 |
INTRODUCTION |
Bacteroides
thetaiotaomicron and other human colonic Bacteroides
species utilize a variety of polysaccharides as a source of carbon and
energy (15). This trait may be important for their survival in the human colon because polysaccharides are the main form
of carbohydrate available to colon bacteria. The starch utilization system of B. thetaiotaomicron is the best studied of the
Bacteroides polysaccharide utilization systems. Previously,
a cluster of starch utilization genes, designated sus genes,
was identified and characterized (4, 5, 13, 14). This
cluster contains seven structural genes (susA to
susG), most of which encode proteins that mediate the
initial steps in starch utilization, such as starch binding and starch
hydrolysis (13, 14). These genes are organized into two
transcriptional units (5, 14), one containing
susA and one containing susB to susG.
Expression of the structural genes is regulated at the transcriptional
level by maltose and higher oligomers of starch. Regulation is mediated
by SusR, a protein encoded by a gene that is located upstream of
susA. Unlike the structural genes, susR is
constitutively expressed (5). Since multiple copies of
susR in trans increased sus gene
expression and since a disruption in susR abolished
expression of susA-susG, it appeared that SusR alone was
responsible for controlling expression of the structural genes. In this
report, we show that there is at least one other regulatory gene that participates in control of sus gene expression.
No other starch utilization genes were found in the region of the
sus gene cluster, but it was clear that B. thetaiotaomicron must have other starch utilization genes. For one
thing, disruption of susB, which encodes an
-glucosidase,
did not eliminate all of the
-glucosidase activity in cell extracts.
For another, the susR disruption mutant still grew as well
as wild type on maltose and maltotriose even though it could not grow
on higher oligomers. Thus, other maltose utilization genes must be
located elsewhere on the chromosome. We report here that although a
search for mutants unable to grow on maltose and maltotriose failed to
locate the second
-glucosidase gene or any other genes encoding
maltose utilization proteins, it did unexpectedly yield a second
regulatory gene, malR, that controls expression of the
sus genes, as well as expression of the second
-glucosidase.
 |
MATERIALS AND METHODS |
Bacterial strains and growth conditions.
The bacterial
strains and plasmids used in this study are listed in Table
1. All Escherichia coli
strains used in this study were grown in Luria-Bertani (LB) broth or on
LB agar at 37°C. B. thetaiotaomicron 5482, transposon-generated derivatives, and some singly or doubly
disrupted mutants used in this study have been described previously
(1, 4, 14).
Bacteroides strains were grown initially in a prereduced
Trypticase-yeast extract-glucose (TYG) medium. For the characterization of Bacteroides strains, cells were transferred to a defined
minimal medium (9) containing glucose, maltose,
maltotriose, amylopectin, or dextran (0.3% [wt/vol]), respectively,
as a sole carbohydrate source. Antibiotic concentrations used in this
study were as follows: ampicillin, 50 µg/ml; chloramphenicol at 20 µg/ml (E. coli) or at 15 µg/ml (B. thetaiotaomicron); erythromycin, 10 µg/ml; gentamicin, 200 µg/ml; and tetracycline at 10 µg/ml (E. coli), at 3 µg/ml for selection after conjugation and measurement of growth
rates, and otherwise at 1 µg/ml (B. thetaiotaomicron),
unless it is mentioned specifically.
DNA methods.
Isolation of plasmids was done by using a
Wizard Plus DNA purification system (Promega Corp.). Dephosphorylation
reactions and restriction digests were performed in accordance with the manufacturer's instructions (Bethesda Research Laboratories
[Bethesda, Md.] or New England BioLabs [Beverly, Mass.]).
Transformation of E. coli DH5
MCR was done by the method
of Lederberg and Cohen (10). Conjugations, where
constructs generated in E. coli were transferred to
Bacteroides recipients, were performed as described by
Shoemaker et al. (17). Insertional and replicative shuttle vectors were mobilized from E. coli donors to
Bacteroides recipients by transfer genes of RP4 integrated
in the chromosome of S17-1 (19). Southern blotting was
done as described by Maniatis et al. (11) except that a
Renaissance Detection Kit (DuPont-NEN) was used for detection of the
bound DNA probe.
Chemicals.
Glucose, maltose, maltotriose, amylopectin,
dextran, phenylmethylsulfonyl fluoride,
p-nitrophenyl-
-D-glucopyranoside,
were purchased from Sigma Corp.
4-Nitrophenyl-
-D-maltoheptaoside-4,6-O-ethylidene was purchased from Boehringer Mannheim Biochemicals.
Isolation of a B. thetaiotaomicron mutant
deficient in maltose and maltotriose utilization.
To isolate a
mutant of B. thetaiotaomicron that was deficient in maltose
and maltotriose utilization, transposon mutagenesis was done by
introducing the Bacteroides transposon Tn4351
into two different hosts: B. thetaiotaomicron 5482 (wild
type) and the susR disruption mutant B. thetaiotaomicron
susR (BT
susR). In the
mutant strain, BT
susR, the susR gene had been
disrupted by a single crossover insertion of the suicide vector, pBT-1, into which an internal segment of susR had been cloned
(5). The selectable marker on pBT-1 was a tetracycline
resistance gene, tetQ, so that the selectable marker on
Tn4351, the erythromycin resistance gene ermF,
could be used. Tn4351 was introduced into the wild-type
strain or the BT
susR mutant by conjugation, by using as a
donor E. coli HB101 containing Tn4351 on the
self-transmissible IncP plasmid, R751 (2, 12).
Transconjugants harboring Tn4351 insertions were selected by
growth on TYG agar plates containing erythromycin (10 µg/ml) and
gentamicin (200 µg/ml). The gentamicin selection eliminated the
E. coli donors. Tetracycline (3 µg/ml) was also included
in the medium to ensure retention of the pBT-1 insertion in
BT
susR. Transconjugants were screened for growth on
maltose-defined medium agar plates.
Cloning of DNA adjacent to the Tn4351 insertion in
B. thetaiotaomicron MAL (BTMAL).
The strategy used
to clone DNA adjacent to the Tn4351 insertion is shown in
Fig. 1. Chromosomal DNA was isolated from
the mutant and digested with EcoRI. EcoRI cuts
Tn4351 near one end of each of the directly repeated
insertion sequence (IS) elements that flank Tn4351 but
nowhere else in the transposon. The EcoRI fragments were
ligated into the EcoRI site of pUC19. E. coli DH5
MCR transformants were plated onto Luria agar
containing ampicillin (100 µg/ml) and X-Gal
(5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside; 40 µg/ml). White colonies on X-Gal plates were screened for the Tn4351 junction fragment by colony hybridization, by using a
probe that contained IS element DNA. To clone the other chromosomal junction, we first recloned the EcoRI fragment containing IS
DNA into pGERM. This clone was transferred to wild-type B. thetaiotaomicron to create a single crossover insertion in the
cloned region. Chromosomal DNA from the resulting strain was digested
with PstI, religated, and then transformed into E. coli with selection for ampicillin. PstI cuts only once
in pGERM and not at all in the IS element. Thus, ampicillin-resistant
transformants should contain chromosomal DNA adjacent to the insertion
site on both sides of the transposon insertion.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 1.
Cloning of pMAL-Right and pMAL-Left to sequence the
region where Tn4351 is inserted in BTMAL. The position
of the transposon insertion in BTMAL is indicated by the black
rectangle. The heavy horizontal arrows in Tn4351
indicate the direct repeat insertion sequence (IS4351).
Tn4351 carries an erythromycin resistance gene
(ermF), which is expressed only in
Bacteroides strains, and a tetracycline resistance gene
(tetX), which is expressed only in aerobically grown
E. coli strains. pGERM, a suicide vector in
Bacteroides, has a different erythromycin resistance
gene (ermG). The double lines (=) indicate
Bacteroides chromosomal DNA. Abbreviations: RI,
EcoRI; P, PstI
|
|
The clones were sequenced by the University of Illinois Biotechnology
Automated Sequencing Facility (University of Illinois Biotechnology
Center, Urbana). The BLAST network service was used to search for
proteins in the databases that have homology with the open reading
frames (ORFs) of the sequenced DNA.
Enzyme assays.
-Glucosidase activity and amylase activity
in sonically disrupted cell extracts were measured by determining the
rate of hydrolysis of
p-nitrophenyl-
-D-glucopyranoside
and
4-nitrophenyl-
-D-maltoheptaoside-4,6-O-ethylidene, respectively.
-Glucosidase activity was measured as described by
Smith and Salyers (20). Amylase activity was measured with 2 mM
4-nitrophenyl-
-D-maltoheptaoside-4,6-O-ethylidene
in potassium phosphate buffer (20 mM, pH 6.5) at 37°C (Boehringer
Mannheim Biochemicals). The protein concentration in each extract was
measured by using the Bio-Rad DC protein kit. The
Km values of the
-glucosidases were
calculated from a Lineweaver-Burke plot. BT
susB was used to determine the Km of the second
-glucosidase, and BT
malR was used to determine the
Km of the susB-encoded
-glucosidase.
-Glucuronidase (GUS) assays, used to monitor
expression of uidA (GUS) fusions, were done as described by
Feldhaus et al. (6).
malR gene expression.
To provide malR in trans on
a multicopy plasmid, malR was amplified by PCR with primers
TCAAAGTACTGGATCCCGAAATGACC, which lies ca. 300 bp upstream
of the first start codon in the ORF, and
TATATTGACAGGATCCATGTACTTGT, which lies ca. 150 bp downstream of the first stop codon in the ORF. This product (ca. 1.2 kb) was
cloned into pT-COW, which has a copy number in Bacteroides of 5 to 10 (22). The resulting vector was called pMALR.
To create a malR-uidA (GUS) fusion for studies of
malR expression, a DNA segment including the promoter region
of malR was first amplified by PCR with primers
TCAAAGTACTGGATCCCGAAATGACC and
AATCAGCGATGGATCCAGACGTCCAC, a sequence which lies ca. 210 bp
upstream of the first stop codon in the ORF, and then cloned into
pMJF-2, a shuttle vector which has the GUS gene clomed downstream of a
multiple cloning site. The resulting vector was called pMALRGUS.
To monitor malR expression in the chromosome, a DNA segment
containing an internal portion of the malR gene was
amplified by PCR, by using the forward primer
CCTCTCATTTGAGGATCCTCATTACC and the reverse primer
AATCAGCGATGGATCCAGACGTCCAC, and then cloned into pCQW-1, a
GUS suicide vector (6). This vector was called p
MALRGUS. The plasmids were transferred to Bacteroides
strains by conjugation.
Reverse transcription-PCR (RT-PCR) was also used to examine the
expression of malR. B. thetaiotaomicron was grown on
the defined medium containing 0.3% (wt/vol) glucose or maltose as a
sole carbon source. A portion (5 ml) of the culture was harvested at an
optical density at 650 nm of 0.3. A Qiagen RNeasy kit (Qiagen,
Chatsworth, Calif.) was used for the isolation of total RNA from cells.
To prevent DNA contamination, the RNA was treated with Recombinant RNasin RNase Inhibitor and RQ1 RNase-free DNase (Promega, Madison, Wis.). Superscript II RNase
reverse
transcriptase (Gibco-BRL) was used for the synthesis of cDNA from the
isolated RNA.
Nucleotide sequence accession number.
The nucleotide
sequence of malR region (Fig.
2A) has been deposited in GenBank under
accession number AF391102.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Map showing the relative locations of ORFs in the
malR gene area. The position of the transposon insertion
in mutant BTMAL is indicated by the vertical arrow above the map. DNA
segments used to make insertional disruptions are shown as horizontal
lines under the map and marked with an " ." The sizes of the DNA
fragments used to make the disruptions are also indicated under the
lines. gs, putative glutamine synthetase gene;
malR, putative regulatory protein gene;
-nagA, putative
-N-acetylglucosaminidase gene. (B) Deduced amino acid
sequence of malR. A possible carboxy-terminal
helix-turn-helix motif is underlined. The vertical arrow indicates the
transposon insertion site in the transposon-generated mutant, BTMAL.
|
|
 |
RESULTS |
Isolation of a mutant with reduced ability to grow on maltose and
maltotriose.
A screen of thousands of transposon-generated mutants
of wild-type B. thetaiotaomicron was done to find mutants
that had lost the ability to utilize maltose or maltotriose. No such
mutants were found. A possible explanation for the failure to find such mutants was that the sus genes were contributing to the
utilization of maltose and maltotriose, and this redundancy with the
other maltose or maltotriose utilization genes made it impossible for a
single transposon insertion to abolish maltose utilization. Accordingly, a mutant with a disruption in susR
(BT
susR) was used as the background for transposon
mutagenesis. This mutant did not produce any of the Sus structural
proteins. Over 15,000 transposon-generated mutants were screened for
maltose and maltotriose utilization. One mutant was found that was
deficient in the ability to grow on maltose and maltotriose. The mutant
was named BTMAL. The growth rate of BTMAL on glucose (0.45 h
1) was the same as that of the parent strain,
BT
susR, but BTMAL had one-fourth the growth rate of the
parent strain on maltose (0.11 h
1) and did not
grow at all on maltotriose.
The DNA sequence of a 4.1-kb chromosomal DNA segment, in which the
transposon had inserted, was analyzed. There were three possible ORFs
in this segment. The transposon had disrupted a small orf in
the middle of the segment (Fig. 2A). This small orf, which
was 699 bp in size, was designated malR. The deduced amino acid sequence of the MalR protein had a low amino acid sequence homology (21 to 26% identity, 45 to 47% similarity) to
transcriptional regulators of the Crp/Fnr family from Bacillus
subtilis, Pseudomonas spp., and Aquifex
aeolicus. A possible helix-turn-helix DNA-binding motif was found
in the carboxy terminus (Fig. 2B). Tn4351 inserted 18 bp
upstream of the 3' end of malR.
The amino acid sequences of the ORFs upstream and downstream of
malR had significant sequence homology to a glutamine
synthetase from Bacteroides fragilis and a putative
-N-acetylhexosaminidase from Porphyromonas
gingivalis, respectively. Thus, they seemed unlikely to be
involved in maltose utilization. Nonetheless, single crossover
disruptions were constructed in each of the three ORFs in
BT
susR. The only disruption that had the same phenotype
as the mutant was the disruption in malR
(BT
susR
malR; Fig.
3). Hence, malR alone among
these ORFs was responsible for the reduced maltose utilization
phenotype (Fig. 3). A disruption of malR in the wild-type
background (BT
malR) reduced somewhat the rate of growth
on both maltose and maltotriose, but the bacteria were still able to
grow on these substrates (Fig. 3). This result supports the hypothesis
that maltotriose and maltose are utilized via the sus
system, as well as by the mal system.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 3.
Growth rates of various mutants on glucose, maltose, and
maltotriose. The medium used was defined medium that contained glucose,
maltose, and maltotriose, and the results are indicated by the three
shaded bars in each set from left to right, respectively. The
concentrations of antibiotics used in this experiment were 3 µg/ml
for tetracycline (Tc) and 10 µg/ml for erythromycin (Em). These
measurements were done in triplicate; the range of values is indicated
by the error bars. B. thetaiotaomicron BT4009 was used
as the wild-type control because it contains a single copy of
tetQ and ermF. Thus, either tetracycline
or erythromycin or both (Tc, Em) can be added to the medium used to
grow both the control and the mutant strains. This eliminates the
slight differences in growth rate that can sometimes occur due to the
presence of antibiotics in the medium (note the difference between
"Tc" columns versus the "Tc, Em" columns). The selectable
marker used to create the BT malR strain was
ermF, and the marker used to create the
BT susR strain was tetQ. The double
mutant BT susR malR contained both
resistance genes.
|
|
The malR gene controls expression of the second
-glucosidase.
-Glucosidase and amylase activities in the
various mutant strains were measured. Amylase activity was used as an
indicator of the sus gene expression because the only
amylases produced by B. thetaiotaomicron are encoded by
susA and susG (16). Thus, the
activity of these proteins is a good indicator of the activity of
proteins encoded in this region. As expected, BT
susR had
no detectable amylase activity and had lower
-glucosidase activity than the wild type (Table 2). The
-glucosidase activity remaining in extracts from the
BT
susR mutant did not come from SusB; when we disrupted
susB, the level of
-glucosidase activity was similar to
that of BT
susR. When malR in
BT
susR was disrupted to create BT
susR
malR, virtually all of the
-glucosidase activity disappeared. This was also true of
BT
susB
malR. Hence, malR controls
expression of the second
-glucosidase.
Comparison of properties of the two
-glucosidases.
Cell
extracts from BT
malR and BT
susB were used
to assay SusB and the second
-glucosidase, respectively. The
Km values of the two
-glucosidases were
similar: 132 µM for SusB and 103 µM for the second
-glucosidase.
Also, the cellular location of these two
-glucosidase were the same.
SusB partitioned to the inner membrane fraction but could be eluted by
washing the membrane with 0.5 M NaCl (4). This was also
the case for the second
-glucosidase; about two-thirds of the
-glucosidase activity partitioned with the membrane fraction. There
was, however, a difference in the stability of the two enzymes in cell
extracts. The second
-glucosidase was not stable even at 4°C. The
enzyme activity that was detectable in a cell extract from
BT
susB after 14 h at 4°C was just 33% of the
initial activity. In contrast, 87% of the original activity was
detectable in an extract from BT
malR that had been stored
for 14 h at 4°C.
malR regulates expression of sus
genes.
If malR regulates only the expression of the
second
-glucosidase, BT
malR should still have full
SusB and amylase (SusA and SusG) activity. That is, the
-glucosidase
activity of the malR disruption strain
(BT
malR) should be ca. 53 U/g of cell protein, the value
of the activity in BT5482 extracts minus the activity in
BT
susR extracts, and the amylase activity should be 49 to 50 U/g of cell protein. However, the
-glucosidase activity in BT
malR extracts was only 14 U/g cell protein, one-fourth
of the expected value (Table 2). Moreover, the amylase activity in
BT
malR extracts was much lower than in extracts from wild
type. Thus, malR seems to be necessary for full expression
of the sus genes. To make sure that the
-glucosidase of
BT
malR was due to SusB, we disrupted susB in
BT
malR to create BT
susB
malR.
BT
susB
malR has no detectable
-glucosidase activity. Thus, the
-glucosidase activity in
extracts from BT
malR came from SusB. The
-glucosidase specific activity in BT
susR extracts was almost the same
as in BT
susB extracts, so SusR does not control the
expression of the
-glucosidase controlled by MalR.
Interestingly, the amylase activity of BT
susB was higher
than that of wild type. We measured the amylase activities of several mutants with disruptions in genes downstream of susB such as
susC, susE, or susG and amylase
activities of those strains were almost the same as that of wild type
(data not shown). Thus, only the disruption in susB
increased amylase activity from SusA. This increased amylase activity
could be due to the fact that maltose, the inducer of sus
gene expression, was not broken down as rapidly in the cell. Higher
levels of maltose could make SusR and/or MalR better able to activate
gene expression.
The malR disruption in BT
susB abolished
virtually all of the
-glucosidase in the cell extract, the
double-disruption strain, BT
susB
malR, yet
the mutant still grew slowly on maltose (0.11 h
1). Thus, there might be the third
-glucosidase in BT5482 that is not detected by our enzyme assay.
The growth rate of BT
malR on the starch amylopectin was
measured. Even though the malR gene disruption lowered the
-glucosidase and amylase activities, the growth rate of
BT
malR (0.39 h
1) on amylopectin
was only slightly lower than that of the wild type (0.49 h
1).
Effect of providing malR in
trans.
The data from disruption mutants indicated
that malR had its own promoter, because disruptions in the
adjacent ORFs had no effect on maltose utilization. Accordingly,
malR plus ca. 300 bp of upstream DNA was cloned to produce
pMALR and was introduced into wild type and BT
malR. The
plasmid in which malR was cloned has a copy number of ca. 5 to 10 copies per cell (22). When pMALR was present in
BT
malR,
-glucosidase and amylase activities were
twofold higher than those of BT
malR (Table
3), so malR in
trans complemented the disrupted chromosomal malR
and increased expression of starch utilization genes. This same effect
was seen when pMalR was introduced into the wild-type strain (Table 3). These results showed that MalR is not an
-glucosidase but is a
regulatory protein that regulates positively genes encoding
-glucosidase, amylase genes (susA and susG)
and presumably susC to susF as well. The growth
rate of BT5482(pMALR) on amylopectin was 0.61 h
1, a value slightly higher than that of a
control strain, BT5482(pT-COW), which contained only the vector into
which malR was cloned (0.52 h
1).
To determine whether malR exerted its effect on expression
of the sus genes in the absence of SusR, pMALR was
transferred into Ms-1, a mutant strain of B. thetaiotaomicron strain that has a transposon insertion in
susR. In this background multiple copies of malR
in trans did not restore expression of the sus genes (Table 3).
pMALR was transferred into BT
susB, a susB
disruption strain, to determine whether multiple copies of
malR in trans increased the activity of the
second
-glucosidase. The
-glucosidase activity in
BT
susB(pMALR) did not increase compared to
BT
susB. Thus, excess MalR does not have the same effect
on the expression of the second
-glucosidase as it does on
sus gene expression. The amylase activity of
BT
susB(pMALR) was almost the same as that of
BT
susB. Thus, multiple copies of malR in
BT
susB(pMALR) did not increase amylase activity further.
malR is expressed constitutively, and its expression is not
autoregulated.
RT-PCR was used to determine whether
malR is expressed constitutively or is induced by maltose.
Expression of susD was used as a control. RT-PCR detected
susD mRNA only when cells were grown on maltose (Fig.
4). In contrast, malR mRNA was
detected in cells grown on glucose as well as in cells grown on maltose
(Fig. 4). Thus, malR is expressed constitutively.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 4.
Detection of malR expression on glucose
and maltose by using RT-PCR. Odd-numbered lanes contain negative
controls in which the reaction was done without the RT step. The
expression of the maltose-regulated susD gene was used
as a control to assess whether we could detect regulated gene
expression (lane 2, glucose [G]-grown cells; lane 4, maltose
[M]-grown cells). The region amplified from susD was
0.5 kb in size. To check malR expression (lanes 6 and
8), a 0.4-kbp region of the mRNA was amplified. The 1-kb ladder
(Gibco-BRL) is seen in the two outside lanes.
|
|
To confirm the RT-PCR data and to determine whether the expression of
malR is autoregulated, a GUS fusion shuttle vector was used
to monitor malR expression. A DNA segment that contained the
malR promoter region and the 5' end of malR
cloned into pMJF-2 (pMALGUS) produced similar levels of GUS activity on
glucose and maltose (Table 4). pMALR was
transferred into BT5482(pMALRGUS) to create BT5482(pMALRGUS,
pMALR). The two plasmids are compatible and have approximately the same
copy number (5 to 10). Therefore, this arrangement should provide a
similar level of MalR relative to the malR promoter, as is
present in the wild type, but a higher level of MalR relative to the
GUS fusion than in the strain that contained only the GUS fusion
plasmid and one copy of malR in the chromosome. The GUS
activity of this strain was almost the same as that of
BT5482(pMALRGUS) (Table 4). The fact that expression from the
malR promoter was not affected by different amounts of MalR
in the cell suggests that the expression of malR is not
autoregulated.
 |
DISCUSSION |
Our results suggest that the genes controlled by susR
and malR encode most or all of the proteins responsible for
utilization of maltotriose. Disrupting both of these genes abolished
growth on maltotriose and severely reduced growth on maltose. Proteins encoded by the sus genes aid in maltotriose utilization but
do not contribute significantly to utilization of maltose because disruption of susR decreases growth on maltotriose but not
growth on maltose. In contrast, disruption of malR decreases
the rate of growth on both maltose and maltotriose. The malR
gene was not linked genetically to the gene encoding the second
-glucosidase or to any other structural genes that may be under MalR
control, so there is as yet little information about the genes MalR
controls other than the sus genes. An attempt to purify the
second
-glucosidase failed due to the instability of the enzyme
(data not shown), so it was not possible to use N-terminal sequencing
as a basis for designing a probe to locate the gene encoding it. The
Km for this enzyme was virtually identical
to that of SusB. In fact, the only difference between the two enzymes
was stability in cell extracts. This raises the question of why there
are two
-glucosidases, which appear to have redundant
characteristics, and why one is associated with the sus
system and one is not.
MalR appears to be a regulatory protein. Not only does it have amino
acid similarity to known regulatory proteins, but its loss affects the
activities of more than one protein. This latter observation supports
the hypothesis that MalR controls the transcription of the genes
encoding these proteins and probably other genes as well. The fact that
the transcription of susB is affected by a malR
disruption indicates that transcription of the other genes in the
susB-susG operon would also be affected. An unexpected role
of malR is its effect on sus gene expression. The
sus genes were thought to be controlled only by
susR, but results reported here show that disruption of
malR reduced expression of the sus structural
genes by 5- to 10-fold. Loss of SusR, however, did not seem to affect
the expression of the
-glucosidase controlled by MalR. Since both
susR and malR are expressed constitutively, it is
likely that SusR and Mal R proteins interact with each other rather
than one controlling the other's expression.
An alternative possibility is that the second
-glucosidase or one of
the other proteins encoded by MalR-controlled genes is not involved in
catabolism of maltose but rather converts maltose to a derivative that
is a more effective inducer than maltose itself. In this case, the drop
in the expression of susA and susB in the
malR disruption strain would be due to the fact that maltose is now the only inducer available to interact with SusR. This would
explain why MalR seems to influence expression of the sus genes but SusR does not seem to influence expression of the
MalR-controlled
-glucosidase. If SusR and MalR proteins formed a
complex that increases transcription of the sus genes, one
would expect this same complex to be responsible for expression of the
MalR-controlled genes. The hypothesis that a MalR-controlled gene
encodes an enzyme that makes a better inducer would also explain why
expression of the sus genes is decreased in the
malR disruption strain but does not fall to zero.
The results reported here suggest that the MalR regulon and the SusR
regulon together account for all of the genes needed to grow on
maltotriose and starch. The very low rate of growth of the
BT
susB
malR strain on maltose could be due
to uptake and breakdown of maltose by transporters and enzymes that
normally handle a closely related substrate such as melibiose or
lactose. Given that the mal and sus systems
account for most or all of the utilization of small glucosides, the
finding that the BT
malR strain still grew on starch
confirms that the susA-susG gene products are solely
responsible for the processing of starch. The fact that the
malR disruption strain was able to grow on starch nearly as
well as wild type was surprising since expression of the sus genes was decreased five- to ninefold in that strain. This observation can be explained by noting that B. thetaiotaomicron probably
never encounters in nature concentrations of starch as high as those it
encounters in laboratory medium. The bacteria may be optimized to
operate with enzyme levels lower than those seen in bacteria growing on
high concentrations of maltose. Whatever the explanation for the effect
of the disruption in malR on sus gene expression, it is clear that the starch utilization pathway and the pathway controlled by MalR are linked at the metabolic and/or regulatory level.
This work was supported by grant number AI/GM 17876 from the
National Institutes of Health.
| 1.
|
Anderson, K. L., and A. A. Salyers.
1989.
Genetic evidence that outer membrane binding of starch is required for starch utilization by Bacteroides thetaiotaomicron.
J. Bacteriol.
171:3199-3204[Abstract/Free Full Text].
|
| 2.
|
Chikami, G. K.,
D. G. Guiney,
T. J. Schmidhauser, and D. R. Helinski.
1985.
Comparison of 10 IncP plasmid: homology in the regions involved in plasmid replication.
J. Bacteriol.
162:656-660[Abstract/Free Full Text].
|
| 3.
|
Cooper, A. J.,
N. B. Shoemaker, and A. A. Salyers.
1996.
The erythromycin resistance gene from the Bacteroides conjugal transposon Tcr Emr 7853 is nearly identical to ermG from Bacillus sphaericus.
Antimicrob. Agents Chemother.
39:797-805[Medline].
|
| 4.
|
D'Elia, J. N., and A. A. Salyers.
1996.
Contribution of a neopullulanase, a pullulanase, and an -glucosidase to growth of Bacteroides thetaiotaomicron on starch.
J. Bacteriol.
178:7173-7179[Abstract/Free Full Text].
|
| 5.
|
D'Elia, J. N., and A. A. Salyers.
1996.
Effect of regulatory protein levels on utilization of starch by Bacteroides thetaiotaomicron.
J. Bacteriol.
178:7180-7186[Abstract/Free Full Text].
|
| 6.
|
Feldhaus, M. J.,
V. Hwa,
Q. Cheng, and A. A. Salyers.
1991.
Use of an Escherichia coli -glucuronidase gene as a reporter gene for investigation of Bacteroides promoters.
J. Bacteriol.
173:4540-4543[Abstract/Free Full Text].
|
| 7.
|
Gardner, R. G.,
J. B. Russell,
D. B. Willson,
G.-R. Wang, and N. B. Shoemaker.
1996.
Use of a modified Bacteroides-Prevotella shuttle vector to transfer a reconstructed -1,4-D-endoglucanase gene into Bacteroides uniformis and Prevotella ruminicola B14.
Appl. Environ. Microbiol.
62:196-202[Abstract].
|
| 8.
|
Hanahan, D.
1983.
Studies on the transformation of Escherichia coli with plasmids.
J. Mol. Biol.
166:557-580[Medline].
|
| 9.
|
Kotarski, S. F., and A. A. Salyers.
1984.
Isolation and characterization of outer membranes of B. thetaiotaomicron grown on different carbohydrates.
J. Bacteriol.
158:102-109[Abstract/Free Full Text].
|
| 10.
|
Lederberg, E. M., and S. M. Cohen.
1974.
Transformation of Salmonella typhimurium by plasmid deoxyribonucleic acid.
J. Bacteriol.
119:1072-1074[Abstract/Free Full Text].
|
| 11.
|
Maniatis, T.,
E. F. Fritsch, and J. Sambrook.
1982.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 12.
|
Meyer, R. J., and J. A. Shapiro.
1980.
Genetic organization of the broad-host-range IncP-1 plasmid R751.
J. Bacteriol.
143:1362-1373[Abstract/Free Full Text].
|
| 13.
|
Reeves, A. R.,
J. N. D'Elia, and A. A. Salyers.
1996.
A Bacteroides thetaiotaomicron outer membrane protein that is essential for utilization of maltooligosaccharides and starch.
J. Bacteriol.
178:823-830[Abstract/Free Full Text].
|
| 14.
|
Reeves, A. R.,
G.-R. Wang, and A. A. Salyers.
1997.
Characterization of four outer membrane proteins that play a role in utilization of starch by Bacteroides thetaiotaomicron.
J. Bacteriol.
179:643-649[Abstract/Free Full Text].
|
| 15.
|
Salyers, A. A.,
J. R. Vercellotti,
S. H. E. West, and T. D. Wilkins.
1977.
Fermentation of mucin and plant polysaccharides by strains of Bacteroides from the human colon.
Appl. Environ. Microbiol.
33:319-322[Abstract/Free Full Text].
|
| 16.
|
Shipman, J. A.,
K. H. Cho,
H. A. Siegel, and A. A. Salyers.
1999.
Physiological characterization of SusG: an outer membrane protein essential for starch utilization by Bacteroides thetaiotaomicron.
J. Bacteriol.
181:7206-7211[Abstract/Free Full Text].
|
| 17.
|
Shoemaker, N. B.,
C. Getty,
E. P. Guthrie, and A. A. Salyers.
1986.
Regions in Bacteroides plasmids pBFTM10 and pB8-51 that allow Escherichia coli-Bacteroides shuttle vectors to be mobilized by IncP plasmids and by a conjugative Bacteroides tetracycline resistance element.
J. Bacteriol.
166:959-965[Abstract/Free Full Text].
|
| 18.
|
Shoemaker, N. B.,
G.-R. Wang, and A. A. Salyers.
2000.
Multiple gene products and sequences required for the excision of the mobilizable integrated Bacteroides element NBU1.
J. Bacteriol.
182:928-936[Abstract/Free Full Text].
|
| 19.
|
Simon, R.,
U. Priefer, and A. Puhler.
1983.
A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram-negative bacteria.
Bio/Technology
1:784-791[CrossRef].
|
| 20.
|
Smith, K. A., and A. A. Salyers.
1991.
Characterization of a neopullulanase and an -glucosidase from Bacteroides thetaiotaomicron 95-1.
J. Bacteriol.
173:2962-2968[Abstract/Free Full Text].
|
| 21.
|
Tancula, E.,
M. J. Feldhaus,
L. A. Bedzyk, and A. A. Salyers.
1992.
Location and characterization of genes involved in binding of starch to the surface of Bacteroides thetaiotaomicron.
J. Bacteriol.
174:5609-5616[Abstract/Free Full Text].
|
| 22.
| Wang, J., G.-R. Wang, N. B. Shoemaker,
and A. A. Salyers. Production of two proteins encoded by the
Bacteroides mobilizable transposon, NBU1, correlates with
the time-dependent accumulation of the excised NBU1 circular form. J. Bacteriol. 183:6335-6343.
|