Previous Article | Next Article 
Journal of Bacteriology, December 2001, p. 7403-7407, Vol. 183, No. 24
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.24.7403-7407.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
The lytB Gene of Escherichia
coli Is Essential and Specifies a Product Needed for
Isoprenoid Biosynthesis
Sean
McAteer,
Andrew
Coulson,
Neil
McLennan,
and
Millicent
Masters*
Institute of Cell and Molecular Biology,
University of Edinburgh, Edinburgh EH9 3JR, Scotland
Received 21 May 2001/Accepted 12 September 2001
 |
ABSTRACT |
LytB and GcpE, because they are codistributed with other pathway
enzymes, have been predicted to catalyze unknown steps in the
nonmevalonate pathway for isoprenoid biosynthesis. We constructed a
conditional Escherichia coli lytB mutant and found that
LytB is essential for survival and that depletion of LytB results in cell lysis, which is consistent with a role for this protein in isoprenoid biosynthesis. Alcohols which can be converted to pathway intermediates beyond the hypothesized LytB step(s) support limited growth of E. coli lytB mutants. An informatic analysis
of protein structure suggested that GcpE is a globular protein of the
TIM barrel class and that LytB is also a globular protein. Possible biochemical roles for LytB and GcpE are suggested.
| |
TEXT |
The Escherichia
coli K-12 chromosome has about 4,300 genes, approximately
one-third of which have unverified or unknown functions (4). In order to extend the annotation of the E. coli genome, we have deleted uncharacterized genes and analyzed
the resultant phenotypes. Among our targets was the gene that was
called yaaD in EcoMap 9 (3), was later
designated slpA (12), and now is designated
fkpB (22) following its functional
characterization as a gene that encodes a peptidyl-prolyl
cis-trans isomerase of the FKBP family. We show
here that our inability to delete fkpB in haploid bacteria
can be attributed to the polar effect of deletion of fkpB on
expression of the downstream gene lytB.
lytB is highly conserved and has a pattern of distribution
similar to that of genes in the nonmevalonate pathway for isoprenoid biosynthesis used by bacteria and plants (7). Isoprenoids
are universally required metabolites that in bacteria have roles in processes as diverse as respiration (ubiquinones) and cell wall synthesis (bactoprenols) (23). Recent evidence indicates
that the Synechocystis sp. strain PCC 6803 lytB
homolog is required for isoprenoid production and is probably essential
for survival (7). We found that the E. coli
lytB gene is essential for viability and has a phenotype
consistent with a role in isoprenoid synthesis.
FkpB is dispensable but LytB is essential for survival in rich
medium.
In order to delete fkpB, a crossover PCR
product was constructed (15) (Fig
1) and cloned into the PacI
site of pNEB193 (New England Biolabs). (Crossover PCR produces a
fragment with a central deletion.) A Cmpr
cassette was inserted into the central Ecl136II site to
obtain pfkpB<>CAT. (In this paper we use the nomenclature suggested
by Yu et al. [24], where a<>b means that gene a
is replaced by gene b.) P1 phage transduction was used to recover
MG1655 mutants in which fkpB had been replaced by CAT, as
described previously (8). P1 prepared on CAG18442
(pfkpB<>CAT), in which thr-39::Tn10 (Tetr) is <1 min to the left of fkpB,
was used to transduce MG1655 to Cmpr with
Tetr as an external linked marker. Of several
hundred Tetr Cmpr progeny
screened, none was Amps (i.e., had resolved the
duplication resulting from plasmid insertion to replace
fkpB), suggesting that fkpB could not be deleted
and might be essential.
View larger version (15K):
[in this window]
[in a new window]
|
FIG. 1.
The 0.5-min region of the E. coli
chromosome. The genes referred to in this paper are drawn to scale, and
the directions of transcription are indicated by the arrowheads.
Promoters predicted from the sequence (3) are indicated by
P. Chromosomal inserts in the plasmids are shown below the map as lines
of the appropriate lengths. The chromosomal restriction sites used in
plasmid construction are shown (Ps, PstI; X,
XbaI; RV, EcoRV; S,
SnaBI). pSP47 lytB was constructed from pSP47
by deletion; the inserts for the remaining plasmids, other than pGB-XY,
were constructed by using PCR amplification. The following primers were
used to construct deletion plasmid pfkpB<>CAT: Fol
(5'AATTCGCGTATTAATTAAACGATTTCCACGAAGTG), For
(5'AATTCTCCGCATTAATTAAATGCAGCAGTTGCAGG), Fil
(5'CCGTGTACCCGGGAGCTCGATGCGTCTGTACAGATTCAGACATGCAGG),
and Fir
(5'CGCATCGAGCTCCCGGGTACACGGCGTAACATGCAGATCCTGTTGGCC). The
following primers were used to construct deletion plasmid
plytB<>KAN: Lol (5'ATTGCTGCGAAATCGTCGACCG), Lil
(5'AACCGTGTAGCGGCCGCGTAGCGTGTTACGCCTCCAGTGCCGGATCG), Lor
(5'ATCACCAGCCCGGGAATATACG), and Lir
(5'ACGCTACGCGGCCGCTACACGGTTGTCATTAGCAGCCTAAGTTATGCG). The
DNA between the primer pairs is absent from the chromosomes of deletion
strains.
|
|
We modified our procedure to use an external marker,
dapB,
very closely linked to
fkpB (Fig.
1) and introduced
compatible,
complementing plasmids into both the donor and the
recipient so
that chromosomal deletants did not lack essential gene
functions.
The donor used was MG1655(pfkpB<>CAT, pGB-XY), and the
dapB recipient
was AT999(pGB-XY). pGB-XY contains the insert
from pGM21 (
17)
(kindly provided by E. Ishiguro) which
includes the contiguous
ileS,
lsp,
fkpB, and
lytB genes and part of the downstream
yaaF gene recloned into pGB2 (
6), a
Spc
r pSC101 replicon.
fkpB and
lytB are thought to be transcribed
from promoters located
within
ileS (
18). Dap
+
Cmp
r Amp
s transductants
were obtained from the cross, indicating that replacement
is possible
in the presence of pGB-XY. Replacement of
fkpB was
verified by Southern blotting, and the close linkage of
dapB
and
Cmp
r was confirmed by further
transduction (data not shown). The deletion/replacement
was transduced
to MG1655(pGB-XY), selecting for Cmp
r, but could
not be transferred to plasmid-free
recipients.
Because
fkpB is cotranscribed with the downstream
lytB gene, it was not clear whether
fkpB or
lytB or both are essential.
To determine this, we transduced
the
fkpB replacement to MG1655
with extrachromosomal copies
of both
fkpB and
lytB on pSP47, of
only
fkpB on SP47
lytB, or of only
lytB on pBAD-L
(pBAD18 [
9]
in which the
lytB coding sequence
was cloned under the control
of the arabinose operon promoter,
P
BAD). The chromosomal DNA in
these
plasmids is shown in Fig.
1. Table
1
shows that
fkpB is
dispensable but LytB is not. The growth
rate of MG1655
fkpB<>CAT
(pBAD-L) on Luria-Bertani
(LB) medium containing arabinose was
identical to that of MG1655
(data not shown). Microscopic observation
showed that cells were
normal in appearance. We concluded that
fkpB is not needed
for normal growth under these conditions.
To study LytB function further, we constructed a conditionally
expressing system. Crossover PCR was used to construct a 1-kb
fragment
in which the sequence flanking
lytB was joined. The fragment
was cloned into the
SmaI/
SalI sites of pKO3
(
15), and a Kan
r cassette was cloned
into the central
NotI site created during
amplification. The
resulting plasmid, plytB<>KAN, was transformed
into
MG1655(pBAD-L) grown with arabinose, and replacements were
isolated
as described previously (
15). A representative construct,
strain MG
Ly, was unable to form colonies under conditions in
which
P
BAD is inactive (arabinose absent, glucose
present), confirming
that LytB is an essential
protein.
Evidence that LytB is defective in isoprenoid synthesis.
Because LytB synthesis in MGLy cultures could be inhibited by
removing arabinose and adding glucose, it was possible to examine the
effects of LytB depletion on cells. During depletion, growth continued
normally for about 3 h and then slowed; lysis followed at about
4.6 h (Fig. 2A). Examination of the
cultures showed that cells were converted to spheroplasts en route to
lysis (Fig. 3). This phenotype can be
explained since isoprenoids are required to make the bactoprenols which
transport peptidoglycan precursors to the periplasm. Cunningham et al.
(7) used 3-methyl-3-buten-1-ol (A3) and
3-methyl-2-buten-1-ol (A2), alcohol analogs of 3-methyl-3-buten-1-ol diphosphate (isopentenyl diphosphate [IPP]) and 3-methyl-2-buten-1-ol diphosphate (dimethyallyl diphosphate [DMAPP]) (see pathway in Fig.
4), to support the growth of
Synechocystis cells deficient in LytB. We tested these
alcohols to see if they were able to replace the requirement for LytB
in E. coli. We found that they could not (presumably because
they were not efficiently converted to the diphosphorylated derivatives
that they would need to replace) during exponential growth in broth.
However, they must have been successfully transported into the cell to
some extent because they prevented lysis and allowed growth to continue
for a period beyond the time when lysis would have occurred (Fig. 2B).
The response to A2 was better than the response to A3 and was similar to the response to the two alcohols together. On LB medium plates containing glucose (to repress PBAD) adding A2 or
both alcohols resulted in slow colony formation, most likely because
viability was sustained until changed intracellular conditions resulted in PBAD induction. To show that the alcohols
circumvent the lytB mutation rather than prevent lysis
generally, we added the alcohols to dapA cells which had
been deprived of diaminopimelic acid. The time and rate of lysis of the
dapA mutant were not altered.
View larger version (26K):
[in this window]
[in a new window]
|
FIG. 2.
Growth of MGLy after depletion of LytB. Cultures
grown in LB medium containing 0.2% arabinose and 50 µg of ampicillin
per ml were diluted and grown in the same medium for 3.5 generations.
At the times indicated by the arrows cultures were diluted into medium
with arabinose or glucose (0.2%). Cultures were maintained in the
exponential phase at all times. Large decreases in optical density at
600 nm (O.D. 600) indicate times of dilution. (A) Growth with arabinose
or glucose; (B) cultures contain glucose and each of the alcohols
indicated at a concentration of 10 mM.
|
|
View larger version (158K):
[in this window]
[in a new window]
|
FIG. 3.
Cell lysis in LytB-depleted cultures. Samples were taken
from the cultures described in the legend to Fig. 2A at 360 min, fixed,
and later photographed. (A) Spheroplasting in LytB-depleted cultures
grown with glucose; (B) cells grown with arabinose.
|
|
We also constructed a strain in which a single copy of
lytB
was present on the chromosome under the control of the
P
BAD promoter
by using the method and a plasmid
kindly provided by Hans Loferer
(
2). This strain, MG1655
araBCD<>
lytB, was not able to form
colonies in the absence of arabinose on rich or minimal solid
media
with or without alcohols, showing that the alcohols could
not replace
LytB activity. Addition of alcohols to broth cultures
of this strain
delayed lysis (data not
shown).
Nonmevalonate pathway and LytB function.
The
1-deoxy-D-xylulose-5-phosphate (DOXP) pathway
(14) is used in green plants and many bacteria instead of
the mevalonate pathway to generate the isoprenoid precursors IPP and
DMAPP. This pathway (Fig. 4) originates with pyruvate and
glyceraldehyde-3-phosphate. Almost all of the biochemical steps
are now known.
The most recently identified reactions and genes are those that
follow the formation of DOXP. The first reaction is simultaneous
reduction and isomerization to
2-
C-methyl-
D-erythritol-4-phosphate,
catalyzed by the
dxr gene product. This enzyme has been
isolated
from
E. coli and characterized (
13).
The chemistry of the three
following steps has also been established:
CTP-dependent cytidylation
catalyzed by YgbP (
20) (now
renamed IspD; see EcoCyc at
www.ecocyc.org/ for the
isp
pathway), ATP-dependent phosphorylation catalyzed
by YchB (now IspE)
(
16), and cyclization with loss of CMP catalyzed
by YgbB
(now IspF) (
11). Uncertainty remains about the final
steps between
2
C-methyl-
D-erythritol-2,4-cyclodiphosphate
and
the isomers IPP and DMAPP. It has been shown (
10) that
although
idi, the IPP isomerase gene of the mevalonate
pathway, is present
and active in
E. coli, it is
dispensable, suggesting that DMAPP
and IPP are produced independently
in the DOXP pathway; additional
evidence that this is the case has been
presented recently (
19).
The remaining chemical steps in the pathway are two reductions
(reduction of a primary alcohol and reduction of a secondary
alcohol)
and a ring-opening elimination reaction. Either IPP or
DMAPP could be
the product of this reaction, depending on which
carbon contributes the
hydrogen atom to the elimination. There
are no known examples of
reduction of alcohols in a single enzymatic
step. Most commonly, these
reactions occur in two steps: dehydration
followed by enoyl reduction
by NADPH. These considerations imply
either that there are still a
number of unrecognized genes in
the DOXP pathway or that the alcohol
reduction steps occur by
non-pathway-specific
mechanisms.
The two remaining genes with a pattern of homology that indicates that
their functions may be specific to this pathway are
lytB and
gcpE (
7). Our results and those of Cunningham
et al.
(
7) show that
lytB is an essential gene
in the pathway.
gcpE has recently also been shown to be
essential (
1,
5). Secondary-structure
predictions (Fig.
5 and
6)
indicate that both proteins are globular,
/
proteins with
generally alternating
-helix and
-strand units.
For GcpE this
secondary structure was shown to be compatible with
the eight-strand,
-TIM barrel tertiary structure (data not shown).
For neither
protein is there structural or sequence evidence for
a binding site of
a reduced coenzyme. If the alcohol level reductions
are carried out by
non-pathway-specific reductase systems, then
it is possible that LytB
and GcpE both catalyze elimination reactions
and that the branching of
the pathway is due to these enzymes
acting in parallel.
View larger version (48K):
[in this window]
[in a new window]
|
FIG. 5.
Predicted secondary and tertiary structures for
GcpE. H and E beneath the protein sequence indicate that the
corresponding residues are predicted by PHD (21) to
form parts of an -helix and an extended structure (-sheet),
respectively. Information above the sequence indicates the
predicted positions and extents of the backbone - and -units
of the TIM barrel tertiary structure, inferred from a comparison
of the sequences of homologues of GcpE and of the PDB structure
1THF.
|
|
| |
ACKNOWLEDGMENTS |
This work was supported in its early stages by the Medical Research
Council (United Kingdom) and more recently by the BBSRC (United Kingdom).
| |
ADDENDUM IN PROOF |
After this paper was submitted, Altincicek et al. (A. Altincicek,
A.-K. Kollas, M. Eberl, J. Wiesner, S. Sanderbrand, M. Hintz, E. Beck,
and H. Jomaa, FEBS Lett. 499:37-40, 2001) also reported
that the E. coli lytB gene is an essential gene of
isoprenoid biosynthesis.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute of
Cell and Molecular Biology, University of Edinburgh, Kings' Buildings, Mayfield Road, Edinburgh EH9 3JR, Scotland. Phone: 44 131 650 5355. Fax: 44 131 650 8650. E-mail: M.Masters{at}ed.ac.uk.
Present address: CJD Surveillance Unit, Department of Pathology,
University of Edinburgh, Western General Hospital, Edinburgh, Scotland.
| |
REFERENCES |
| 1.
|
Altincicek, B.,
A.-K. Kollas,
S. Sanderbrand,
J. Wiesner,
M. Hintz,
E. Beck, and H. Jomaa.
2001.
GcpE is involved in the 2-C-methyl-D-erythritol 4-phosphate pathway of isoprenoid biosynthesis in Escherichia coli.
J. Bacteriol.
183:2411-2416[Abstract/Free Full Text].
|
| 2.
|
Arigoni, F.,
F. Talabot,
M. Peitsch,
M. D. Edgerton,
E. Meldrum,
E. Allet,
R. Fish,
T. Jamotte,
M. L. Curchod, and H. Loferer.
1998.
A genome-based approach for the identification of essential bacterial genes.
Nat. Biotechnol.
16:851-856[CrossRef][Medline].
|
| 3.
|
Berlyn, M.,
K. B. Low, and K. E. Rudd.
1996.
Linkage map of Escherichia coli K-12, edition 9, p. 1715-1902.
In
F. C. Neidhardt, et al. (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology, 2nd ed. ASM Press, Washington, D.C.
|
| 4.
|
Blattner, F. R.,
G. Plunkett, 3rd,
C. A. Bloch,
N. T. Perna,
V. Burland,
M. Riley,
J. Collado-Vides,
J. D. Glasner,
C. K. Rode,
G. F. Mayhew,
J. Gregor,
N. W. Davis,
H. A. Kirkpatrick,
M. A. Goeden,
D. J. Rose,
B. Mau, and Y. Shao.
1997.
The complete genome sequence of Escherichia coli K-12.
Science
277:1453-1474[Abstract/Free Full Text].
|
| 5.
|
Campos, N.,
M. Rodriguez-Concepcion,
M. Seemann,
M. Rohmer, and A. Boronat.
2001.
Identification of gcpE as a novel gene of the 2-C-methyl-D-erythritol 4-phosphate pathway for isoprenoid biosynthesis in Escherichia coli.
FEBS Lett.
488:170-173[CrossRef][Medline].
|
| 6.
|
Churchward, G.,
D. Belin, and Y. Nagamine.
1984.
A pSC101-derived plasmid which shows no sequence homology to other commonly used cloning vectors.
Gene
31:165-171[CrossRef][Medline].
|
| 7.
|
Cunningham, F. X., Jr.,
T. P. Lafond, and E. Gantt.
2000.
Evidence of a role for LytB in the nonmevalonate pathway of isoprenoid biosynthesis.
J. Bacteriol.
182:5841-5848[Abstract/Free Full Text].
|
| 8.
|
Draper, G. C.,
N. McLennan,
K. Begg,
M. Masters, and W. D. Donachie.
1998.
Only the N-terminal domain of FtsK functions in cell division.
J. Bacteriol.
180:4621-4627[Abstract/Free Full Text].
|
| 9.
|
Guzman, L. M.,
D. Belin,
M. J. Carson, and J. Beckwith.
1995.
Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter.
J. Bacteriol.
177:4121-4130[Abstract/Free Full Text].
|
| 10.
|
Hahn, F. M.,
A. P. Hurlburt, and C. D. Poulter.
1999.
Escherichia coli open reading frame 696 is idi, a nonessential gene encoding isopentenyl diphosphate isomerase.
J. Bacteriol.
181:4499-4504[Abstract/Free Full Text].
|
| 11.
|
Herz, S.,
J. Wungsintaweekul,
C. A. Schuhr,
S. Hecht,
H. Luttgen,
S. Sagner,
M. Fellermeier,
W. Eisenreich,
M. H. Zenk,
A. Bacher, and F. Rohdich.
2000.
Biosynthesis of terpenoids: YgbB protein converts 4-diphosphocytidyl-2C-methyl-D-erythritol-2-phosphate to 2C-methyl-D-erythritol-2,4-cyclodiphosphate.
Proc. Natl. Acad. Sci. USA
97:2486-2490[Abstract/Free Full Text].
|
| 12.
|
Hottenrott, S.,
T. Schumann,
A. Pluckthun,
G. Fischer, and J. U. Rahfeld.
1997.
The Escherichia coli SlyD is a metal ion-regulated peptidyl-prolyl cis/trans-isomerase.
J. Biol. Chem.
272:15697-15701[Abstract/Free Full Text].
|
| 13.
|
Kuzuyama, T.,
S. Takahashi,
M. Takagi, and H. Seto.
2000.
Characterization of 1-deoxy-D-xylulose-5-phosphate reductoisomerase, an enzyme involved in isopentenyl diphosphate biosynthesis and identification of its catalytic amino acid residues.
J. Biol. Chem.
275:19928-19932[Abstract/Free Full Text].
|
| 14.
|
Lichtenthaler, H. K.
1999.
The 1-deoxy-D-xylulose-5-phosphate pathway of isoprenoid biosynthesis in plants.
Annu. Rev. Plant Physiol. Plant Mol. Biol.
50:47-65[CrossRef].
|
| 15.
|
Link, A. J.,
D. Phillips, and G. M. Church.
1997.
Methods for generating precise deletions and insertions in the genome of wild-type Escherichia coli: application to open reading frame characterization.
J. Bacteriol.
179:6228-6237[Abstract/Free Full Text].
|
| 16.
|
Luttgen, H.,
F. Rohdich,
S. Herz,
J. Wungsintaweekul,
S. Hecht,
C. A. Schuhr,
M. Fellermeier,
S. Sagner,
M. H. Zenk,
A. Bacher, and W. Eisenreich.
2000.
Biosynthesis of terpenoids: YchB protein of Escherichia coli phosphorylates the 2-hydroxy group of 4-diphosphocytidyl-2C-methyl-D-erythritol.
Proc. Natl. Acad. Sci. USA
97:1052-1057.
|
| 17.
|
Mackie, G. A., and G. D. Parsons.
1982.
Identification of gene products from cloned fragments of the left arm of lambda dapB2.
Can J. Biochem.
60:338-346[Medline].
|
| 18.
|
Miller, K. W.,
J. Bouvier,
P. Stragier, and H. C. Wu.
1987.
Identification of the genes in the Escherichia coli ileS-lsp operon. Analysis of multiple polycistronic mRNAs made in vivo.
J. Biol. Chem.
262:7391-7397[Abstract/Free Full Text].
|
| 19.
|
Rodriguez-Concepcion, M.,
N. Campos,
L. Lois,
C. Maldonado,
J.-F. Hoeffler,
C. Grosdemange-Billiard,
M. Rohmer, and A. Boronat.
2000.
Genetic evidence of branching in the isoprenoid pathway for the production of isopentenyl diphosphate and dimethylallyl diphosphate in Escherichia coli.
FEBS Lett.
473:328-332[CrossRef][Medline].
|
| 20.
|
Rohdich, F.,
J. Wungsintaweekul,
M. Fellermeier,
S. Sagner,
S. Herz,
K. Kis,
W. Eisenreich,
A. Bacher, and M. H. Zenk.
1999.
Cytidine 5'-triphosphate-dependent biosynthesis of isoprenoids: YgbP protein of Escherichia coli catalyzes the formation of 4-diphosphocytidyl-2-C-methyl erythritol.
Proc. Natl. Acad. Sci. USA
96:11758-11763[Abstract/Free Full Text].
|
| 21.
|
Rost, B.
1998.
PHD: predicting one-dimensional protein structure by profile based neural networks.
Methods Enzymol.
266:525-539.
|
| 22.
|
Rudd, K. E.
1998.
Linkage map of Escherichia coli K-12, edition 10: the physical map.
Microbiol. Mol. Biol. Rev.
62:985-1019[Abstract/Free Full Text].
|
| 23.
|
Sherman, M. M.,
L. A. Petersen, and C. D. Poulter.
1989.
Isolation and characterization of isoprene mutants of Escherichia coli.
J. Bacteriol.
171:3619-3628[Abstract/Free Full Text].
|
| 24.
|
Yu, D.,
H. M. Ellis,
E. C. Lee,
N. A. Jenkins,
N. G. Copeland, and D. L. Court.
2000.
An efficient recombination system for chromosome engineering in Escherichia coli.
Proc. Natl. Acad. Sci. USA
97:5978-5983[Abstract/Free Full Text].
|
Journal of Bacteriology, December 2001, p. 7403-7407, Vol. 183, No. 24
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.24.7403-7407.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Alyahya, S. A., Alexander, R., Costa, T., Henriques, A. O., Emonet, T., Jacobs-Wagner, C.
(2009). From the Cover: RodZ, a component of the bacterial core morphogenic apparatus. Proc. Natl. Acad. Sci. USA
106: 1239-1244
[Abstract]
[Full Text]
-
Hsieh, M.-H., Goodman, H. M.
(2005). The Arabidopsis IspH Homolog Is Involved in the Plastid Nonmevalonate Pathway of Isoprenoid Biosynthesis. Plant Physiol.
138: 641-653
[Abstract]
[Full Text]
-
Page, J. E., Hause, G., Raschke, M., Gao, W., Schmidt, J., Zenk, M. H., Kutchan, T. M.
(2004). Functional Analysis of the Final Steps of the 1-Deoxy-D-xylulose 5-phosphate (DXP) Pathway to Isoprenoids in Plants Using Virus-Induced Gene Silencing. Plant Physiol.
134: 1401-1413
[Abstract]
[Full Text]
-
Testa, C. A., Cornish, R. M., Poulter, C. D.
(2004). The Sorbitol Phosphotransferase System Is Responsible for Transport of 2-C-Methyl-D-Erythritol into Salmonella enterica Serovar Typhimurium. J. Bacteriol.
186: 473-480
[Abstract]
[Full Text]
-
Rohdich, F., Hecht, S., Gartner, K., Adam, P., Krieger, C., Amslinger, S., Arigoni, D., Bacher, A., Eisenreich, W.
(2002). Studies on the nonmevalonate terpene biosynthetic pathway: Metabolic role of IspH (LytB) protein. Proc. Natl. Acad. Sci. USA
10.1073/pnas.032658999v1
[Abstract]
[Full Text]
-
Richard, S. B., Ferrer, J.-L., Bowman, M. E., Lillo, A. M., Tetzlaff, C. N., Cane, D. E., Noel, J. P.
(2002). Structure and Mechanism of 2-C-Methyl-D-erythritol 2,4-Cyclodiphosphate Synthase. AN ENZYME IN THE MEVALONATE-INDEPENDENT ISOPRENOID BIOSYNTHETIC PATHWAY. J. Biol. Chem.
277: 8667-8672
[Abstract]
[Full Text]
-
Rohdich, F., Hecht, S., Gartner, K., Adam, P., Krieger, C., Amslinger, S., Arigoni, D., Bacher, A., Eisenreich, W.
(2002). Studies on the nonmevalonate terpene biosynthetic pathway: Metabolic role of IspH (LytB) protein. Proc. Natl. Acad. Sci. USA
99: 1158-1163
[Abstract]
[Full Text]
Top
Abstract
Text
