Previous Article | Next Article 
Journal of Bacteriology, December 2001, p. 7318-7328, Vol. 183, No. 24
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.24.7318-7328.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Global Transcriptional Response of Bacillus
subtilis to Heat Shock
John D.
Helmann,1,*
Ming Fang Winston
Wu,2
Phil A.
Kobel,2
Francisco-Javier
Gamo,3
Michael
Wilson,2,
Maud M.
Morshedi,2
Marc
Navre,2 and
Chris
Paddon2
Department of Microbiology, Cornell
University, Ithaca, New York 14853-81011;
Affymax Research Institute, Santa Clara, California
950512; and Molecular Microbiology
Department, Glaxo Wellcome, SA, C/Severo Ochoa, 28760 Tres Cantos,
Spain3
Received 10 July 2001/Accepted 12 September 2001
 |
ABSTRACT |
In response to heat stress, Bacillus subtilis
activates the transcription of well over 100 different genes. Many of
these genes are members of a general stress response regulon controlled by the secondary sigma factor,
B, while others are under
control of the HrcA or CtsR heat shock regulators. We have used DNA
microarrays to monitor the global transcriptional response to heat
shock. We find strong induction of known
B-dependent
genes with a characteristic rapid induction followed by a return to
near prestimulus levels. The HrcA and CtsR regulons are also induced,
but with somewhat slower kinetics. Analysis of DNA sequences proximal
to newly identified heat-induced genes leads us to propose ~70
additional members of the
B regulon. We have also
identified numerous heat-induced genes that are not members of known
heat shock regulons. Notably, we observe very strong induction of
arginine biosynthesis and transport operons. Induction of several genes
was confirmed by quantitative reverse transcriptase PCR. In addition,
the transcriptional responses measured by microarray hybridization
compare favorably with the numerous previous studies of heat shock in
this organism. Since many different conditions elicit both specific and
general stress responses, knowledge of the heat-induced general stress
response reported here will be helpful for interpreting future
microarray studies of other stress responses.
 |
INTRODUCTION |
DNA microarray technology provides a
powerful tool for the analysis of global transcriptional responses
elicited by various physical and chemical stresses. One challenge in
this sort of analysis is to distinguish stress-specific responses from
more general stress responses. For example, in Bacillus
subtilis, many different stresses (including heat shock, osmotic
stress, and energy stress) activate the large general stress response
controlled by the
B transcription factor
(20, 44, 45). While others have used two-dimensional protein gels to classify cellular stress responses (55, 58), DNA-based methods have several advantages: they can be rapidly adapted to new organisms, they provide greater coverage
of the genome, and data processing is comparatively easy to automate.
Ultimately, it may be possible to integrate both technologies, at least
for well-studied model organisms (19, 41, 56).
We have initiated a series of studies to characterize the global
transcriptional responses of B. subtilis, a model
gram-positive microorganism. Here, we document the heat-induced general
stress response. Heat shock was chosen for this initial study since it is arguably the best-studied stress response in this organism and
includes activation of the large general stress response under the
control of
B (20, 44). In
addition, a subset of antibiotics that inhibit translation have been
reported to induce heat shock genes in other organisms
(57). It is anticipated that knowledge of transcriptional responses to antimicrobial compounds will be useful for both
antibacterial discovery and characterization (47).
Analysis of the transcriptional profile of B. subtilis after
heat shock clearly revealed the known heat shock regulons, including the large
B-dependent general stress regulon
(21, 44), together with several operons not previously
anticipated to be heat inducible. Prominent among these are operons
involved in arginine biosynthesis and transport and many candidate new
members of the
B regulon.
 |
MATERIALS AND METHODS |
Strains and growth conditions.
B. subtilis 168 strain MO945 was obtained from Niels Frandsen (GlaxoWellcome, Verona,
Italy). It was grown in Bacto Mueller Hinton Broth (Difco, Detroit,
Mich.). All experiments used baffled shake flasks. A 5-ml volume of
medium in a 50-ml flask was inoculated and grown overnight at 37°C on
a rotary platform (250 rpm). This culture was used to inoculate 50 ml
of prewarmed medium (37°C) in a 500-ml flask to an optical density at
600 nm (OD600) of 0.05. The flask was shaken on a
rotary platform (250 rpm) until an OD600 of 1.0 was attained. Samples (zero time) were taken from the 50-ml culture,
and a 20-ml aliquot was transferred to a prewarmed 250-ml flask at
48°C which was incubated in a reciprocal-shaking water bath incubator
at 48°C. A parallel identical experiment was performed with a
prewarmed 250-ml flask at 37°C and incubation in a reciprocal-shaking water bath at 37°C. Samples were removed from these flasks for RNA extraction.
Sampling and RNA isolation.
Samples of the culture were
rapidly removed into 2-ml tubes and centrifuged at 14,000 × g for 10 s, and the culture supernatant was rapidly
removed. The tubes containing the cell pellet were placed in liquid
nitrogen. The entire procedure from the start of the centrifugation to
the obtaining of the frozen pellet took approximately 40 s. Total
RNA was extracted from B. subtilis by disruption in
phenol/guanidine isothiocyanate (TRIzol; Life Technologies, Rockville,
Md.). Briefly, TRIzol and zirconium silica beads were added to each
2-ml tube containing frozen cell pellets. The tubes were shaken on a
Mini-beadbeater-8 (BioSpec Products, Bartlesville, Okla.) for four
1-min cycles. Nucleic acid was precipitated, and residual DNA was
removed with 4 U of RNase-free DNase I (Ambion, Austin, Tex.). After
extraction with phenol-chloroform, precipitation and resuspension the
RNA was quantitated with RiboGreen (Molecular Probes, Eugene, Oreg.).
Generation of ORF DNA and production of microarrays.
Oligonucleotide primers for all 4,100 open reading frames (ORFs) in the
B. subtilis genome were purchased from Eurogentec (Seraing,
Belgium). Full-length ORFs were made by PCR, with the following cycling
conditions: 1 min of denaturing at 95°C, 45 s of annealing at
55°C, and 3.5 min of elongation at 72°C. All PCR products were
purified with the QIAquick 96-well purification kit from Qiagen
(Valencia, Calif.). The quality of the amplified sequences was checked
by electrophoresis on a 1.5% agarose gel. The gels were digitally
imaged, and the band sizes were entered into a database where the
expected size was compared to the observed size. Additional data
describing faint and multiple bands were also collected. In 481 cases,
the PCRs failed to yield satisfactory products (no product, wrong size,
additional bands, or faint bands) and oligonucleotide primers for
selected genes were redesigned and obtained from Operon (Alameda,
Calif.) or MWG Biotech (High Point, N.C.). Finally, over 90% (3,703 ORFs) of the B. subtilis genome was correctly amplified.
Slide preparation and printing followed the procedures described by
Wilson et al. (64). Briefly, amplicons were suspended in
6× SSC-15% DMSO and spotted onto
poly-L-lysine-coated slides by using Telechem
(Sunnyvale, Calif.) SMP5 spotting pins and an SPH16 printhead fitted to
a Genemachines Omnigrid arrayer (1× SSC is 0.15 M NaCl plus 0.015 M
sodium citrate). Spot spacing was 230 µm. Slides were processed as
previously described (64) and stored under
N2.
cDNA labeling and slide hybridization.
Each fluorescently
labeled cDNA probe was prepared from 6 µg of DNase I-treated total
RNA by random hexamer [pd(N)6; Amersham Pharmacia Biotech, Piscataway, N.J.]-primed polymerization using reverse transcriptase (Superscript II RT; Life Technologies,
Gaithersburg, Md.). Concentrations of nucleotides in the labeling
reaction mixture were as follows: 0.5 mM dGTP, 0.5 mM dATP, 0.5 mM
dTTP, and 0.05 mM dCTP. The final concentration of Cy3-dCTP or Cy5-dCTP
(Fluorolink Cy dye- labeled dCTP; Amersham Pharmacia Biotech) was 0.04 mM. The final concentration of random hexamer was 0.06 mM.
Unincorporated dye-labeled dCTP was removed by washing the probe in a
microconcentrator (Microcon YM-30; Millipore, Bedford, Mass.).
Microarray slides were incubated for 30 min at 42°C with
prehybridization solution (1% bovine serum albumin, 0.5%
L-glutamate, 4× SSC), washed three times in
double-distilled H2O, and dried by centrifugation
at 50 × g for 90 s. For each hybridization, cDNA
probe made from RNA from untreated cells (time zero sample) was mixed
with probe made from RNA from heat-shocked cells. Each microarray
received ~22 µl of hybridization solution (4.2× SSC, 42%
formamide, 0.17% SDS, 63 µg of salmon sperm DNA/µl) containing the
two probes. The solution was applied by capillary action under a
coverslip (LifterSlip; Erie Scientific Company, Portsmouth, N.H.)
placed over the microarray. The whole assembly was sealed in a
hybridization chamber (CMT Hybridization Chamber; Corning Incorporated,
Corning, N.Y.) and submerged for 16 h in a 42°C water bath.
Microarray slides were washed for 1 min in 1× SSC-0.05% SDS, 30 s in 0.06× SSC, and again for 1 min in 0.06× SSC. Slides were dried
by centrifugation at 50 × g for 90 s and were
immediately scanned and analyzed with a confocal laser scanner/software
package (Axon GenePix 4000A/GenePix Pro 3.0; Axon Instruments, Inc.,
Foster City, Calif.).
Data analysis.
For analysis, any gene feature that had
<80% of pixels >2 standard deviations above the local background in
both channels was rejected. Ratios for levels of RNA (heat-shocked
divided by time zero sample) were calculated using a ratio of medians
method. Any gene feature wherein one channel was within one standard
deviation of the local background was flagged as giving a potentially
inaccurate ratio (indicated in the tables by values in italics; also
indicated in supplemental material S2
[http://www.micro.cornell.edu/faculty.JHelmann.html]). Data
normalization was based on the premise that the ratio of measured
expression averaged over the entire set of sorted genes for which data
was obtained is approximately equal to 1. We used a normalization
method based on the geometric mean (average of the logarithmic measures
of the ratios) rather than the arithmetic mean of ratios, as the
geometric mean accounts for down- as well as up-regulation.
Specifically, each ratio output from the scanner was multiplied by a
factor of 2
[average of
log2(ratios)].
A further explanation and proof of this normalization method are
given in the supplemental material (S1
[http://www.micro.cornell.edu/faculty.JHelmann.html]).
To check for reproducibility in the cDNA preparation and hybridization
steps, we tested the competitive hybridization of two
cDNA samples both
prepared from a culture grown at 37°C. Of the
2,033 gene signals
detected, the overall range of ratios was quite
small (1.47- to
0.62-fold range; 96% of the ratios were between
0.75 and 1.25). All
experimental data were collected by the competitive
hybridization of
three independent cDNA preparations from each
time point against the
non-heat-shocked control sample (referred
to as experiments 1 to 3). A
comparison of 90 genes previously
assigned to the heat shock stimulon
showed that for genes where
all three experiments yielded valid ratios,
46% of triplicate
ratios yielded a coefficient of variation (CV) of
<20% and 97%
yielded a CV of <40%. The entire data set for all
three experiments
can be found in the supplemental material (Table S2
[
http://www.micro.cornell.edu/faculty.JHelmann.html]).
Initial analysis focused on three overlapping sets of genes. For the
first set, the induction profiles for all reported members
of the heat
shock stimulon were compiled from all three experiments.
The resulting
data from one hybridization experiment (no. 3) are
presented in this
study except where noted. This data set was
chosen since this set of
slides yielded a more complete data set
than the other two replicates,
with more than 3,000 genes detected
with signals above background
(compared to ~2,600 genes for experiments
1 and 2). However, the
overall transcriptional response in each
set of hybridizations was very
similar (e.g., see Fig.
4). For
the second set, the 50 most highly
induced genes from each of
the nine data sets (three experiments with
three time points each)
were tabulated. The resulting list of 450 gene
signals was found
to result from 143 different genes (set 2), most of
which appeared,
as expected, in multiple experiments. For the third
set, all 405
genes induced greater than twofold at the 3-min time point
in
experiment 3 were analyzed further. Since the
B regulon was so large and was induced only
transiently, many potential
new members of this regulon were included
in set 3 but were not
found in the other two sets of
genes.
The lists of genes in sets 2 and 3 were analyzed to remove artifactual
signals as judged by nonreproducibility in the induction.
For example,
in several cases, genes were initially included in
set 2 (among the top
50 induced genes at one time point), but
further analysis indicated
that this was due to a single point
which was flagged as possibly
inaccurate as noted above. Moreover,
there was often reliable data in
the replicate experiments that
clearly showed little or no induction of
this same gene. By this
criterion, 19 genes were removed from set 2. Of
the remaining
124 genes which were reproducibly induced by heat shock,
about
half were members of known heat shock regulons (set 1). The
remaining
genes were visually analyzed to determine likely operon
organization
and inspected for the presence of candidate
B-like promoter elements. A similar treatment
was used for those
genes in set 3. Those having a plausible match to
the
B consensus are listed in Table
4, and
other heat-inducible genes
of unknown regulation are included in the
supplementary material
(Table S3
[
http://www.micro.cornell.edu/faculty.JHelmann.html]).
The heat shock
response of genes likely to be cotranscribed with
strongly induced
genes was also evaluated, and in many cases they
demonstrated very
similar folds induction and kinetics. This provides
additional support
for the observed regulation. Likely operon
organization, DNA sequences,
and current functional assignments
were all obtained from the SubtiList
database (
37).
Quantitative RT-PCR.
Taqman quantitative reverse
transcription (RT)-PCR primers and probes were designed using Primer
Express software (Applied Biosystems, Foster City, Calif.) and were
synthesized by Applied Biosystems. 6FAM reporter dye and TAMRA quencher
were affixed on the 5' and 3' ends of the probe, respectively. Primer
and probe sequences were as follows: sigB sense primer,
GATGAAGTCGATCGGCTCATAAG, antisense primer,
CCCGCACAAGCGTTTCC, and probe,
TTACCAAACAAAGCAAGATGAACAAGCGC; argB sense primer,
TTGCTGAGCTTGCCAAACAC, antisense primer,
CAAAAGACCGCCATCCTTACC, and probe,
AATGCCCGCGGCTCGCAGT; dnaK sense primer,
TGAGCTTGGCGACGGTGTA, antisense primer,
GATGATCGATGATAACTTGGTCAAA, and probe,
TTCGTTCAACTGCCGGCGACAA; ctsR sense primer,
CAAGGTAATTTCAGAAAGAGAAGCAA, antisense primer, TTCTCGCTCTTAATTCATCACGTT, and probe,
TAATGGACCGCTCAGTTTTACACATTGACTTACC. Reactions were performed
using 50 ng of the DNase-treated total RNA, a 300 nM concentration of
each Taqman primer, and 150 nM Taqman probe in a 50-µl volume.
Controls lacking reverse transcriptase or template were used. Reactions
were run on an ABI 7700 instrument (Applied Biosystems) using the
following cycling parameters: reverse transcription at 48°C for 30 min, reverse transcriptase inactivation at 95°C for 10 min, 40 cycles
of denaturation at 94°C for 15 s, and extension at 60°C for 1 min. Changes in expression were calculated from the displacement of the
amplification curve of the heat-shocked sample from the time zero sample.
Determination of transcriptional orientation.
Transcriptional orientation for the elucidation of proximity effects in
the transcription of yfkT was determined by Taqman RT-PCR
using oppositely oriented primers. RT was carried out for 30 min at
48°C from 50 ng of DNase-treated total RNA with either 300 nM
yfkT sense primer (TGACCAGAATGGCGCAGAT) or 300 nM
antisense primer (CCAGCGTAAATGGAAGGAACA). The Taqman probe
(6FAM-TTCCTATTTCCATTCGGCATCCTGGTC-TAMRA; 150 nM) and
AmpliTaq Gold DNA polymerase (Applied Biosystems) were included in the
reaction mixture. RNA was digested by the addition of an RNase A (5 µg; Roche)/RNase T1 (10 U; Ambion) mixture and incubated at 37°C
for 1 h. Reverse transcriptase was inactivated, and Taq
was activated at 95°C for 10 min. A 300 nM concentration of the
opposing primer was then added, and the reaction was run on an ABI 7700 instrument with 40 cycles of denaturation at 94°C for 15 s and
extension at 60°C for 1 min. Changes of expression in either
orientation were calculated as described above.
 |
RESULTS AND DISCUSSION |
To develop a platform for monitoring global transcriptional
responses in B. subtilis, we have amplified, using PCR,
~90% of the ~4,100 annotated ORFs and arrayed the resulting
products on glass slides. In this report, we characterize the
transcriptional response elicited by shifting a growing culture from 37 to 48°C, and we compare the resulting data with those obtained in the
numerous previous studies of the heat shock stimulon in this organism
(reviewed in references 19, 21, and 44).
Experimental design and array validation.
To measure gene
expression under different conditions, total RNA was isolated and
labeled by RT in the presence of either Cy3-dCTP or Cy5-dCTP in
reactions primed with random hexamers. The resulting cDNAs were
hybridized to glass slide microarrays as described in Materials and
Methods. The relative hybridization of the two cDNA populations was
ascertained by the relative fluorescence of the two fluorophores. The
resulting data are expressed as the fold induction in the accompanying
tables. While it is possible, by using appropriate normalizations, to
convert fluorescence intensities to absolute transcript levels
(63), we have not attempted such an analysis with these data.
Altogether, three sets of hybridization experiments were performed to
measure heat shock-induced changes at 3, 10, and 20
min after shifting
to 48°C (nine data sets). To control for possible
variability in
nucleoside incorporation, each experiment was performed
at least once
with the Cy3- and Cy5-labeled nucleosides reversed.
As a practical
matter, fold induction or repression could be confidently
measured over
a nearly 10,000-fold range (100-fold induction to
100-fold repression).
However, for some genes, the fluorescence
signal in one channel was
near background and the fold induction
or repression could not be
confidently
estimated.
In a typical experiment, hybridization signals were obtained, at levels
significantly above background, for ~70% of all genes
under these
growth conditions. This is comparable to results reported
previously
for
Escherichia coli (
4,
54,
63). When these
signals are mapped onto the chromosome, several large clusters
of
apparently silent genes map to the integrated SP

prophage,
the
skin element, and several other proposed prophages (data not
shown). In a control experiment involving competitive hybridization
of
two cDNA samples both prepared from a culture grown at 37°C,
no
signal (of >2,000) varied by more than twofold (range, 1.47-
to
0.62-fold). Thus, changes in cDNA populations well beyond this
range
are likely to reflect real differences in the corresponding
RNA
populations. The analysis described used data from one set
of
hybridizations (experiment 3), but similar results were obtained
from
the other two experiments (see Materials and Methods and
supplemental material
[
http://www.micro.cornell.edu/faculty.JHelmann.html]),
and
reference is made to these results where needed. In order
to
independently confirm the veracity of the microarray results,
the
expression of four genes was also quantitated by real-time
RT-PCR
(
22).
Overview of the heat shock stimulon.
To obtain an overview of
the heat shock stimulon, we focused our analysis on three overlapping
sets of genes. Set 1 included all previously described heat-inducible
genes, set 2 included the 50 most strongly induced genes in all nine
data sets (three replicate hybridization experiments with three time
points each: 450 gene signals), and set 3 included all those genes
induced at least twofold at the 3-min time point in experiment 3 (which yielded the most complete data set). Since the
B regulon is very large and is induced
transiently, many new candidate members of the
B regulon appeared in set 3 but not in set 2. Our analysis identified many known members of the
B and other heat shock regulons. However, we
have also identified new heat shock genes, including many with
candidate
B-dependent promoters.
Consistent with existing nomenclature in
B. subtilis
(
20,
21,
44), heat shock genes are assigned to several
discrete
classes: class I is the HrcA regulon, class II genes are
B dependent, and class III genes are regulated
by CtsR (and may
also be regulated by
B). We
suggest that those genes for which the regulatory pathway
is not yet
characterized be designated class U heat shock genes
(unknown
regulation) rather than class IV, since the latter nomenclature
will
likely lead to confusion as additional regulons are
defined.
The HrcA regulon (class I).
The HrcA protein is a
transcriptional repressor of class I heat shock genes
(50). This repressor binds to conserved
cis-acting regulatory sequences known as CIRCE elements
(67) and responds specifically to heat induction. In
B. subtilis, HrcA is known to regulate the expression of two
operons, the complex hrcA operon (24, 50) and
the groEL-groES operon (34, 49). Strong and reproducible signals were not obtained for the groEL-groES
operon in this study, so we focus our analysis on the hrcA operon.
Transcription initiating in the
hrcA promoter region leads
to the synthesis of an 8-kb primary transcript spanning seven genes
that is rapidly processed into a complex family of smaller transcripts
(
24,
25). Previously, mRNA levels for all seven genes were
measured at 5, 10, 15, and 30 min after the shift from 37 to 48°C
(
25). Our data are in reasonable agreement with those
obtained
previously (Table
1). We find
the strongest induction for the
first three genes in the operon,
hrcA,
grpE, and
dnaK, with weaker
effects on the downstream genes. In fact, in our studies, the
three
promoter distal genes were induced little if at all, with
a maximal
fold induction of ~2-fold. This is consistent with the
slot blot
analysis, which demonstrated at most two- to fourfold
induction for
these genes (Table
1).
The sigB regulon (class II heat shock genes).
Activation of
B in response to heat stress is
well documented, and it is estimated that the
B regulon includes over 200 genes (19,
44, 45). Genes belonging to the
B
regulon are prominently represented among the genes of the heat shock
stimulon, particularly at the 3-min time point. Because the mRNA levels
for many
B regulon genes return rapidly to
pre-stimulus levels (see below), members of the
B regulon were not well represented among the
most strongly induced genes at later time points.
For purposes of discussion, we can divide known and putative members of
the
B regulon (class II heat shock genes) into
three subcategories.
Class IIA includes those genes for which a
dependence on
B has been documented by direct
start site mapping (e.g., by primer
extension), genetic experiments, or
both (see reference
44).
Class IIB includes genes
previously postulated to be members of
the
B
regulon, based on a promoter consensus search procedure
(
43).
Class IIC includes additional heat shock genes
identified in this
study that are preceded by candidate
B promoters. Many of these same genes were
independently assigned
to the
B regulon based
on transcriptional profiling experiments monitoring
gene expression in
response to ethanol stress and induction of
sigB expression
(
45).
Class IIA.
Many of the well characterized genes belonging to
the
B regulon (44) are induced
following heat shock (Table 2; Fig.
1 and
2). Comparison of their expression
kinetics reveals a consistent pattern: in general, the
B regulon is very rapidly activated in
response to temperature shift with relative RNA levels (fold induction)
rapidly increasing by the 3-min time point and often, though not
always, declining by the 10-min time point. The transient nature of
induction in response to heat stress is consistent with previous
analyses of
B-dependent transcripts, including
sigB itself (6, 59), ctc (6), gspA (1), katB
(13) and trxA (48).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 1.
Heat induction of sigB operon genes
(rsbR-S-T-U-V-W-sigB-rsbX). The sigB
operon is illustrated schematically (genes are not to scale), and the
fold induction by heat shock at 3 min (black), 10 min (grey), and 20 min (white) is superimposed on the operon structure. The operon is
transcribed from an upstream A-dependent promoter
(65) and from an internal, heat-inducible
B-dependent promoter (6, 27). Measurements
of sigB induction by RT-PCR yielded values of 11.8-fold
(3 min), 3.0-fold (10 min), and 3.3-fold (20 min).
|
|

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 2.
Heat induction of the ydaDEFG gene
cluster. The ydaDEFG cluster of genes has been
previously shown to be expressed from two B-dependent
promoter elements as shown (42). Induction at 3, 10, and
20 min is shown as in Fig. 1.
|
|
The
B regulon includes
sigB itself,
which is transcribed as part of a complex operon containing eight genes
(Fig.
1). As expected,
RNA levels corresponding to all four genes
downstream of the internal
B-dependent
promoter are rapidly elevated after heat shock (~5-
to 9-fold), while
RNA corresponding to the upstream genes is only
slightly induced. Note
that none of these genes are strongly induced,
and none of them are
represented among the top 50 induced genes,
even at the 3-min time
point. Like other members of the
B regulon,
mRNA levels return to near the pre-stress level by 10
and 20 min
following heat shock. Previous measurements of
sigB mRNA
levels following heat shock revealed a maximal induction
of >20-fold
at 5 min, followed by reduced levels at 10, 15, and
20 min following
temperature stress (
59).
For comparison with the array data, we independently determined the
degree of induction for the
sigB mRNA using a quantitative
RT-PCR approach (
22). These experiments revealed
consistent
kinetics of induction with a maximal induction (at 3 min) of
12-fold.
Note that this is somewhat higher than the induction measured
using the arrays (ninefold). In a control experiment, using cells
shifted from 37°C to another flask at 37°C, we also see a much
weaker (~2-fold) but still significant induction of
sigB
(data
not shown). This may be a response to stresses associated with
transfer of the cells. For example, removal from a well aerated
flask
using a glass pipette could allow a transient depletion
of oxygen in
the rapidly growing
culture.
The
ydaDEFG region of the chromosome has been previously
analyzed (
42) and found to have two
B-dependent promoters giving rise to a complex
family of transcripts
as determined by Northern blot analysis. Our data
support the
suggestion, from Northern analysis, that
ydaD
and
ydaE are cotranscribed
as both are strongly and
coordinately induced (Fig.
2). In addition,
we find very strong
induction of
ydaG, but
ydaF is induced much
more
modestly, and with slower kinetics. This is consistent with
the
presence of a prominent heat-induced transcript corresponding
to the
ydaG gene, and argues that there may be limited
transcriptional
readthrough from
ydaDE into
ydaF.
Two genes considered to be members of the
B
regulon that are not strongly induced by heat shock are
bmrR
and
bmr, the two
promoter distal genes in the
bmrU operon (Table
2). However,
bmrU is strongly
and reproducibly induced. It had previously been
suggested that
bmrR and
bmr may be cotranscribed with
bmrU, but
the published Northern blot analysis suggests that
most transcription
terminates after the
bmrU gene
(
42). The lack of strong heat
induction of the promoter
distal genes,
bmrR and
bmr, is consistent
with
the idea that readthrough into these downstream genes does
not greatly
affect their
expression.
Class IIB.
Using a consensus search approach, Petersohn et al.
(43) identified 31 additional
B-type promoters. In three cases
(yhdF, yacL, ysdB), these promoters were confirmed by primer extension mapping, and these genes have therefore been added to class IIA (Table 2). An additional 25 sites
were shown, using slot blot analysis, to be induced by ethanol. In all
but four cases, this induction was apparent in the wild type but not in
a sigB mutant strain (43). Three genes
(yabJ, yhaR, and yqhZ) are not induced
by ethanol (43), and we found that these genes did not
respond to heat shock. Thus, these putative
B
promoters may represent false positives generated by an imperfect search algorithm.
We found strong heat shock induction for genes proximal to 16 of the
proposed promoters (
43), and the kinetics of induction
are
comparable to those of known members (class IIA) of the
B regulon (Table
3). These results support the previous
suggestion
that these genes are part of the
B regulon
(
43). Note that the
yfhK gene is upstream of
the
W-dependent operon
yfhLM, and
this promoter may be responsible
for the heat induction of those genes
as well (
26).
Five genes (
ydbP,
yoxA,
ypuB,
yqhQ, and
yrvD) shown to be inducible by ethanol
in a
B-dependent manner (
43) were
not strongly induced by heat shock
in our study. Nor was heat shock
induction detected for
yqiS,
a gene induced by ethanol in
both the wild-type and
sigB mutant
strains (Table
3).
Finally, no data were obtained for
yotK and
yycD,
as these genes were absent from the arrays used in these
experiments.
Additional experiments will be required to establish
whether or not the
putative
B-dependent promoters associated with
these eight genes are in
fact
functional.
Class IIC.
By sequence inspection, we propose 44 additional
candidate
B-dependent promoters (likely
controlling ~70 genes) proximal to newly identified heat shock genes
(Table 4). In many cases, these candidate
promoters are a good match to the
B consensus
(43, 44) in both the
35 and
10 recognition elements. Indeed, 19 of these operons were independently proposed to be candidate
members of the
B regulon, based on an analysis
of genes induced by ethanol or by induction of
B expression, and 11 of these same promoters
were identified using a hidden Markov model (45). Thus, it
is likely that many, although probably not all, of the genes we have
identified represent new members of the
B
regulon. In some cases, for example, the candidate promoters we propose
differ in potentially significant ways from the
B consensus, and these may be nonfunctional,
chance occurrences. Interestingly, several of these genes encode
paralogs of known members of the
B regulon
(YwtG is 49% identical to CsbC; YxbG is 34% identical to YcdF; YdaB
is 33% identical to YfhL; YxhD is 41% identical to YhdF). As a class,
these candidate
B regulon members include many
predicted membrane proteins and transporters, functions consistent with
the composition of the
B regulon as a whole.
Mapping all the known
B regulon members,
together with additional likely members emerging from this study, onto
the
B. subtilis genome revealed three instances of clusters
of transcriptional
units. As many as nine
B
consensus elements are clustered around the
ydaDEFG operon
(Fig.
2). This cluster includes the
B-dependent
gsiB and
ydaP genes (Table
2), the
ydaTS and
ydbD operons (Table
3), and the heat-induced
ydaB,
ydaC, and
ydaJKLMN genes (Table
4). A second cluster occurs upstream of the
comG operon
(four promoters:
yqxL,
yqhB,
yqhA, and
yqgZ). The third
cluster includes the
yfkM,
yfkJIH,
yfkF, and
yfkED operons. The
vast majority of the remaining
B-dependent
operons are apparently isolated or are occasionally
found in small
clusters of two or three
operons.
Finally, analysis of the
yheK gene leads us to propose a
revision to the existing genome annotation (
37). This gene
displays
the characteristic
B induction
pattern, yet the best candidate
B promoter is
situated with the

35 region overlapping the assigned
start codon
(TTG). Sequence inspection identifies an alternative
start site (ATG)
at codon 19 of the
yheK ORF. Furthermore, most
YheK homologs
lack the 18 additional amino acids that would result
from initiation at
the assigned TTG start codon. We therefore
suggest that translation of
YheK begins with the ATG codon at
position 19 and that the indicated
promoter element may therefore
be physiologically relevant (this new
translation start site was
also chosen in the latest annotation of the
SubtiList database;
release R16.1). Note that this gene has been
redesignated
nhaX and is proposed to form an operon with the
downstream gene
nhaC (formerly
yheL)
(
62). However, there are no published data to
support the
suggestion of an operon structure, and 130 bp separate
the
yheK (
nhaX) and
nhaC genes. Moreover,
we did not observe heat
induction for
yheL.
The CtsR regulon (class III).
A subset of genes regulated by
B is also controlled by another heat shock
pathway under control of CtsR (10, 32). CtsR is encoded by
the first gene in the ctsR operon, which is transcribed from
both
B- and
A-dependent promoters. We noted strong
induction of the ctsR operon in this study (Table
5), but unlike that of
B-dependent heat shock genes, transcription of
the ctsR operon peaked at the 10-min time point. The lower
level of induction of the two promoter distal genes (sms and
yacK) is consistent with recent data indicating that these
genes are part of a separate,
M-dependent
operon (A. Moir, personal communication). CtsR also regulates
clpP, clpE, and clpC
(10), which are strongly induced at the 10-min time point.
This is in agreement with previous mRNA measurements that document a
peak induction of clpP of ~28-fold between 6 and 9 min
after a shift to 48°C (15). A similar pattern of
induction was observed for clpE (9).
The AhrC regulon.
One of the most unexpected findings in this
study was the exceptionally strong transcriptional induction of three
operons involved in arginine biosynthesis
and transport (Fig. 3). There was no induction at the 3-min time
point, but by 10 min after heat shock, all three operons were induced
at least 50-fold. Independent confirmation of argB induction
by quantitative RT-PCR showed over 900-fold induction, suggesting that
the microarray experiment may underestimate the change in expression.
Since both the arginine biosynthesis operons are repressed by the AhrC
arginine-sensing transcription factor (8, 53), it is
possible that heat shock induced a transient arginine deprivation.
Alternatively, the AhrC protein itself may be temperature labile
(12). The yqiXYZ operon was recently shown to
encode an arginine transport system (52), and it also
displays the same magnitude and kinetics of induction as noted for the
two biosynthetic operons (Fig. 3C).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 3.
Heat induction of arginine biosynthesis and uptake
genes. Transcription of the argC biosynthetic operon
(A), argG biosynthetic operons (B), and the
yqiX arginine transport system (C) (52) is
illustrated. The biosynthetic operons are repressed in response to
arginine by the AhrC regulatory protein (8, 53). The
yqiXYZ operon has been renamed artPQM to
be consistent with E. coli nomenclature
(52). Values for argB obtained by RT-PCR
were 0.9-fold (3 min), 920-fold (10 min), and 328-fold (20 min). In the
microarray studies, signals were not detected reproducibly for the
3-min points, presumably due to low message levels. However, those
signals that were detected (four signals) were near 1, so these values
have been shown as 1.0 for illustration purposes.
|
|
Since AhrC is also required as a positive activator of arginine
catabolic genes (
14,
29,
35), we also looked at the
effects of heat shock on transcription of the
rocA,
rocG, and
rocD operons. These operons are rapidly
repressed following temperature
shift and are among the most
dramatically repressed genes in our
analysis (mRNA levels declined by
3- to 20-fold after 10 min).
This is consistent with a rapid (within 10 min) functional inactivation
of the AhrC transcriptional activator
combined with a short mRNA
half-life for these
transcripts.
Other identified stress response genes (class U).
Many other
genes have been identified as heat inducible in previous studies but
are regulated by as-yet-unknown mechanisms. Several of these genes were
also found to be heat induced in our study, as shown in Table
6. For example, we detect an ~5-fold induction of both ykdA(htrA) and yvtA,
two heat-inducible HtrA paralogs regulated by unknown mechanisms from
similar promoter elements (38).
An additional 66 members of the heat shock stimulon are not associated
with obvious candidate promoter elements for
B
or obvious recognition sites for known heat shock regulators
(see
supplementary material; Table S3 at
http://www.micro.cornell.edu/faculty.JHelmann.html).
All of these
genes showed reproducible heat induction of at least
3.5-fold (or are
cotranscribed with induced genes). Since regulatory
pathways for these
genes are not known, we assigned them to class
U. Interestingly,
several of these genes encode transport functions,
including the
appDFABC operon, one of two oligopeptide uptake
systems in
B. subtilis (
30,
31). Other transporters
induced
by heat shock include a choline ABC transporter
(
opuB operon),
a putative
Na
+/nucleoside cotransporter (
yutK)
and a multidrug efflux homolog
(
yuxJ). We also note heat
induction of a subset of the S-box regulon
(
18) including
specifically those genes implicated in methionine
biosynthesis.
Additional work will be required to determine the
mechanism and
relevance of this heat
induction.
Gene signals arising from proximity effects.
In addition to
increased transcription due to heat shock, some of the signals detected
in these experiments may arise from what we generically call proximity
effects. For example, transcription termination at the end of operons
is often less than 100% efficient, and these read-through transcripts
may lead to signals corresponding to genes downstream of strongly
induced heat shock genes. If the downstream gene is codirectional with
the heat shock gene, these signals could be physiologically relevant.
However, in some cases, the downstream gene is convergent with the heat
shock gene and the transcript through this region is anti-sense. These
are nevertheless detected using random hexamer priming and could give
rise to spurious signals. Two likely examples that emerged in this
study are the yfkQ operon and the yknA gene
(Table 7). All four genes of the yfkQ operon showed some heat induction, but there was a
clear gradient, with the largest apparent induction near the end of the
operon. Since this operon is convergent with the strongly induced,
B-dependent yflA gene (Table 3),
this pattern is consistent with read-through transcription from
yflA giving rise to (gradually diminishing) antisense RNA
through this region.
To test this model, readthrough transcription from
yflA into
yfkT was measured by a modification of the standard Taqman
quantitative
RT-PCR protocol. RT was conducted with either a sense or
an antisense
primer, after which time the RNA was digested and reverse
transcriptase
was inactivated. The opposing primer was then added and
quantitative
PCR was carried out. RT with the sense primer (i.e.,
priming off
the antisense strand) showed a 29-fold induction at the
3-min
time point, whereas the antisense primer showed only a threefold
induction (data not shown). This result is consistent with a proximity
effect whereby the apparent induction of
yfkT by heat shock
is
primarily due to read-through from
yflA with the
antisense strand
of
yfkT being transcribed. Similarly, the
apparent induction of
yknA may result from the fact that
this gene is convergent with
the strongly induced
ykzA gene
(Table
2). Although both the
yknA gene and the
yfkQ operon were considered good candidates for the
B regulon on the basis of transcriptional
profiling studies (
45),
our findings suggest that a
reinterpretation of these data is
in order. Similar proximity effects
have been noted in microarray
studies of
E. coli (
28,
66). It is possible to avoid this
complication by using 3'-end,
gene-specific primers for RT. However,
as discussed in detail elsewhere
(
4), this approach does not
uniformly label all mRNAs and
therefore provides a more limited
picture of the
transcriptome.
Summary.
The transfer of B. subtilis from 37 to
48°C elicits a very large transcriptional response coordinated by
several distinct transcription factors (19-21, 44). In
the studies described here, we document the heat induction of hundreds
of genes and independently confirm the microarray data for four genes
by quantitative RT-PCR. Over 5% of the transcriptionally active genes
are induced at least threefold, and well over 10% of the genome
displays a measurable induction in response to heat shock (Fig.
4).

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 4.
Overview of heat shock stimulon. The percentage of genes
induced after heat shock was calculated for all three experiments for
cells sampled at 3, 10, and 20 min after the shift from 37 to 48°C.
The percentage of genes (±1 standard deviation) that are induced by at
least 2-fold (closed circles), 3-fold (squares), 5-fold (triangles), or
10-fold (open circles) is shown. Percentages were determined by
dividing the number of induced genes by the total number for which mRNA
was detected at a level significantly above background (the average
numbers of total genes [over all three time points] for which a
signal was detected were 2,528 [experiment 1], 2,489 [experiment
2], and 3,204 [experiment 3]).
|
|
Activation of the
B regulon is the single
largest component of the heat shock response in
B. subtilis
(
19,
44). We have
measured the induction of 70 known or
previously proposed members
of the
B regulon
(Tables
2 and
3; Fig.
1 and
2) and identified another
72 candidate
B regulon members (Table
4). Our heat shock
data provides additional
support for many, albeit not all, members of
the
B regulon proposed previously on the basis
of consensus search
procedures (
43) and transcriptional
profiling studies (
45).
As expected, heat induction of the CtsR (Table
5) and HrcA (Table
1)
regulons is apparent, and other known heat shock proteins
(Table
6) are
also induced. Finally, we can assign many new genes
to the heat shock
stimulon (Table S3
[
http://www.micro.cornell.edu/faculty.JHeilmann.html]),
though
the factor(s) mediating their heat induction are not clear
at
present. Prominent among these genes are three operons involved
in
arginine biosynthesis and transport (Fig.
3). Induction of
these genes
may reflect an in vivo temperature lability of the
AhrC regulatory
protein, an idea supported by the decrease in
expression of the
AhrC-dependent arginine catabolic
genes.
Our analysis provides further evidence of the power and utility of
microarray approaches to defining bacterial stimulons and
regulons. As
we extend this work to include other stimulons, a
thorough knowledge of
the heat shock activated general stress
response will be very useful in
distinguishing specific from more
general transcriptional
responses.
 |
ACKNOWLEDGMENTS |
We thank Dave Huber for mathematical and software assistance,
Young Kim for technical help, and Tarek Msadek for helpful comments on
the manuscript.
This work was partially supported by grant MCB 9983656 from the
National Science Foundation to J.D.H.
 |
FOOTNOTES |
*
Department of Microbiology, Cornell University, Ithaca,
NY 14853-8101. Phone: (607) 255-6570. Fax: (607) 255-3904. E-mail: jdh9{at}cornell.edu.
Present address: Microarray Research Facility, NIAID/NIH,
Rockville, MD 20852.
 |
REFERENCES |
| 1.
|
Antelmann, H.,
J. Bernhardt,
R. Schmid, and M. Hecker.
1995.
A gene at 333 degrees on the Bacillus subtilis chromosome encodes the newly identified sigma B-dependent general stress protein GspA.
J. Bacteriol.
177:3540-3545[Abstract/Free Full Text].
|
| 2.
|
Antelmann, H.,
J. Bernhardt,
R. Schmid,
H. Mach,
U. Volker, and M. Hecker.
1997.
First steps from a two-dimensional protein index towards a response-regulation map for Bacillus subtilis.
Electrophoresis
18:1451-1463[CrossRef][Medline].
|
| 3.
|
Antelmann, H.,
S. Engelmann,
R. Schmid, and M. Hecker.
1996.
General and oxidative stress responses in Bacillus subtilis: cloning, expression, and mutation of the alkyl hydroperoxide reductase operon.
J. Bacteriol.
178:6571-6578[Abstract/Free Full Text].
|
| 4.
|
Arfin, S. M.,
A. D. Long,
E. T. Ito,
L. Tolleri,
M. M. Riehle,
E. S. Paegle, and G. W. Hatfield.
2000.
Global gene expression profiling in Escherichia coli K12. The effects of integration host factor.
J. Biol. Chem.
275:29672-29684[Abstract/Free Full Text].
|
| 5.
|
Ashiuchi, M.,
K. Soda, and H. Misono.
1999.
A poly-gamma-glutamate synthetic system of Bacillus subtilis IFO 3336: gene cloning and biochemical analysis of poly-gamma-glutamate produced by Escherichia coli clone cells.
Biochem. Biophys. Res. Commun.
263:6-12[CrossRef][Medline].
|
| 6.
|
Benson, A. K., and W. G. Haldenwang.
1993.
The sigma B-dependent promoter of the Bacillus subtilis sigB operon is induced by heat shock.
J. Bacteriol.
175:1929-1935[Abstract/Free Full Text].
|
| 7.
|
Chen, Y.,
S. Fukuoka, and S. Makino.
2000.
A novel spore peptidoglycan hydrolase of Bacillus cereus: biochemical characterization and nucleotide sequence of the corresponding gene sleL.
J. Bacteriol.
182:1499-1506[Abstract/Free Full Text].
|
| 8.
|
Czaplewski, L. G.,
A. K. North,
M. C. Smith,
S. Baumberg, and P. G. Stockley.
1992.
Purification and initial characterization of AhrC: the regulator of arginine metabolism genes in Bacillus subtilis.
Mol. Microbiol.
6:267-275[CrossRef][Medline].
|
| 9.
|
Derre, I.,
G. Rapoport,
K. Devine,
M. Rose, and T. Msadek.
1999.
ClpE, a novel type of HSP100 ATPase, is part of the CtsR heat shock regulon of Bacillus subtilis.
Mol. Microbiol.
32:581-593[CrossRef][Medline].
|
| 10.
|
Derre, I.,
G. Rapoport, and T. Msadek.
1999.
CtsR, a novel regulator of stress and heat shock response, controls clp and molecular chaperone gene expression in gram-positive bacteria.
Mol. Microbiol.
31:117-131[CrossRef][Medline].
|
| 11.
|
Deuerling, E.,
A. Mogk,
C. Richter,
M. Purucker, and W. Schumann.
1997.
The ftsH gene of Bacillus subtilis is involved in major cellular processes such as sporulation, stress adaptation and secretion.
Mol. Microbiol.
23:921-933[CrossRef][Medline].
|
| 12.
|
Dion, M.,
D. Charlier,
H. Wang,
D. Gigot,
A. Savchenko,
J. N. Hallet,
N. Glansdorff, and V. Sakanyan.
1997.
The highly thermostable arginine repressor of Bacillus stearothermophilus: gene cloning and repressor-operator interactions.
Mol. Microbiol.
25:385-398[CrossRef][Medline].
|
| 13.
|
Engelmann, S.,
C. Lindner, and M. Hecker.
1995.
Cloning, nucleotide sequence, and regulation of katE encoding a sigma B-dependent catalase in Bacillus subtilis.
J. Bacteriol.
177:5598-5605[Abstract/Free Full Text].
|
| 14.
|
Gardan, R.,
G. Rapoport, and M. Debarbouille.
1997.
Role of the transcriptional activator RocR in the arginine-degradation pathway of Bacillus subtilis.
Mol. Microbiol.
24:825-837[CrossRef][Medline].
|
| 15.
|
Gerth, U.,
E. Kruger,
I. Derre,
T. Msadek, and M. Hecker.
1998.
Stress induction of the Bacillus subtilis clpP gene encoding a homologue of the proteolytic component of the Clp protease and the involvement of ClpP and ClpX in stress tolerance.
Mol. Microbiol.
28:787-802[CrossRef][Medline].
|
| 16.
|
Gerth, U.,
A. Wipat,
C. R. Harwood,
N. Carter,
P. T. Emmerson, and M. Hecker.
1996.
Sequence and transcriptional analysis of clpX, a class-III heat-shock gene of Bacillus subtilis.
Gene
181:77-83[CrossRef][Medline].
|
| 17.
|
Gronewold, T. M. A., and D. Kaiser.
2001.
The act operon controls the level and time of C-signal production for Myxococcus xanthus development.
Mol. Microbiol.
40:744-756[CrossRef][Medline].
|
| 18.
|
Grundy, F. J., and T. M. Henkin.
1998.
The S box regulon: a new global transcription termination control system for methionine and cysteine biosynthesis genes in gram-positive bacteria.
Mol. Microbiol.
30:737-749[CrossRef][Medline].
|
| 19.
|
Hecker, M., and S. Engelmann.
2000.
Proteomics, DNA arrays and the analysis of still unknown regulons and unknown proteins of Bacillus subtilis and pathogenic gram-positive bacteria.
Intl. J. Med. Microbiol.
290:123-134.
|
| 20.
|
Hecker, M.,
W. Schumann, and U. Volker.
1996.
Heat-shock and general stress response in Bacillus subtilis.
Mol. Microbiol.
19:417-428[CrossRef][Medline].
|
| 21.
|
Hecker, M., and U. Volker.
1998.
Non-specific, general and multiple stress resistance of growth-restricted Bacillus subtilis cells by the expression of the sigmaB regulon.
Mol. Microbiol.
29:1129-1136[CrossRef][Medline].
|
| 22.
|
Heid, C. A.,
J. Stevens,
K. J. Livak, and P. M. Williams.
1996.
Real time quantitative PCR.
Genome Res.
6:986-994[Abstract/Free Full Text].
|
| 23.
|
Heilmann, C.,
O. Schweitzer,
C. Gerke,
N. Vanittanakom,
D. Mack, and F. Goetz.
1996.
Molecular basis of intercellular adhesion in the biofilm-forming Staphylococcus epidermidis.
Mol. Microbiol.
20:1083-1091[Medline].
|
| 24.
|
Homuth, G.,
S. Masuda,
A. Mogk,
Y. Kobayashi, and W. Schumann.
1997.
The dnaK operon of Bacillus subtilis is heptacistronic.
J. Bacteriol.
179:1153-1164[Abstract/Free Full Text].
|
| 25.
|
Homuth, G.,
A. Mogk, and W. Schumann.
1999.
Post-transcriptional regulation of the Bacillus subtilis dnaK operon.
Mol. Microbiol.
32:1183-1197[CrossRef][Medline].
|
| 26.
|
Huang, X.,
A. Gaballa,
M. Cao, and J. D. Helmann.
1999.
Identification of target promoters for the Bacillus subtilis extracytoplasmic function sigma factor, sigma W.
Mol. Microbiol.
31:361-371[CrossRef][Medline].
|
| 27.
|
Kalman, S.,
M. L. Duncan,
S. M. Thomas, and C. W. Price.
1990.
Similar organization of the sigB and spoIIA operons encoding alternate sigma factors of Bacillus subtilis RNA polymerase.
J. Bacteriol.
172:5575-5585[Abstract/Free Full Text].
|
| 28.
|
Khodursky, A. B.,
B. J. Peter,
N. R. Cozzarelli,
D. Botstein,
P. O. Brown, and C. Yanofsky.
2000.
DNA microarray analysis of gene expression in response to physiological and genetic changes that affect tryptophan metabolism in Escherichia coli.
Proc. Natl. Acad. Sci. USA
97:12170-12175[Abstract/Free Full Text].
|
| 29.
|
Klingel, U.,
C. M. Miller,
A. K. North,
P. G. Stockley, and S. Baumberg.
1995.
A binding site for activation by the Bacillus subtilis AhrC protein, a repressor/activator of arginine metabolism.
Mol. Gen. Genet.
248:329-340[CrossRef][Medline].
|
| 30.
|
Koide, A., and J. A. Hoch.
1994.
Identification of a second oligopeptide transport system in Bacillus subtilis and determination of its role in sporulation.
Mol. Microbiol.
13:417-426[CrossRef][Medline].
|
| 31.
|
Koide, A.,
M. Perego, and J. A. Hoch.
1999.
ScoC regulates peptide transport and sporulation initiation in Bacillus subtilis.
J. Bacteriol.
181:4114-4117[Abstract/Free Full Text].
|
| 32.
|
Kruger, E., and M. Hecker.
1998.
The first gene of the Bacillus subtilis clpC operon, ctsR, encodes a negative regulator of its own operon and other class III heat shock genes.
J. Bacteriol.
180:6681-6688[Abstract/Free Full Text].
|
| 33.
|
Kugimiya, W.,
Y. Otani, and Y. Hashimoto.
1992.
Molecular cloning and structure of the gene for esterase from a thermophilic bacterium, Bacillus stearothermophilus IFO 12550.
Biosci. Biotechnol. Biochem.
56:2074-2075[Medline].
|
| 34.
|
Li, M., and S. L. Wong.
1992.
Cloning and characterization of the groESL operon from Bacillus subtilis.
J. Bacteriol.
174:3981-3992[Abstract/Free Full Text].
|
| 35.
|
Miller, C. M.,
S. Baumberg, and P. G. Stockley.
1997.
Operator interactions by the Bacillus subtilis arginine repressor/activator, AhrC: novel positioning and DNA-mediated assembly of a transcriptional activator at catabolic sites.
Mol. Microbiol.
26:37-48[CrossRef][Medline].
|
| 36.
|
Moch, C.,
O. Schrogel, and R. Allmansberger.
2000.
Transcription of the nfrA-ywcH operon from Bacillus subtilis is specifically induced in response to heat.
J. Bacteriol.
182:4384-4393[Abstract/Free Full Text].
|
| 37.
|
Moszer, I.,
P. Glaser, and A. Danchin.
1995.
SubtiList: a relational database for the Bacillus subtilis genome.
Microbiology
141:261-268[Abstract/Free Full Text].
|
| 38.
|
Noone, D.,
A. Howell,
R. Collery, and K. M. Devine.
2001.
YkdA and YvtA, HtrA-like serine proteases in Bacillus subtilis, engage in negative autoregulation and reciprocal cross-regulation of ykdA and yvtA gene expression.
J. Bacteriol.
183:654-663[Abstract/Free Full Text].
|
| 39.
|
Noone, D.,
A. Howell, and K. M. Devine.
2000.
Expression of ykdA, encoding a Bacillus subtilis homologue of HtrA, is heat shock inducible and negatively autoregulated.
J. Bacteriol.
182:1592-1599[Abstract/Free Full Text].
|
| 40.
|
Oussenko, I. A., and D. H. Bechhofer.
2000.
The yvaJ gene of Bacillus subtilis encodes a 3'-to-5' exoribonuclease and is not essential in a strain lacking polynucleotide phosphorylase.
J. Bacteriol.
182:2639-2642[Abstract/Free Full Text].
|
| 41.
|
Page, M. J.,
B. Amess,
C. Rohlff,
C. Stubberfield, and R. Parekh.
1999.
Proteomics: a major new technology for the drug discovery process.
Drug Discov. Today
4:55-62[CrossRef][Medline].
|
| 42.
|
Petersohn, A.,
H. Antelmann,
U. Gerth, and M. Hecker.
1999.
Identification and transcriptional analysis of new members of the sigmaB regulon in Bacillus subtilis.
Microbiology
145:869-880[Abstract/Free Full Text].
|
| 43.
|
Petersohn, A.,
J. Bernhardt,
U. Gerth,
D. Hoper,
T. Koburger,
U. Volker, and M. Hecker.
1999.
Identification of sigma(B)-dependent genes in Bacillus subtilis using a promoter consensus-directed search and oligonucleotide hybridization.
J. Bacteriol.
181:5718-5724[Abstract/Free Full Text].
|
| 44.
|
Price, C. W.
2000.
Protective function and regulation of the general stress response in Bacillus subtilis and related gram-positive bacteria, p. 179-197.
In
G. Storz, and R. Hengge-Aronis (ed.), Bacterial stress responses. ASM Press, Washington, D.C.
|
| 45.
|
Price, C. W.,
P. Fawcett,
H. Ceremonine,
Y. Su,
C. K. Murphy, and P. Youngman.
2001.
Genome-wide analysis of the general stress response in Bacillus subtilis.
Mol. Microbiol.
41:757-774[CrossRef][Medline].
|
| 46.
|
Riethdorf, S.,
U. Volker,
U. Gerth,
A. Winkler,
S. Engelmann, and M. Hecker.
1994.
Cloning, nucleotide sequence, and expression of the Bacillus subtilis lon gene.
J. Bacteriol.
176:6518-6527[Abstract/Free Full Text].
|
| 47.
|
Rosamond, J., and A. Allsop.
2000.
Harnessing the power of the genome in the search for new antibiotics.
Science
287:1973-1976[Abstract/Free Full Text].
|
| 48.
|
Scharf, C.,
S. Riethdorf,
H. Ernst,
S. Engelmann,
U. Volker, and M. Hecker.
1998.
Thioredoxin is an essential protein induced by multiple stresses in Bacillus subtilis.
J. Bacteriol.
180:1869-1877[Abstract/Free Full Text].
|
| 49.
|
Schmidt, A.,
M. Schiesswohl,
U. Volker,
M. Hecker, and W. Schumann.
1992.
Cloning, sequencing, mapping, and transcriptional analysis of the groESL operon from Bacillus subtilis.
J. Bacteriol.
174:3993-3999[Abstract/Free Full Text].
|
| 50.
|
Schulz, A., and W. Schumann.
1996.
hrcA, the first gene of the Bacillus subtilis dnaK operon, encodes a negative regulator of class I heat shock genes.
J. Bacteriol.
178:1088-1093[Abstract/Free Full Text].
|
| 51.
|
Schulz, A.,
S. Schwab,
G. Homuth,
S. Versteeg, and W. Schumann.
1997.
The htpG gene of Bacillus subtilis belongs to class III heat shock genes and is under negative control.
J. Bacteriol.
179:3103-3109[Abstract/Free Full Text].
|
| 52.
|
Sekowska, A.,
S. Robin,
J. J. Daudin,
A. Henaut, and A. Danchin.
2001.
Extracting biological information from DNA arrays: an unexpected link between arginine and methionine metabolism in Bacillus subtilis.
Genome Biol.
2:0019.0011-0019.0012.
|
| 53.
|
Smith, M. C.,
L. Czaplewski,
A. K. North,
S. Baumberg, and P. G. Stockley.
1989.
Sequences required for regulation of arginine biosynthesis promoters are conserved between Bacillus subtilis and Escherichia coli.
Mol. Microbiol.
3:23-28[CrossRef][Medline].
|
| 54.
|
Tao, H.,
C. Bausch,
C. Richmond,
F. R. Blattner, and T. Conway.
1999.
Functional genomics: expression analysis of Escherichia coli growing on minimal and rich media.
J. Bacteriol.
181:6425-6440[Abstract/Free Full Text].
|
| 55.
|
VanBogelen, R. A.,
K. Z. Abshire,
B. Moldover,
E. R. Olson, and F. C. Neidhardt.
1997.
Escherichia coli proteome analysis using the gene-protein database.
Electrophoresis
18:1243-1251[CrossRef][Medline].
|
| 56.
|
VanBogelen, R. A.,
K. D. Greis,
R. M. Blumenthal,
T. H. Tani, and R. G. Matthews.
1999.
Mapping regulatory networks in microbial cells.
Trends Microbiol.
7:320-328[CrossRef][Medline].
|
| 57.
|
VanBogelen, R. A., and F. C. Neidhardt.
1990.
Ribosomes as sensors of heat and cold shock in Escherichia coli.
Proc. Natl. Acad. Sci. USA
87:5589-5593[Abstract/Free Full Text].
|
| 58.
|
VanBogelen, R. A.,
E. E. Schiller,
J. D. Thomas, and F. C. Neidhardt.
1999.
Diagnosis of cellular states of microbial organisms using proteomics.
Electrophoresis
20:2149-2159[CrossRef][Medline].
|
| 59.
|
Voelker, U.,
A. Voelker,
B. Maul,
M. Hecker,
A. Dufour, and W. G. Haldenwang.
1995.
Separate mechanisms activate sigma B of Bacillus subtilis in response to environmental and metabolic stresses.
J. Bacteriol.
177:3771-3780[Abstract/Free Full Text].
|
| 60.
|
Volker, U.,
S. Engelmann,
B. Maul,
S. Riethdorf,
A. Volker,
R. Schmid,
H. Mach, and M. Hecker.
1994.
Analysis of the induction of general stress proteins of Bacillus subtilis.
Microbiology
140:741-752[Abstract/Free Full Text].
|
| 61.
|
Weber, A.,
E. Menzlaff,
B. Arbinger,
M. Gutensohn,
C. Eckerskorn, and U.-I. Fluegge.
1995.
The 2-oxoglutarate/malate translocator of chloroplast envelope membranes: molecular cloning of a transporter containing a 12-helix motif and expression of the functional protein in yeast cells.
Biochemistry
34:2621-2627[CrossRef][Medline].
|
| 62.
|
Wei, Y.,
A. A. Guffanti,
M. Ito, and T. A. Krulwich.
2000.
Bacillus subtilis YqkI is a novel malic/Na+-lactate antiporter that enhances growth on malate at low protonmotive force.
J. Biol. Chem.
275:30287-30292[Abstract/Free Full Text].
|
| 63.
|
Wei, Y.,
J. M. Lee,
C. Richmond,
F. R. Blattner,
J. A. Rafalski, and R. A. LaRossa.
2001.
High-density microarray-mediated gene expression profiling of Escherichia coli.
J. Bacteriol.
183:545-556[Abstract/Free Full Text].
|
| 64.
|
Wilson, M.,
J. DeRisi,
H. H. Kristensen,
P. Imboden,
S. Rane,
P. O. Brown, and G. K. Schoolnik.
1999.
Exploring drug-induced alterations in gene expression in Mycobacterium tuberculosis by microarray hybridization.
Proc. Natl. Acad. Sci. USA
96:12833-12838[Abstract/Free Full Text].
|
| 65.
|
Wise, A. A., and C. W. Price.
1995.
Four additional genes in the sigB operon of Bacillus subtilis that control activity of the general stress factor sigma B in response to environmental signals.
J. Bacteriol.
177:123-133[Abstract/Free Full Text].
|
| 66.
|
Zimmer, D. P.,
E. Soupene,
H. L. Lee,
V. F. Wendisch,
A. B. Khodursky,
B. J. Peter,
R. A. Bender, and S. Kustu.
2000.
Nitrogen regulatory protein C-controlled genes of Escherichia coli: scavenging as a defense against nitrogen limitation.
Proc. Natl. Acad. Sci. USA
97:14674-14679[Abstract/Free Full Text].
|
| 67.
|
Zuber, U., and W. Schumann.
1994.
CIRCE, a novel heat shock element involved in regulation of heat shock operon dnaK of Bacillus subtilis.
J. Bacteriol.
176:1359-1363[Abstract/Free Full Text].
|
Journal of Bacteriology, December 2001, p. 7318-7328, Vol. 183, No. 24
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.24.7318-7328.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ehira, S., Teramoto, H., Inui, M., Yukawa, H.
(2009). Regulation of Corynebacterium glutamicum Heat Shock Response by the Extracytoplasmic-Function Sigma Factor SigH and Transcriptional Regulators HspR and HrcA. J. Bacteriol.
191: 2964-2972
[Abstract]
[Full Text]
-
Barreiro, C., Nakunst, D., Huser, A. T., de Paz, H. D., Kalinowski, J., Martin, J. F.
(2009). Microarray studies reveal a 'differential response' to moderate or severe heat shock of the HrcA- and HspR-dependent systems in Corynebacterium glutamicum. Microbiology
155: 359-372
[Abstract]
[Full Text]
-
Emerson, J. E., Stabler, R. A., Wren, B. W., Fairweather, N. F.
(2008). Microarray analysis of the transcriptional responses of Clostridium difficile to environmental and antibiotic stress. J Med Microbiol
57: 757-764
[Abstract]
[Full Text]
-
Raengpradub, S., Wiedmann, M., Boor, K. J.
(2008). Comparative Analysis of the {sigma}B-Dependent Stress Responses in Listeria monocytogenes and Listeria innocua Strains Exposed to Selected Stress Conditions. Appl. Environ. Microbiol.
74: 158-171
[Abstract]
[Full Text]
-
Chan, Y. C., Raengpradub, S., Boor, K. J., Wiedmann, M.
(2007). Microarray-Based Characterization of the Listeria monocytogenes Cold Regulon in Log- and Stationary-Phase Cells. Appl. Environ. Microbiol.
73: 6484-6498
[Abstract]
[Full Text]
-
van der Veen, S., Hain, T., Wouters, J. A., Hossain, H., de Vos, W. M., Abee, T., Chakraborty, T., Wells-Bennik, M. H. J.
(2007). The heat-shock response of Listeria monocytogenes comprises genes involved in heat shock, cell division, cell wall synthesis, and the SOS response. Microbiology
153: 3593-3607
[Abstract]
[Full Text]
-
Singh, V. K., Utaida, S., Jackson, L. S., Jayaswal, R. K., Wilkinson, B. J., Chamberlain, N. R.
(2007). Role for dnaK locus in tolerance of multiple stresses in Staphylococcus aureus. Microbiology
153: 3162-3173
[Abstract]
[Full Text]
-
van Schaik, W., van der Voort, M., Molenaar, D., Moezelaar, R., de Vos, W. M., Abee, T.
(2007). Identification of the {sigma}B Regulon of Bacillus cereus and Conservation of {sigma}B-Regulated Genes in Low-GC-Content Gram-Positive Bacteria. J. Bacteriol.
189: 4384-4390
[Abstract]
[Full Text]
-
Sato, M., Nimura-Matsune, K., Watanabe, S., Chibazakura, T., Yoshikawa, H.
(2007). Expression Analysis of Multiple dnaK Genes in the Cyanobacterium Synechococcus elongatus PCC 7942. J. Bacteriol.
189: 3751-3758
[Abstract]
[Full Text]
-
Shin, J.-H., Price, C. W.
(2007). The SsrA-SmpB Ribosome Rescue System Is Important for Growth of Bacillus subtilis at Low and High Temperatures. J. Bacteriol.
189: 3729-3737
[Abstract]
[Full Text]
-
Motegi, M., Takagi, Y., Yonezawa, H., Hanada, N., Terajima, J., Watanabe, H., Senpuku, H.
(2006). Assessment of Genes Associated with Streptococcus mutans Biofilm Morphology. Appl. Environ. Microbiol.
72: 6277-6287
[Abstract]
[Full Text]
-
Koide, T., Vencio, R. Z. N., Gomes, S. L.
(2006). Global Gene Expression Analysis of the Heat Shock Response in the Phytopathogen Xylella fastidiosa.. J. Bacteriol.
188: 5821-5830
[Abstract]
[Full Text]
-
Miethke, M., Hecker, M., Gerth, U.
(2006). Involvement of Bacillus subtilis ClpE in CtsR Degradation and Protein Quality Control. J. Bacteriol.
188: 4610-4619
[Abstract]
[Full Text]
-
Gunesekere, I. C., Kahler, C. M., Powell, D. R., Snyder, L. A. S., Saunders, N. J., Rood, J. I., Davies, J. K.
(2006). Comparison of the RpoH-Dependent Regulon and General Stress Response in Neisseria gonorrhoeae. J. Bacteriol.
188: 4769-4776
[Abstract]
[Full Text]
-
Wolff, S., Otto, A., Albrecht, D., Zeng, J. S., Buttner, K., Gluckmann, M., Hecker, M., Becher, D.
(2006). Gel-free and Gel-based Proteomics in Bacillus subtilis: A Comparative Study. Mol. Cell. Proteomics
5: 1183-1192
[Abstract]
[Full Text]
-
Charng, Y.-y., Liu, H.-c., Liu, N.-y., Hsu, F.-c., Ko, S.-s.
(2006). Arabidopsis Hsa32, a Novel Heat Shock Protein, Is Essential for Acquired Thermotolerance during Long Recovery after Acclimation. Plant Physiol.
140: 1297-1305
[Abstract]
[Full Text]
-
Chhabra, S. R., He, Q., Huang, K. H., Gaucher, S. P., Alm, E. J., He, Z., Hadi, M. Z., Hazen, T. C., Wall, J. D., Zhou, J., Arkin, A. P., Singh, A. K.
(2006). Global Analysis of Heat Shock Response in Desulfovibrio vulgaris Hildenborough.. J. Bacteriol.
188: 1817-1828
[Abstract]
[Full Text]
-
Budde, I., Steil, L., Scharf, C., Volker, U., Bremer, E.
(2006). Adaptation of Bacillus subtilis to growth at low temperature: a combined transcriptomic and proteomic appraisal.. Microbiology
152: 831-853
[Abstract]
[Full Text]
-
Madsen, M. L., Nettleton, D., Thacker, E. L., Edwards, R., Minion, F. C.
(2006). Transcriptional Profiling of Mycoplasma hyopneumoniae during Heat Shock Using Microarrays. Infect. Immun.
74: 160-166
[Abstract]
[Full Text]
-
Rohlin, L., Trent, J. D., Salmon, K., Kim, U., Gunsalus, R. P., Liao, J. C.
(2005). Heat Shock Response of Archaeoglobus fulgidus. J. Bacteriol.
187: 6046-6057
[Abstract]
[Full Text]
-
Ren, D., Zuo, R., Gonzalez Barrios, A. F., Bedzyk, L. A., Eldridge, G. R., Pasmore, M. E., Wood, T. K.
(2005). Differential Gene Expression for Investigation of Escherichia coli Biofilm Inhibition by Plant Extract Ursolic Acid. Appl. Environ. Microbiol.
71: 4022-4034
[Abstract]
[Full Text]
-
Zhao, K., Liu, M., Burgess, R. R.
(2005). The Global Transcriptional Response of Escherichia coli to Induced {sigma}32 Protein Involves {sigma}32 Regulon Activation Followed by Inactivation and Degradation of {sigma}32 in Vivo. J. Biol. Chem.
280: 17758-17768
[Abstract]
[Full Text]
-
Hoper, D., Volker, U., Hecker, M.
(2005). Comprehensive Characterization of the Contribution of Individual SigB-Dependent General Stress Genes to Stress Resistance of Bacillus subtilis. J. Bacteriol.
187: 2810-2826
[Abstract]
[Full Text]
-
Gao, H., Wang, Y., Liu, X., Yan, T., Wu, L., Alm, E., Arkin, A., Thompson, D. K., Zhou, J.
(2004). Global Transcriptome Analysis of the Heat Shock Response of Shewanella oneidensis. J. Bacteriol.
186: 7796-7803
[Abstract]
[Full Text]
-
Xie, Y., Chou, L.-s., Cutler, A., Weimer, B.
(2004). DNA Macroarray Profiling of Lactococcus lactis subsp. lactis IL1403 Gene Expression during Environmental Stresses. Appl. Environ. Microbiol.
70: 6738-6747
[Abstract]
[Full Text]
-
Sue, D., Fink, D., Wiedmann, M., Boor, K. J.
(2004). {sigma}B-dependent gene induction and expression in Listeria monocytogenes during osmotic and acid stress conditions simulating the intestinal environment. Microbiology
150: 3843-3855
[Abstract]
[Full Text]
-
Holtmann, G., Brigulla, M., Steil, L., Schutz, A., Barnekow, K., Volker, U., Bremer, E.
(2004). RsbV-Independent Induction of the SigB-Dependent General Stress Regulon of Bacillus subtilis during Growth at High Temperature. J. Bacteriol.
186: 6150-6158
[Abstract]
[Full Text]
-
Ren, D., Bedzyk, L. A., Setlow, P., England, D. F., Kjelleberg, S., Thomas, S. M., Ye, R. W., Wood, T. K.
(2004). Differential Gene Expression To Investigate the Effect of (5Z)-4-Bromo- 5-(Bromomethylene)-3-Butyl-2(5H)-Furanone on Bacillus subtilis. Appl. Environ. Microbiol.
70: 4941-4949
[Abstract]
[Full Text]
-
Knobloch, J. K.-M., Jager, S., Horstkotte, M. A., Rohde, H., Mack, D.
(2004). RsbU-Dependent Regulation of Staphylococcus epidermidis Biofilm Formation Is Mediated via the Alternative Sigma Factor {sigma}B by Repression of the Negative Regulator Gene icaR. Infect. Immun.
72: 3838-3848
[Abstract]
[Full Text]
-
Bischoff, M., Dunman, P., Kormanec, J., Macapagal, D., Murphy, E., Mounts, W., Berger-Bachi, B., Projan, S.
(2004). Microarray-Based Analysis of the Staphylococcus aureus {sigma}B Regulon. J. Bacteriol.
186: 4085-4099
[Abstract]
[Full Text]
-
van Schaik, W., Zwietering, M. H., de Vos, W. M., Abee, T.
(2004). Identification of {sigma}B-Dependent Genes in Bacillus cereus by Proteome and In Vitro Transcription Analysis. J. Bacteriol.
186: 4100-4109
[Abstract]
[Full Text]
-
Ren, D., Bedzyk, L. A., Ye, R. W., Thomas, S. M., Wood, T. K.
(2004). Stationary-Phase Quorum-Sensing Signals Affect Autoinducer-2 and Gene Expression in Escherichia coli. Appl. Environ. Microbiol.
70: 2038-2043
[Abstract]
[Full Text]
-
Anderton, J. M., Tokarz, R., Thill, C. D., Kuhlow, C. J., Brooks, C. S., Akins, D. R., Katona, L. I., Benach, J. L.
(2004). Whole-Genome DNA Array Analysis of the Response of Borrelia burgdorferi to a Bactericidal Monoclonal Antibody. Infect. Immun.
72: 2035-2044
[Abstract]
[Full Text]
-
Tomas, C. A., Beamish, J., Papoutsakis, E. T.
(2004). Transcriptional Analysis of Butanol Stress and Tolerance in Clostridium acetobutylicum. J. Bacteriol.
186: 2006-2018
[Abstract]
[Full Text]
-
Kawai, F., Shoda, M., Harashima, R., Sadaie, Y., Hara, H., Matsumoto, K.
(2004). Cardiolipin Domains in Bacillus subtilis Marburg Membranes. J. Bacteriol.
186: 1475-1483
[Abstract]
[Full Text]
-
Cetin, M. S., Zhang, C., Hutkins, R. W., Benson, A. K.
(2004). Regulation of Transcription of Compatible Solute Transporters by the General Stress Sigma Factor, {sigma}B, in Listeria monocytogenes. J. Bacteriol.
186: 794-802
[Abstract]
[Full Text]
-
van Schaik, W., Tempelaars, M. H., Wouters, J. A., de Vos, W. M., Abee, T.
(2004). The Alternative Sigma Factor {sigma}B of Bacillus cereus: Response to Stress and Role in Heat Adaptation. J. Bacteriol.
186: 316-325
[Abstract]
[Full Text]
-
Shen, L., Li, M., Zhang, Y.-x.
(2004). Chlamydia trachomatis {sigma}28 recognizes the fliC promoter of Escherichia coli and responds to heat shock in chlamydiae. Microbiology
150: 205-215
[Abstract]
[Full Text]
-
Fuangthong, M., Helmann, J. D.
(2003). Recognition of DNA by Three Ferric Uptake Regulator (Fur) Homologs in Bacillus subtilis. J. Bacteriol.
185: 6348-6357
[Abstract]
[Full Text]
-
Steil, L., Hoffmann, T., Budde, I., Volker, U., Bremer, E.
(2003). Genome-Wide Transcriptional Profiling Analysis of Adaptation of Bacillus subtilis to High Salinity. J. Bacteriol.
185: 6358-6370
[Abstract]
[Full Text]
-
Weiner III, J., Zimmerman, C.-U., Gohlmann, H. W. H., Herrmann, R.
(2003). Transcription profiles of the bacterium Mycoplasma pneumoniae grown at different temperatures. Nucleic Acids Res
31: 6306-6320
[Abstract]
[Full Text]
-
Sue, D., Boor, K. J., Wiedmann, M.
(2003). {sigma}B-dependent expression patterns of compatible solute transporter genes opuCA and lmo1421 and the conjugated bile salt hydrolase gene bsh in Listeria monocytogenes. Microbiology
149: 3247-3256
[Abstract]
[Full Text]
-
Kazmierczak, M. J., Mithoe, S. C., Boor, K. J., Wiedmann, M.
(2003). Listeria monocytogenes {sigma}B Regulates Stress Response and Virulence Functions. J. Bacteriol.
185: 5722-5734
[Abstract]
[Full Text]
-
Brigulla, M., Hoffmann, T., Krisp, A., Volker, A., Bremer, E., Volker, U.
(2003). Chill Induction of the SigB-Dependent General Stress Response in Bacillus subtilis and Its Contribution to Low-Temperature Adaptation. J. Bacteriol.
185: 4305-4314
[Abstract]
[Full Text]
-
Tomas, C. A., Alsaker, K. V., Bonarius, H. P. J., Hendriksen, W. T., Yang, H., Beamish, J. A., Paredes, C. J., Papoutsakis, E. T.
(2003). DNA Array-Based Transcriptional Analysis of Asporogenous, Nonsolventogenic Clostridium acetobutylicum Strains SKO1 and M5. J. Bacteriol.
185: 4539-4547
[Abstract]
[Full Text]
-
Thackray, P. D., Moir, A.
(2003). SigM, an Extracytoplasmic Function Sigma Factor of Bacillus subtilis, Is Activated in Response to Cell Wall Antibiotics, Ethanol, Heat, Acid, and Superoxide Stress. J. Bacteriol.
185: 3491-3498
[Abstract]
[Full Text]
-
Nakano, S., Nakano, M. M., Zhang, Y., Leelakriangsak, M., Zuber, P.
(2003). A regulatory protein that interferes with activator-stimulated transcription in bacteria. Proc. Natl. Acad. Sci. USA
100: 4233-4238
[Abstract]
[Full Text]
-
Schlothauer, T., Mogk, A., Dougan, D. A., Bukau, B., Turgay, K.
(2003). MecA, an adaptor protein necessary for ClpC chaperone activity. Proc. Natl. Acad. Sci. USA
100: 2306-2311
[Abstract]
[Full Text]
-
Luna, V. A., King, D., Davis, C., Rycerz, T., Ewert, M., Cannons, A., Amuso, P., Cattani, J.
(2003). Novel Sample Preparation Method for Safe and Rapid Detection of Bacillus anthracis Spores in Environmental Powders and Nasal Swabs. J. Clin. Microbiol.
41: 1252-1255
[Abstract]
[Full Text]
-
Rollenhagen, C., Antelmann, H., Kirstein, J., Delumeau, O., Hecker, M., Yudkin, M. D.
(2003). Binding of {sigma}A and {sigma}B to Core RNA Polymerase after Environmental Stress in Bacillus subtilis. J. Bacteriol.
185: 35-40
[Abstract]
[Full Text]
-
Helmann, J. D., Wu, M. F. W., Gaballa, A., Kobel, P. A., Morshedi, M. M., Fawcett, P., Paddon, C.
(2003). The Global Transcriptional Response of Bacillus subtilis to Peroxide Stress Is Coordinated by Three Transcription Factors. J. Bacteriol.
185: 243-253
[Abstract]
[Full Text]
-
Periago, P. M., van Schaik, W., Abee, T., Wouters, J. A.
(2002). Identification of Proteins Involved in the Heat Stress Response of Bacillus cereus ATCC 14579. Appl. Environ. Microbiol.
68: 3486-3495
[Abstract]
[Full Text]
-
Perego, M., Hoch, J. A.
(2001). Functional Genomics of Gram-Positive Microorganisms: Review of the Meeting, San Diego, California, 24 to 28 June 2001. J. Bacteriol.
183: 6973-6978
[Full Text]