This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McAteer, S.
Right arrow Articles by Masters, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McAteer, S.
Right arrow Articles by Masters, M.

 Previous Article  |  Next Article 

Journal of Bacteriology, December 2001, p. 7403-7407, Vol. 183, No. 24
0021-9193/01/$04.00+0   DOI: 10.1128/JB.183.24.7403-7407.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

The lytB Gene of Escherichia coli Is Essential and Specifies a Product Needed for Isoprenoid Biosynthesis

Sean McAteer, Andrew Coulson, Neil McLennan,dagger and Millicent Masters*

Institute of Cell and Molecular Biology, University of Edinburgh, Edinburgh EH9 3JR, Scotland

Received 21 May 2001/Accepted 12 September 2001


    ABSTRACT
Top
Abstract
Text
References

LytB and GcpE, because they are codistributed with other pathway enzymes, have been predicted to catalyze unknown steps in the nonmevalonate pathway for isoprenoid biosynthesis. We constructed a conditional Escherichia coli lytB mutant and found that LytB is essential for survival and that depletion of LytB results in cell lysis, which is consistent with a role for this protein in isoprenoid biosynthesis. Alcohols which can be converted to pathway intermediates beyond the hypothesized LytB step(s) support limited growth of E. coli lytB mutants. An informatic analysis of protein structure suggested that GcpE is a globular protein of the TIM barrel class and that LytB is also a globular protein. Possible biochemical roles for LytB and GcpE are suggested.


    TEXT
Top
Abstract
Text
References

The Escherichia coli K-12 chromosome has about 4,300 genes, approximately one-third of which have unverified or unknown functions (4). In order to extend the annotation of the E. coli genome, we have deleted uncharacterized genes and analyzed the resultant phenotypes. Among our targets was the gene that was called yaaD in EcoMap 9 (3), was later designated slpA (12), and now is designated fkpB (22) following its functional characterization as a gene that encodes a peptidyl-prolyl cis-trans isomerase of the FKBP family. We show here that our inability to delete fkpB in haploid bacteria can be attributed to the polar effect of deletion of fkpB on expression of the downstream gene lytB.

lytB is highly conserved and has a pattern of distribution similar to that of genes in the nonmevalonate pathway for isoprenoid biosynthesis used by bacteria and plants (7). Isoprenoids are universally required metabolites that in bacteria have roles in processes as diverse as respiration (ubiquinones) and cell wall synthesis (bactoprenols) (23). Recent evidence indicates that the Synechocystis sp. strain PCC 6803 lytB homolog is required for isoprenoid production and is probably essential for survival (7). We found that the E. coli lytB gene is essential for viability and has a phenotype consistent with a role in isoprenoid synthesis.

FkpB is dispensable but LytB is essential for survival in rich medium. In order to delete fkpB, a crossover PCR product was constructed (15) (Fig 1) and cloned into the PacI site of pNEB193 (New England Biolabs). (Crossover PCR produces a fragment with a central deletion.) A Cmpr cassette was inserted into the central Ecl136II site to obtain pfkpB<>CAT. (In this paper we use the nomenclature suggested by Yu et al. [24], where a<>b means that gene a is replaced by gene b.) P1 phage transduction was used to recover MG1655 mutants in which fkpB had been replaced by CAT, as described previously (8). P1 prepared on CAG18442 (pfkpB<>CAT), in which thr-39::Tn10 (Tetr) is <1 min to the left of fkpB, was used to transduce MG1655 to Cmpr with Tetr as an external linked marker. Of several hundred Tetr Cmpr progeny screened, none was Amps (i.e., had resolved the duplication resulting from plasmid insertion to replace fkpB), suggesting that fkpB could not be deleted and might be essential.


View larger version (15K):
[in this window]
[in a new window]
 
FIG. 1.   The 0.5-min region of the E. coli chromosome. The genes referred to in this paper are drawn to scale, and the directions of transcription are indicated by the arrowheads. Promoters predicted from the sequence (3) are indicated by P. Chromosomal inserts in the plasmids are shown below the map as lines of the appropriate lengths. The chromosomal restriction sites used in plasmid construction are shown (Ps, PstI; X, XbaI; RV, EcoRV; S, SnaBI). pSP47Delta lytB was constructed from pSP47 by deletion; the inserts for the remaining plasmids, other than pGB-XY, were constructed by using PCR amplification. The following primers were used to construct deletion plasmid pfkpB<>CAT: Fol (5'AATTCGCGTATTAATTAAACGATTTCCACGAAGTG), For (5'AATTCTCCGCATTAATTAAATGCAGCAGTTGCAGG), Fil (5'CCGTGTACCCGGGAGCTCGATGCGTCTGTACAGATTCAGACATGCAGG), and Fir (5'CGCATCGAGCTCCCGGGTACACGGCGTAACATGCAGATCCTGTTGGCC). The following primers were used to construct deletion plasmid plytB<>KAN: Lol (5'ATTGCTGCGAAATCGTCGACCG), Lil (5'AACCGTGTAGCGGCCGCGTAGCGTGTTACGCCTCCAGTGCCGGATCG), Lor (5'ATCACCAGCCCGGGAATATACG), and Lir (5'ACGCTACGCGGCCGCTACACGGTTGTCATTAGCAGCCTAAGTTATGCG). The DNA between the primer pairs is absent from the chromosomes of deletion strains.

We modified our procedure to use an external marker, dapB, very closely linked to fkpB (Fig. 1) and introduced compatible, complementing plasmids into both the donor and the recipient so that chromosomal deletants did not lack essential gene functions. The donor used was MG1655(pfkpB<>CAT, pGB-XY), and the dapB recipient was AT999(pGB-XY). pGB-XY contains the insert from pGM21 (17) (kindly provided by E. Ishiguro) which includes the contiguous ileS, lsp, fkpB, and lytB genes and part of the downstream yaaF gene recloned into pGB2 (6), a Spcr pSC101 replicon. fkpB and lytB are thought to be transcribed from promoters located within ileS (18). Dap+ Cmpr Amps transductants were obtained from the cross, indicating that replacement is possible in the presence of pGB-XY. Replacement of fkpB was verified by Southern blotting, and the close linkage of dapB and Cmpr was confirmed by further transduction (data not shown). The deletion/replacement was transduced to MG1655(pGB-XY), selecting for Cmpr, but could not be transferred to plasmid-free recipients.

Because fkpB is cotranscribed with the downstream lytB gene, it was not clear whether fkpB or lytB or both are essential. To determine this, we transduced the fkpB replacement to MG1655 with extrachromosomal copies of both fkpB and lytB on pSP47, of only fkpB on SP47Delta lytB, or of only lytB on pBAD-L (pBAD18 [9] in which the lytB coding sequence was cloned under the control of the arabinose operon promoter, PBAD). The chromosomal DNA in these plasmids is shown in Fig. 1. Table 1 shows that fkpB is dispensable but LytB is not. The growth rate of MG1655 fkpB<>CAT (pBAD-L) on Luria-Bertani (LB) medium containing arabinose was identical to that of MG1655 (data not shown). Microscopic observation showed that cells were normal in appearance. We concluded that fkpB is not needed for normal growth under these conditions.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Successful transduction of fkpB<>CAT requires lytB expression

To study LytB function further, we constructed a conditionally expressing system. Crossover PCR was used to construct a 1-kb fragment in which the sequence flanking lytB was joined. The fragment was cloned into the SmaI/SalI sites of pKO3 (15), and a Kanr cassette was cloned into the central NotI site created during amplification. The resulting plasmid, plytB<>KAN, was transformed into MG1655(pBAD-L) grown with arabinose, and replacements were isolated as described previously (15). A representative construct, strain MGDelta Ly, was unable to form colonies under conditions in which PBAD is inactive (arabinose absent, glucose present), confirming that LytB is an essential protein.

Evidence that LytB is defective in isoprenoid synthesis. Because LytB synthesis in MGDelta Ly cultures could be inhibited by removing arabinose and adding glucose, it was possible to examine the effects of LytB depletion on cells. During depletion, growth continued normally for about 3 h and then slowed; lysis followed at about 4.6 h (Fig. 2A). Examination of the cultures showed that cells were converted to spheroplasts en route to lysis (Fig. 3). This phenotype can be explained since isoprenoids are required to make the bactoprenols which transport peptidoglycan precursors to the periplasm. Cunningham et al. (7) used 3-methyl-3-buten-1-ol (A3) and 3-methyl-2-buten-1-ol (A2), alcohol analogs of 3-methyl-3-buten-1-ol diphosphate (isopentenyl diphosphate [IPP]) and 3-methyl-2-buten-1-ol diphosphate (dimethyallyl diphosphate [DMAPP]) (see pathway in Fig. 4), to support the growth of Synechocystis cells deficient in LytB. We tested these alcohols to see if they were able to replace the requirement for LytB in E. coli. We found that they could not (presumably because they were not efficiently converted to the diphosphorylated derivatives that they would need to replace) during exponential growth in broth. However, they must have been successfully transported into the cell to some extent because they prevented lysis and allowed growth to continue for a period beyond the time when lysis would have occurred (Fig. 2B). The response to A2 was better than the response to A3 and was similar to the response to the two alcohols together. On LB medium plates containing glucose (to repress PBAD) adding A2 or both alcohols resulted in slow colony formation, most likely because viability was sustained until changed intracellular conditions resulted in PBAD induction. To show that the alcohols circumvent the lytB mutation rather than prevent lysis generally, we added the alcohols to dapA cells which had been deprived of diaminopimelic acid. The time and rate of lysis of the dapA mutant were not altered.


View larger version (26K):
[in this window]
[in a new window]
 
FIG. 2.   Growth of MGDelta Ly after depletion of LytB. Cultures grown in LB medium containing 0.2% arabinose and 50 µg of ampicillin per ml were diluted and grown in the same medium for 3.5 generations. At the times indicated by the arrows cultures were diluted into medium with arabinose or glucose (0.2%). Cultures were maintained in the exponential phase at all times. Large decreases in optical density at 600 nm (O.D. 600) indicate times of dilution. (A) Growth with arabinose or glucose; (B) cultures contain glucose and each of the alcohols indicated at a concentration of 10 mM.


View larger version (158K):
[in this window]
[in a new window]
 
FIG. 3.   Cell lysis in LytB-depleted cultures. Samples were taken from the cultures described in the legend to Fig. 2A at 360 min, fixed, and later photographed. (A) Spheroplasting in LytB-depleted cultures grown with glucose; (B) cells grown with arabinose.


View larger version (20K):
[in this window]
[in a new window]
 
FIG. 4.   Known and postulated reactions of the DOXP pathway.

We also constructed a strain in which a single copy of lytB was present on the chromosome under the control of the PBAD promoter by using the method and a plasmid kindly provided by Hans Loferer (2). This strain, MG1655 araBCD<>lytB, was not able to form colonies in the absence of arabinose on rich or minimal solid media with or without alcohols, showing that the alcohols could not replace LytB activity. Addition of alcohols to broth cultures of this strain delayed lysis (data not shown).

Nonmevalonate pathway and LytB function. The 1-deoxy-D-xylulose-5-phosphate (DOXP) pathway (14) is used in green plants and many bacteria instead of the mevalonate pathway to generate the isoprenoid precursors IPP and DMAPP. This pathway (Fig. 4) originates with pyruvate and glyceraldehyde-3-phosphate. Almost all of the biochemical steps are now known.

The most recently identified reactions and genes are those that follow the formation of DOXP. The first reaction is simultaneous reduction and isomerization to 2-C-methyl-D-erythritol-4-phosphate, catalyzed by the dxr gene product. This enzyme has been isolated from E. coli and characterized (13). The chemistry of the three following steps has also been established: CTP-dependent cytidylation catalyzed by YgbP (20) (now renamed IspD; see EcoCyc at www.ecocyc.org/ for the isp pathway), ATP-dependent phosphorylation catalyzed by YchB (now IspE) (16), and cyclization with loss of CMP catalyzed by YgbB (now IspF) (11). Uncertainty remains about the final steps between 2C-methyl-D-erythritol-2,4-cyclodiphosphate and the isomers IPP and DMAPP. It has been shown (10) that although idi, the IPP isomerase gene of the mevalonate pathway, is present and active in E. coli, it is dispensable, suggesting that DMAPP and IPP are produced independently in the DOXP pathway; additional evidence that this is the case has been presented recently (19).

The remaining chemical steps in the pathway are two reductions (reduction of a primary alcohol and reduction of a secondary alcohol) and a ring-opening elimination reaction. Either IPP or DMAPP could be the product of this reaction, depending on which carbon contributes the hydrogen atom to the elimination. There are no known examples of reduction of alcohols in a single enzymatic step. Most commonly, these reactions occur in two steps: dehydration followed by enoyl reduction by NADPH. These considerations imply either that there are still a number of unrecognized genes in the DOXP pathway or that the alcohol reduction steps occur by non-pathway-specific mechanisms.

The two remaining genes with a pattern of homology that indicates that their functions may be specific to this pathway are lytB and gcpE (7). Our results and those of Cunningham et al. (7) show that lytB is an essential gene in the pathway. gcpE has recently also been shown to be essential (1, 5). Secondary-structure predictions (Fig. 5 and 6) indicate that both proteins are globular, alpha /beta proteins with generally alternating alpha -helix and beta -strand units. For GcpE this secondary structure was shown to be compatible with the eight-strand, alpha beta -TIM barrel tertiary structure (data not shown). For neither protein is there structural or sequence evidence for a binding site of a reduced coenzyme. If the alcohol level reductions are carried out by non-pathway-specific reductase systems, then it is possible that LytB and GcpE both catalyze elimination reactions and that the branching of the pathway is due to these enzymes acting in parallel.


View larger version (48K):
[in this window]
[in a new window]
 
FIG. 5.   Predicted secondary and tertiary structures for GcpE. H and E beneath the protein sequence indicate that the corresponding residues are predicted by PHD (21) to form parts of an alpha -helix and an extended structure (beta -sheet), respectively. Information above the sequence indicates the predicted positions and extents of the backbone alpha - and beta -units of the TIM barrel tertiary structure, inferred from a comparison of the sequences of homologues of GcpE and of the PDB structure 1THF.


View larger version (40K):
[in this window]
[in a new window]
 
FIG. 6.   Predicted secondary structure for LytB. For an explanation of the labels see the legend to Fig. 5.


    ACKNOWLEDGMENTS

This work was supported in its early stages by the Medical Research Council (United Kingdom) and more recently by the BBSRC (United Kingdom).


    ADDENDUM IN PROOF

After this paper was submitted, Altincicek et al. (A. Altincicek, A.-K. Kollas, M. Eberl, J. Wiesner, S. Sanderbrand, M. Hintz, E. Beck, and H. Jomaa, FEBS Lett. 499:37-40, 2001) also reported that the E. coli lytB gene is an essential gene of isoprenoid biosynthesis.


    FOOTNOTES

* Corresponding author. Mailing address: Institute of Cell and Molecular Biology, University of Edinburgh, Kings' Buildings, Mayfield Road, Edinburgh EH9 3JR, Scotland. Phone: 44 131 650 5355. Fax: 44 131 650 8650. E-mail: M.Masters{at}ed.ac.uk.

dagger Present address: CJD Surveillance Unit, Department of Pathology, University of Edinburgh, Western General Hospital, Edinburgh, Scotland.


    REFERENCES
Top
Abstract
Text
References

1. Altincicek, B., A.-K. Kollas, S. Sanderbrand, J. Wiesner, M. Hintz, E. Beck, and H. Jomaa. 2001. GcpE is involved in the 2-C-methyl-D-erythritol 4-phosphate pathway of isoprenoid biosynthesis in Escherichia coli. J. Bacteriol. 183:2411-2416[Abstract/Free Full Text].
2. Arigoni, F., F. Talabot, M. Peitsch, M. D. Edgerton, E. Meldrum, E. Allet, R. Fish, T. Jamotte, M. L. Curchod, and H. Loferer. 1998. A genome-based approach for the identification of essential bacterial genes. Nat. Biotechnol. 16:851-856[CrossRef][Medline].
3. Berlyn, M., K. B. Low, and K. E. Rudd. 1996. Linkage map of Escherichia coli K-12, edition 9, p. 1715-1902. In F. C. Neidhardt, et al. (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology, 2nd ed. ASM Press, Washington, D.C.
4. Blattner, F. R., G. Plunkett, 3rd, C. A. Bloch, N. T. Perna, V. Burland, M. Riley, J. Collado-Vides, J. D. Glasner, C. K. Rode, G. F. Mayhew, J. Gregor, N. W. Davis, H. A. Kirkpatrick, M. A. Goeden, D. J. Rose, B. Mau, and Y. Shao. 1997. The complete genome sequence of Escherichia coli K-12. Science 277:1453-1474[Abstract/Free Full Text].
5. Campos, N., M. Rodriguez-Concepcion, M. Seemann, M. Rohmer, and A. Boronat. 2001. Identification of gcpE as a novel gene of the 2-C-methyl-D-erythritol 4-phosphate pathway for isoprenoid biosynthesis in Escherichia coli. FEBS Lett. 488:170-173[CrossRef][Medline].
6. Churchward, G., D. Belin, and Y. Nagamine. 1984. A pSC101-derived plasmid which shows no sequence homology to other commonly used cloning vectors. Gene 31:165-171[CrossRef][Medline].
7. Cunningham, F. X., Jr., T. P. Lafond, and E. Gantt. 2000. Evidence of a role for LytB in the nonmevalonate pathway of isoprenoid biosynthesis. J. Bacteriol. 182:5841-5848[Abstract/Free Full Text].
8. Draper, G. C., N. McLennan, K. Begg, M. Masters, and W. D. Donachie. 1998. Only the N-terminal domain of FtsK functions in cell division. J. Bacteriol. 180:4621-4627[Abstract/Free Full Text].
9. Guzman, L. M., D. Belin, M. J. Carson, and J. Beckwith. 1995. Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J. Bacteriol. 177:4121-4130[Abstract/Free Full Text].
10. Hahn, F. M., A. P. Hurlburt, and C. D. Poulter. 1999. Escherichia coli open reading frame 696 is idi, a nonessential gene encoding isopentenyl diphosphate isomerase. J. Bacteriol. 181:4499-4504[Abstract/Free Full Text].
11. Herz, S., J. Wungsintaweekul, C. A. Schuhr, S. Hecht, H. Luttgen, S. Sagner, M. Fellermeier, W. Eisenreich, M. H. Zenk, A. Bacher, and F. Rohdich. 2000. Biosynthesis of terpenoids: YgbB protein converts 4-diphosphocytidyl-2C-methyl-D-erythritol-2-phosphate to 2C-methyl-D-erythritol-2,4-cyclodiphosphate. Proc. Natl. Acad. Sci. USA 97:2486-2490[Abstract/Free Full Text].
12. Hottenrott, S., T. Schumann, A. Pluckthun, G. Fischer, and J. U. Rahfeld. 1997. The Escherichia coli SlyD is a metal ion-regulated peptidyl-prolyl cis/trans-isomerase. J. Biol. Chem. 272:15697-15701[Abstract/Free Full Text].
13. Kuzuyama, T., S. Takahashi, M. Takagi, and H. Seto. 2000. Characterization of 1-deoxy-D-xylulose-5-phosphate reductoisomerase, an enzyme involved in isopentenyl diphosphate biosynthesis and identification of its catalytic amino acid residues. J. Biol. Chem. 275:19928-19932[Abstract/Free Full Text].
14. Lichtenthaler, H. K. 1999. The 1-deoxy-D-xylulose-5-phosphate pathway of isoprenoid biosynthesis in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 50:47-65[CrossRef].
15. Link, A. J., D. Phillips, and G. M. Church. 1997. Methods for generating precise deletions and insertions in the genome of wild-type Escherichia coli: application to open reading frame characterization. J. Bacteriol. 179:6228-6237[Abstract/Free Full Text].
16. Luttgen, H., F. Rohdich, S. Herz, J. Wungsintaweekul, S. Hecht, C. A. Schuhr, M. Fellermeier, S. Sagner, M. H. Zenk, A. Bacher, and W. Eisenreich. 2000. Biosynthesis of terpenoids: YchB protein of Escherichia coli phosphorylates the 2-hydroxy group of 4-diphosphocytidyl-2C-methyl-D-erythritol. Proc. Natl. Acad. Sci. USA 97:1052-1057.
17. Mackie, G. A., and G. D. Parsons. 1982. Identification of gene products from cloned fragments of the left arm of lambda dapB2. Can J. Biochem. 60:338-346[Medline].
18. Miller, K. W., J. Bouvier, P. Stragier, and H. C. Wu. 1987. Identification of the genes in the Escherichia coli ileS-lsp operon. Analysis of multiple polycistronic mRNAs made in vivo. J. Biol. Chem. 262:7391-7397[Abstract/Free Full Text].
19. Rodriguez-Concepcion, M., N. Campos, L. Lois, C. Maldonado, J.-F. Hoeffler, C. Grosdemange-Billiard, M. Rohmer, and A. Boronat. 2000. Genetic evidence of branching in the isoprenoid pathway for the production of isopentenyl diphosphate and dimethylallyl diphosphate in Escherichia coli. FEBS Lett. 473:328-332[CrossRef][Medline].
20. Rohdich, F., J. Wungsintaweekul, M. Fellermeier, S. Sagner, S. Herz, K. Kis, W. Eisenreich, A. Bacher, and M. H. Zenk. 1999. Cytidine 5'-triphosphate-dependent biosynthesis of isoprenoids: YgbP protein of Escherichia coli catalyzes the formation of 4-diphosphocytidyl-2-C-methyl erythritol. Proc. Natl. Acad. Sci. USA 96:11758-11763[Abstract/Free Full Text].
21. Rost, B. 1998. PHD: predicting one-dimensional protein structure by profile based neural networks. Methods Enzymol. 266:525-539.
22. Rudd, K. E. 1998. Linkage map of Escherichia coli K-12, edition 10: the physical map. Microbiol. Mol. Biol. Rev. 62:985-1019[Abstract/Free Full Text].
23. Sherman, M. M., L. A. Petersen, and C. D. Poulter. 1989. Isolation and characterization of isoprene mutants of Escherichia coli. J. Bacteriol. 171:3619-3628[Abstract/Free Full Text].
24. Yu, D., H. M. Ellis, E. C. Lee, N. A. Jenkins, N. G. Copeland, and D. L. Court. 2000. An efficient recombination system for chromosome engineering in Escherichia coli. Proc. Natl. Acad. Sci. USA 97:5978-5983[Abstract/Free Full Text].


Journal of Bacteriology, December 2001, p. 7403-7407, Vol. 183, No. 24
0021-9193/01/$04.00+0   DOI: 10.1128/JB.183.24.7403-7407.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Alyahya, S. A., Alexander, R., Costa, T., Henriques, A. O., Emonet, T., Jacobs-Wagner, C. (2009). From the Cover: RodZ, a component of the bacterial core morphogenic apparatus. Proc. Natl. Acad. Sci. USA 106: 1239-1244 [Abstract] [Full Text]  
  • Hsieh, M.-H., Goodman, H. M. (2005). The Arabidopsis IspH Homolog Is Involved in the Plastid Nonmevalonate Pathway of Isoprenoid Biosynthesis. Plant Physiol. 138: 641-653 [Abstract] [Full Text]  
  • Page, J. E., Hause, G., Raschke, M., Gao, W., Schmidt, J., Zenk, M. H., Kutchan, T. M. (2004). Functional Analysis of the Final Steps of the 1-Deoxy-D-xylulose 5-phosphate (DXP) Pathway to Isoprenoids in Plants Using Virus-Induced Gene Silencing. Plant Physiol. 134: 1401-1413 [Abstract] [Full Text]  
  • Testa, C. A., Cornish, R. M., Poulter, C. D. (2004). The Sorbitol Phosphotransferase System Is Responsible for Transport of 2-C-Methyl-D-Erythritol into Salmonella enterica Serovar Typhimurium. J. Bacteriol. 186: 473-480 [Abstract] [Full Text]  
  • Rohdich, F., Hecht, S., Gartner, K., Adam, P., Krieger, C., Amslinger, S., Arigoni, D., Bacher, A., Eisenreich, W. (2002). Studies on the nonmevalonate terpene biosynthetic pathway: Metabolic role of IspH (LytB) protein. Proc. Natl. Acad. Sci. USA 10.1073/pnas.032658999v1 [Abstract] [Full Text]  
  • Richard, S. B., Ferrer, J.-L., Bowman, M. E., Lillo, A. M., Tetzlaff, C. N., Cane, D. E., Noel, J. P. (2002). Structure and Mechanism of 2-C-Methyl-D-erythritol 2,4-Cyclodiphosphate Synthase. AN ENZYME IN THE MEVALONATE-INDEPENDENT ISOPRENOID BIOSYNTHETIC PATHWAY. J. Biol. Chem. 277: 8667-8672 [Abstract] [Full Text]  
  • Rohdich, F., Hecht, S., Gartner, K., Adam, P., Krieger, C., Amslinger, S., Arigoni, D., Bacher, A., Eisenreich, W. (2002). Studies on the nonmevalonate terpene biosynthetic pathway: Metabolic role of IspH (LytB) protein. Proc. Natl. Acad. Sci. USA 99: 1158-1163 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McAteer, S.
Right arrow Articles by Masters, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McAteer, S.
Right arrow Articles by Masters, M.