keelan, M., Ng, L.-K., Martin, I., Perna, N. T., Burland, N. T. V., Blattner, F. R.
(2002). Genomic Variability of O Islands Encoding Tellurite Resistance in Enterohemorrhagic Escherichia coli O157:H7 Isolates. J. Bacteriol.
184: 4690-4698
[Abstract]
[Full Text]