Journal of Bacteriology, February 2001, p. 821-829, Vol. 183, No. 3
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.3.821-829.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
andDepartment of Microbiology, North Carolina State University, Raleigh, North Carolina 27695
Received 11 September 2000/Accepted 1 November 2000
| |
ABSTRACT |
|---|
|
|
|---|
A yeast glc7-1 mutant expressing a variant of protein phosphatase type 1 fails to accumulate glycogen. This defect is associated with hyperphosphorylated and inactive glycogen synthase, consistent with Glc7p acting directly to dephosphorylate and activate glycogen synthase. To characterize the glycogen synthesis defect of this mutant in more detail, we isolated 26 pseudorevertants of the glc7-1 mutant. All pseudoreversion events were due to missense mutations in GSY2, the gene encoding the major isoform of glycogen synthase. A majority of the mutations responsible for the suppression were in the 3' end of the gene, corresponding to the phosphorylated COOH terminus of Gsy2p. Phosphorylation of the mutant proteins was reduced, suggesting that they are poor substrates for glycogen synthase kinases. Suppressor mutations outside this domain did not decrease the phosphorylation of the resulting proteins, indicating that these proteins are immune to the regulatory effects of phosphorylation. Since no growth defect has been observed for strains with altered glycogen levels, the relative levels of fitness of GSY2 mutants that fail to accumulate glycogen and that hyperaccumulate glycogen were assayed by cocultivation experiments. A wild-type strain outcompeted both hypo- and hyperaccumulating strains, suggesting that glycogen levels contribute substantially to the fitness of yeast.
| |
INTRODUCTION |
|---|
|
|
|---|
The wide distribution of the storage carbohydrate glycogen in nature suggests that it plays important physiological roles. Indeed, genetic, biochemical, and physiological analyses of mammals indicate that glycogen metabolism plays an essential role in energy homeostasis. As one might expect, the synthesis and degradation of glycogen are regulated by multiple signaling pathways. Glycogen also accumulates in fungi; in the budding yeast Saccharomyces cerevisiae, where the pathway has been studied in detail, the metabolism of glycogen is remarkably similar to that in mammals. Most of the enzymatic components (glycogenin, glycogen synthase, phosphorylase, and branching enzyme) are conserved in yeast and mammals (5, 7, 8, 22, 31, 37), but the signaling pathways that regulate glycogen synthase have diverged. In mammals, glycogen metabolism is under hormonal control, whereas in yeast, it is controlled largely by nutrients. Yeast cells normally accumulate glycogen near the end of log-phase growth, due to a decrease in the levels of nutrients such as glucose, phosphate, nitrogen, and sulfate (23). This accumulation is due in part to the increased expression of genes whose products act in the pathway (15, 24, 25, 31) and in part to post translational regulatory mechanisms (10, 16, 21, 27, 30). At least for glucose, the accumulation of glycogen does not seem dependent on the absolute amount present; rather, glycogen accumulates when approximately half the glucose is consumed (23). Although many of the key regulators have been identified, the basic mechanism that controls this accumulation is unknown.
Glycogen synthase is regulated at the level of gene expression and by posttranscriptional mechanisms. mRNA levels for the major isoform of glycogen synthase (GSY2 mRNA) increase as cells approach stationary phase when grown in glucose-containing medium (15, 24, 25). Gsy2p is also phosphorylated and negatively regulated by phosphorylation at its COOH terminus (16). Glycogen synthase can be fully activated by glucose-6-phosphate (G6P), even in the fully phosphorylated state (26). Therefore, the ratio of glycogen synthase activities assayed in the absence and presence of G6P (activity ratio) provides a convenient means of assessing the phosphorylation state of the protein. Mammalian glycogen synthase is phosphorylated at its NH2 and COOH termini (28). In contrast, yeast glycogen synthase is phosphorylated only at its COOH terminus. A deletion variant of Gsy2p lacking amino acid residues after amino acid (aa) 643 has a very high activity ratio and is not phosphorylated in vivo (16). Other Gsy2p variants that contain alanine substitutions for Ser-650 (S650A), Ser-654 (S654A), or Thr-667 (T667A) also have high activity ratios, suggesting that these residues are the major sites of phosphorylation (16).
Biochemical characterization of glycogen synthase kinase in yeast has revealed at least two distinct activities (18), one of which is cyclin-dependent kinase Pho85p activity. Null mutations in the genes encoding the catalytic subunit, PHO85 (18, 38), or two of its many cyclin subunits, PCL8 and PCL10 (19), result in the hyperaccumulation of glycogen. Pho85p-Pcl10p can phosphorylate Gsy2p in vitro (19, 39). However, Gsy2p variants that lack Ser-654 and Thr-667 are no longer Pho85p-Pcl10p substrates, suggesting that Pho85p phosphorylates Gsy2p at these two sites while another, as-yet-unidentified kinase phosphorylates Gsy2p at Ser-650. Further evidence indicates that at least one other kinase is involved in down-regulating Gsy2p. Yang et al. (40) have recently found that a block to respiration inhibits glycogen accumulation by increasing the phosphorylation state of glycogen synthase. The activity ratio of glycogen synthase is very low in respiration-deficient mutants, and GSY2 mutants that lack any one of the three key phosphorylation sites (Ser-650, Ser-654, or Thr-667) accumulate glycogen in a respiration-deficient background. However, the loss of Pho85 kinase does not restore glycogen accumulation to respiration-deficient cells, indicating that another protein kinase is responsible for the effect.
On the reverse side of the regulatory pathway, protein phosphatase type 1 is responsible for dephosphorylating and activating glycogen synthase. Some mutations in GLC7, which encodes the catalytic subunit of protein phosphatase type 1, result in a failure to accumulate glycogen due to retention of glycogen synthase in the inactive, phosphorylated form (11, 27). The phosphatase directly responsible for activating glycogen synthase is thought to be composed of Glc7p and the regulatory subunit Gac1p. Gac1p binds to both Glc7p and glycogen synthase through separate domains and appears to act as a scaffold to target the substrate to the phosphatase (X. Wu, H. Hart, C. Cheng, P. J. Roach, and K. Tatchell, submitted for publication). The related protein Pig1p, first identified in a screen for glycogen synthase binding proteins, may have a role similar to that of Gac1p. The low levels of glycogen in a gac1 mutant are reduced further by deletion of PIG1 (4). The glycogen deficiency of glc7-1 or gac1 mutants can be suppressed either by elimination of the phosphorylation sites in Gsy2p (16) or by inactivation of Pho85p-Pcl8p and Pho85p-Pcl10p kinase (19), furthering the idea that the Glc7-Gac1p phosphatase reverses the phosphorylation and inactivation of Gsy2p by Pho85p-Pcl8p or Pho85p-Pcl10p.
To further the understanding of glycogen metabolism, we have isolated revertants of glc7-1 (glycogen defect) mutants. All mutants isolated in this screen are defective in the major isoform of glycogen synthase, Gsy2p, and all suppress the glc7-1 mutation by increasing the activity of glycogen synthase. The mutations in some suppressors are located in the region known to encode the phosphorylated COOH terminus. However, other mutants alter portions of the protein not previously known to have a regulatory role. In addition, we demonstrate for the first time the importance of glycogen accumulation by showing that levels of glycogen play an important role in overall fitness. Strains that accumulate too much or too little glycogen are rapidly outcompeted by wild-type strains.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Strains and media.
Crosses were performed and analyzed by
standard yeast genetic practices (14). Petite strains were
generated by treatment with ethidium bromide as described previously
(14). Hyperactive GSY2 mutants were crossed to
strains containing snf1, bcy1, or gac1
mutations (Table 1). The resultant
diploids were allowed to sporulate, and double mutants were identified
by tetrad analysis. Isolates were confirmed by backcrossing to the
parental strain and examining meiotic progeny from this cross. Strains
CV182 and CV218 were derived from a strain kindly provided by Peter
Roach (8) by three serial backcrosses to KT1113. All other
strains were derivatives of JC482 (3). Ethyl
methanesulfonate mutagenesis of strain KT1118 was performed as
described previously (14). Since spontaneous suppressors
were infrequent, cells were mutagenized to approximately 99% killing
and plated on either 1% yeast extract-2% peptone-2% dextrose
medium (YPD) or synthetic medium (2% glucose and 0.67% yeast nitrogen
base without amino acids, supplemented with required amino acids) at 30 °C for screening. All strains accumulated more glycogen on synthetic
medium, and all subsequent screens were performed with this medium.
Suppression of the glc7-1 glycogen defect was scored
qualitatively by inverting freshly grown plates over iodine crystals
for 30 to 60 s. Increased glycogen accumulation results in darker
brown staining. Putative suppressor mutants were backcrossed three
times to the parental strain (glc7-1) and retested for
glycogen accumulation. Mutants with suppressors that segregated in a
Mendelian fashion were then backcrossed three times to the wild-type
strain (KT1113). These suppressor mutants in the wild-type strain
background were crossed to a gsy2::HIS3 strain
(CV218), and suppressors were scored for linkage of the hyperaccumulation of glycogen to HIS3. All suppressors were
linked, indicating that the suppressors were located in or near
GSY2.
|
were performed with filter-sterilized media. Solid
media contained 2% agar. Strains were typically grown at 30°C.
Sporulation was performed on 1% yeast extract-2% peptone-2% potassium acetate medium (YPA) for 3 days at 24°C or longer if required. Although strains homozygous for glc7-1 will not
sporulate on traditional sporulation medium, it was found that
sufficient, although poor, sporulation could be achieved on YPA after 5 days.
Quantitative analysis. Glycogen assays were performed as described previously (9). Cell numbers were determined by direct counts with a hemacytometer. Glycogen synthase activity assays were performed as described previously (36). Yeast strains were inoculated at 2 × 106 cells per ml and grown at 30°C until late-log or early-stationary phase, approximately 12 h. Protein extracts were made as described below. Yeast extract (30 µl) was combined with 60 µl of synthase assay mixture (36) in duplicate and incubated for 10 min at 30°C. A 75-µl sample of the reaction mixture was spotted on Whatman 31 ET paper, which was immediately placed in 66% ethanol kept at 4°C. The paper samples were washed twice in cold ethanol, twice in ethanol at room temperature, and once in acetone; then, they were dried and placed into scintillation vials, and counts were determined. Background counts were determined by spotting 60 µl of assay mixture (no protein) on Whatman paper, which was then treated with experimental samples.
Plasmid construction and sequencing. Standard methods (32) were used for plasmid generation, identification, and amplification. Unless otherwise stated, all digestions and ligations were performed using enzymes obtained from New England Biolabs. pBluescript with a 3.8-kb SalI fragment containing GSY2 was kindly provided by Peter Roach (8). The 3.8-kb SalI fragment from this plasmid was subcloned into the SalI site of YEp351 (pCV58). pCV58 was digested with NdeI to excise a 2.8-kb fragment of GSY2 and religated to produce pCV59. This plasmid was digested with NdeI, and the resulting linearized plasmid was transformed into the suppressor strains to gap repair the mutant GSY2 genes. The gap-repaired plasmids were isolated from yeast (29), transformed into CV130, and assayed for the ability to suppress the glycogen accumulation defect of glc7-1. To localize the mutation responsible for suppression, pCV58 was digested with XhoI and KpnI (excision of a 1.7-kb fragment), KpnI and SacI (excision of a 0.7-kb fragment), or XhoI and SacI (excision of a 2.4-kb fragment); the restriction fragments containing portions of GSY2 were replaced with the same fragments from the suppressor-containing GSY2 genes. These plasmids were transformed into CV130 and assayed for glc7-1 suppression. Sequence analysis was performed using a Sequenase 2.0 kit (U.S. Biochemicals) to identify the mutation or mutations present in this region.
To construct a six-histidine-tagged wild-type GSY2 gene, two PCR products were generated. The first consisted of the GSY2 promoter, the ATG, and a sequence encoding a nine-amino acid tag (RGSHHHHHH) directly after the ATG and followed by an XmaI/EcoRI site at the 3' end (primers 5' GTCGACCTGCAGGTCAACGGATCACAAA 3' and 5' AAGTTTTGACTACCTCAGAGAAAAATTTTGATGAGAGGTTCGCATCATCATCATCATCATTTCCCGGGAATTCTG 3'). The other product consisted of the entire coding region of GSY2 with an XmaI site added at the 5' and 3' ends by PCR (primers 5' ATTTTCCCGGGGATGTCCCGTGACCTAC 3' and 5' TCCCCCGGGGGACGCCTCGAAATGTCGTATGTC 3'). These products were cloned into pBluescript (0.8-kb Sau3A/EcoRI promoter fragment into BamHI/EcoRI and 2.2-kb XmaI coding fragment into XmaI). The promoter fragment and part of the multicloning site of pBluescript were excised with EagI and XhoI and ligated into the EagI/XhoI sites of pRS316 (33). The 2.2-kb XmaI fragment containing the coding region was then ligated into this plasmid to create pCV116. The 2.6-kb EcoRI/SalI fragment of wild-type GSY2 and the gap-repaired mutants was then inserted into an EcoRI/XhoI fragment of pCV116, replacing all but 0.4 kb of the PCR-generated coding region to create plasmids pCV117 GSY2, pCV117 GSY2-G264R, and so forth, which were then transformed into CV218 (gsy2::HIS3).Protein extracts.
Yeast cells were inoculated into selective
minimal media and grown at 30°C with shaking until the cultures
reached late log phase. Cells (7.5 × 108) were
harvested, washed with breaking buffer (100 mM Tris, 200 mM NaCl, 1 mM
EDTA, 5% glycerol [pH 7.0]), and resuspended in 0.25 ml of cold
breaking buffer containing 1 mM phenylmethylsulfonyl fluoride and a
1/150 dilution of a protease inhibitor cocktail consisting of 5 mg each
of chymostatin, leupeptin, antipain, and pepstatin in 20 ml of 50%
ethanol. Cells were broken using a Mini-BeadBeater (Biospec Products)
(four repetitions at a setting of 50 for 20 s). Samples were
placed in an ice bath for a minimum of 1 min between repetitions.
Breaking buffer (0.25 ml) with protease inhibitors (see above) was
added to each sample, samples were centrifuged at 4°C for 2 min at
3,800 × g, and the supernatant was used immediately or
stored at
80°C.
Immunoblot analysis.
Protein concentrations of cell extracts
were determined using the bicinchoninic acid protein assay (Pierce)
with bovine serum albumin as a standard. Protein loading dye (0.6 M
Tris [pH 6.8], 10% glycerol, 2% sodium dodecyl sulfate [SDS], 5%
2-mercaptoethanol, 0.05% bromphenol blue) was added, and samples were
heated to 80°C for 4 min. Equal concentrations of total protein were
loaded in each well of an SDS-7.5% polyacrylamide gel, which was run
at 200 V for approximately 45 min. The gel was rinsed in transfer buffer (25 mM Tris, 192 mM glycine, 20% methanol) and transferred to
nitrocellulose for 1 h at 100 V using a Bio-Rad Mini Trans-Blot apparatus. The membrane was blocked for 2 h in 5% nonfat milk in
TBS (10 mM Tris-HCl [pH 7.5], 150 mM NaCl) and then incubated with a
1/1,000 dilution of primary antibody (RGS
His antibody; Qiagen) in
antibody binding solution (TBS with 1.5% bovine serum albumin and
1.5% nonfat milk) for 2 h. The membrane was washed twice with 20 mM Tris-HCl [pH 7.5]-500 mM NaCl-0.1% Tween 20- 0.4% Triton
X-100 and once with TBS, 10 min each wash. The membrane was incubated
with a 1/8,000 dilution of goat anti-mouse peroxidase-conjugated secondary antibody (Sigma) in antibody binding solution for 1 h
and then washed as described above. Detection was performed using an
Amersham ECL kit in accordance with the manufacturer's instructions.
Purification of His-tagged proteins. His-tagged proteins were purified with Ni-nitrilotriacetic acid (NTA)- agarose (Qiagen) using a batch procedure. Cell extracts were added to Ni-NTA-agarose beads, incubated at room temperature for 30 min, and then washed three times with buffer C (8 M urea, 0.1 M NaH2PO4, 0.01 M Tris [pH 6.3]). Purified protein was eluted with buffer C (pH 6.03) containing 100 mM EDTA. Immunoblotting was performed as described above, except that equal volumes of eluate rather than equal amounts of protein were loaded. As the amount of purified protein did not approach the binding capacity of the resin, the amount of purified protein in the eluate reflects the amount of the His-tagged protein in the cell extract.
32P labeling. Strains from fresh overnight cultures were inoculated at 2 × 106 cells/ml into 50 ml of selective medium. After 12 h of incubation at 140 rpm and 30°C, 109 cells were pelleted, washed with water, and resuspended in 10 ml of low-phosphate medium. Low-phosphate medium was prepared by combining 3.3 g of yeast nitrogen base without amino acids, 5 ml of 1 M MgSO4, and 5 ml of concentrated NH4OH in 450 ml of distilled H2O. Precipitated phosphate was allowed to settle, the resultant supernatant was filtered through a 0.22-µm- pore-size cellulose acetate filter, and the pH of the medium was adjusted to 5.8 with concentrated HCl. Appropriate amino acids were added to sustain growth. After 3 h of incubation, 0.1 mCi of 32P (as orthophosphate) was added. The culture was incubated for 1 h, at which point cells were harvested and broken as described above with the following exception: phosphatase inhibitors were added to the breaking buffer-protease inhibitor mixture. After cells were broken, purification was performed as described above and the purified protein was electrophoresed by SDS-polyacrylamide gel electrophoresis (PAGE). Protein was transferred to nitrocellulose as for the immunoblot protocol, and the blot was exposed to film overnight to detect 32P incorporation. Phosphorimaging was performed to quantitate radioactivity in the Gsy2p bands. To quantitate protein, the blot was incubated in 7 ml of phosphatase buffer (50 mM Tris-HCl [pH 8.0], 1 mM MgCl2, 0.1 mM ZnCl2) containing 70 U of alkaline phosphatase. This step removed 32P from the nitrocellulose and allowed detection by immunoblotting, which was performed as described above.
| |
RESULTS |
|---|
|
|
|---|
Isolation and genetic analysis of suppressors of glc7-1
mutants.
Strains containing glc7-1 (R73C) accumulate
only 10% of the glycogen levels found in wild-type strains
(2). Glycogen synthase from these strains is in the
phosphorylated, G6P-dependent form (11, 27). To further
dissect the regulatory pathway required for the activation of glycogen
synthase, we mutagenized a MATa glc7-1
strain (KT1118) with ethyl methanesulfonate as described in Materials
and Methods and screened 30,000 colonies for revertants that
accumulated glycogen by using the iodine staining method (6). Twenty-nine revertants were backcrossed three times
to a MAT
glc7-1 strain (KT1119), and
suppressors which did not mate or sporulate, which stained a
bluish-purplish color with iodine (indicating a defect typically found
in mutants with mutations in the glycogen branching enzyme) (31,
37), or which had phenotypes that did not segregate 2:2 in
meiotic progeny were discarded. Twenty-six of the 29 mutants survived
this preliminary screen and were characterized in greater detail.
Cloning and sequencing of suppressors.
Since the suppressors
resided in or near GSY2, the NdeI fragment of
GSY2, which encodes all but the final four amino acid residues of Gsy2p, was cloned by gap repair from each mutant as described in Materials and Methods. Plasmids were transformed into the
glc7-1 strain (CV129) to determine if the GSY2
gene recovered from the mutant strain would suppress the
glc7-1 phenotype. Transformants containing each of the
recovered GSY2 genes accumulated glycogen, indicating that
the mutation responsible for the suppression resided within the
NdeI fragment. Wild-type GSY2 in YEp351 is unable
to restore glycogen accumulation to the glc7-1 strain. To
more accurately localize the suppressor mutations, internal
XhoI/SacI, XhoI/KpnI, and
KpnI/SacI fragments of wild-type GSY2
in YEp351 (pCV58) were exchanged with the identical fragments from each
of the mutant plasmids (Fig. 1). The
presence of the suppressor in each of these subclones was identified by
assaying glycogen levels in CV129 transformants. The DNA sequence was
determined for each restriction fragment from the gap-repaired plasmids
that complemented the glc7-1 defect. The sequence was also
determined for the SacI/NdeI fragment from every
suppressor clone because we were unable to test for the presence of the
suppressor in this fragment.
|
|
Glycogen accumulation in suppressor strains.
To investigate
how the GSY2 mutations alter glycogen synthesis, we first
assayed glycogen levels throughout the growth curve of the wild type
and selected GSY2 mutants that were grown in batch culture.
Glycogen stores are normally low in exponential phase, begin to
increase as the cultures approach stationary phase, peak during
late-log/early-stationary phase, and drop after 12 h in stationary
phase. The three suppressors that we tested accumulated higher levels
of glycogen at each time point but showed basically the same overall
pattern of accumulation (Fig. 2). This
similarity is not unexpected because genes involved in glycogen
metabolism are known to be under transcriptional control (15,
25), which we would predict would not be altered in our
GSY2 mutants. We note that glycogen levels are very
sensitive to the method used to prepare the media (see Materials and
Methods). All subsequent data were gathered from cells grown in
filter-sterilized media.
|
µg of glucose per 107 cells). For a given GSY2 mutant, glycogen
levels were usually higher in a wild-type background than in
a glc7-1 background. The exceptions were
GSY2-P668L and GSY2-P688T mutants, whose
mutations caused the accumulation of the same levels in both
backgrounds. This result suggests that most mutant proteins are not
completely deregulated and require Glc7p to become fully active.
|
Effects of GSY2 mutations on regulatory mutations affecting glycogen accumulation. In addition to Pho85p, two additional protein kinases have been shown to regulate the activity of glycogen synthase. Snf1p, closely related to the mammalian AMP-dependent protein kinase, is a positive regulator of glycogen synthesis. snf1 mutants fail to accumulate glycogen, in part because of a defect in the accumulation of GSY2 mRNA and in part because of a defect in the activation of glycogen synthase (15). This latter defect may be due to reduced levels of G6P accumulating in snf1 mutants (20). In contrast, cyclic AMP (cAMP)-dependent protein kinase has a negative role in the regulation of glycogen synthase. Cells with constitutively active cAMP-dependent protein kinase activity, due to defects in the cAMP binding inhibitory subunit Bcy1p, express very low levels of GSY2 mRNA and may have an altered Gsy2p phosphorylation state (15).
As shown in Fig. 4, our GSY2 mutations were able to suppress the glycogen defect of snf1 mutants, with the exception of GSY2-S593F and G669D. Surprisingly, snf1 GSY2-G653L and snf1 GSY2-P668L mutants accumulated much higher levels of glycogen than any other mutant we tested. In contrast to the results for snf1 mutants, none of our GSY2 mutations was able to suppress the glycogen defect of bcy1 mutants (data not shown), consistent with previous work indicating that cAMP-dependent protein kinase acts on the glycogen biosynthetic pathway, largely at the level of mRNA synthesis (11, 15).
|
Abundance, phosphate incorporation, and activity of mutant Gsy2p
enzymes.
Although the overexpression of wild-type Gsy2p does not
raise glycogen levels in either a wild-type or a glc7-1
mutant background, we nevertheless assayed the levels of Gsy2 proteins
in our mutants to eliminate the possibility that protein abundance was
affecting the glycogen phenotype. To facilitate the assay of Gsy2
protein levels, the sequence encoding RSH6 was inserted
after the NH2-terminal methionine codon for efficient
protein purification and detection. The six-histidine-tagged genes were
cloned into a CEN plasmid that allowed expression from the native
GSY2 promoter, and plasmids containing six different
GSY2 mutations were transformed into a
gsy2::HIS3 strain (CV218) to assay for the ability
of the tagged genes to complement the gsy2::HIS3
disruption. Transformants containing six-histidine-tagged and untagged
GSY2 genes accumulated similar levels of glycogen,
indicating that the introduction of the six-histidine- tag at the
NH2 terminus does not reduce activity. Protein extracts were collected from late-log cultures, at the point at which glycogen levels were at a maximum. Six-histidine-tagged Gsy2 proteins were purified on Ni-NTA-agarose from equal amounts of total protein, separated by SDS-PAGE, transferred to nitrocellulose, and detected using an antibody against the six-histidine tag. As shown in Fig. 5A, mutant protein concentrations
were equal to or lower than wild-type protein levels.
Ni-NTA-purified protein levels were assessed because of the
relatively low level of enzyme in total extracts. However,
immunoblotting was performed using total extracts, and similar results
were obtained (data not shown). Thus, increased glycogen levels in the
mutants were not due to increased Gsy2p abundance.
|
|
Relative fitness of glycogen synthase mutants.
Although yeast
cells have evolved a complex mechanism for the regulation of glycogen
synthesis, little is known about the physiological role for this
storage carbohydrate. The elimination of both GSY1 and
GSY2 has been reported to have no effect on growth rate or
heat shock resistance and to confer only a slight defect in sporulation
(8). To provide a more sensitive assay for defects caused
by altered levels of glycogen, we cocultivated a wild-type strain with
either a gsy2::HIS3 mutant or a
GSY2-E590K mutant. These congenic strains had identical
nutritional requirements and showed no difference in exponential growth
rates when cultured separately (data not shown). In each cocultivation
experiment, the two strains were inoculated into fresh medium at a
concentration of 2 × 104 cells/mI, and cultures were
allowed to grow for 3 days before reinoculation into fresh medium.
After 3 days, samples were diluted with fresh medium to a concentration
of 2 × 104 cells/ml and incubated for an additional 3 days. This regimen was repeated twice. After each 3-day period, the
ratio of the numbers of cells of the strains in the culture was
determined using glycogen accumulation to score the two genotypes. As
shown in Fig. 6A, after 12 days of growth
in glucose-containing medium, greater than 95% of the cells in both
cultures were wild type. In acetate-containing medium,
gsy2::HIS3 and GSY2-E590K strains were
also less fit than the wild type, although the
gsy2::HIS3 strain showed higher fitness in
acetate-containing medium than in glucose-containing medium.
|
| |
DISCUSSION |
|---|
|
|
|---|
In a screen for revertants that restored glycogen accumulation to a glc7-1 strain, we identified 12 unique mutations in GSY2. All 12 probably act by altering the activity of glycogen synthase, because none of the GSY2 mutants tested showed an increase in protein levels, as assayed by immunoblot analysis. In addition, overexpression of the wild-type GSY2 gene does not suppress the glc7-1 phenotype, indicating that the concentration of glycogen synthase in the cell is not normally rate limiting for glycogen biosynthesis. Although there is no direct biochemical evidence in vitro that Glc7p is the phosphatase that activates glycogen synthase, the results presented here strengthen this hypothesis. It is surprising that no other genes were identified in our screen because mutations in REG1 (17) and PHO85 (18, 38) have also been shown to suppress the glc7-1 mutation. However, the exclusion of slowly growing colonies from our screen would have eliminated reg1 and pho85, since both show a slow-growth phenotype unrelated to their high level of glycogen accumulation.
We envision three mechanisms by which our mutations in GSY2 could suppress the glc7-1 phenotype. One possibility is that the mutant proteins are resistant to negative regulation by phosphorylation, either directly due to reduced phosphorylation or indirectly due to changes in allosteric effects of phosphorylation on activity. Another possibility is that mutants could be more sensitive to positive regulation, either by becoming better substrates for phosphatase activity or by becoming more sensitive to the activating effect of G6P. A third possibility is that the suppressors act by increasing the activity of the encoded enzyme without changing its regulation. Six out of 12 GSY2 mutations identified in this screen probably act via the first mechanism. These are located at or near the proposed phosphorylation sites (Fig. 1B). One of the six directly alters phosphorylation site Ser-654, while the others alter residues one or two residues away from the phosphorylation sites.
Pho85p, together with its cyclin subunits Pcl8p and Pcl10p, comprises one of the kinases that phosphorylates Gsy2p at S654 and T667 (19, 39). The precise consensus site has not been determined for this activity, but the consensus sequence around these two sites is S/T-P-X-D-L. Two GSY2 mutations, GSY2-P668T and GSY2P688L, altered one of these prolines, supporting the above consensus recognition motif. The fact that GSY2-G669D also suppressed glc7-1 could indicate that the identity of the amino acid residue after the proline is also restricted for Pho85p-Pcl10p recognition.
The kinase responsible for phosphorylating S650 is not known, but the
fact that GSY2-P648L suppresses glc7-1 leads to
the prediction that the consensus recognition motif for this kinase contains a proline at the
2 position. It is worth noting that a
proline is present at the
2 position in the sequence recognition motif for the mitogen-activated protein (MAP) kinase Erk1 (13, 34). François et al. (9) found that glycogen
synthesis was inhibited by the mating pathway, a signaling pathway
regulated by the MAP kinase Fus3p. However, to our knowledge there is
no direct evidence that Fus3p can phosphorylate Gsy2p. We do not believe that the other six suppressor mutations alter the
phosphorylation state of Gsy2p, but several of them could cause
insensitivity to the effects of phosphorylation. These mutant proteins
were phosphorylated to a greater extent than the wild-type protein, as
judged by the relative levels of 32P incorporation in vivo.
A detailed biochemical characterization of 22 mutations of GSY2 revealed two mutants that were totally resistant to activation by G6P (26). One of these, Gsy2-R586A R588A R591A, had wild-type activity and was inactivated by phosphorylation. Another, Gsy2-R579A R580A R582A, showed reduced sensitivity to phosphorylation. Pederson et al. (26) proposed that these residues constitute a region of glycogen synthase that is important for G6P binding and/or changes between different activity states. It is noteworthy that two of our mutants, GSY2-E590K and GSY2-S593F, had mutations that lay in or near this region. Gsy2-E590K had the highest activity in the presence or absence of G6P, suggesting that this mutant might also be insensitive to the influence of G6P and C-terminal phosphorylation. A detailed biochemical characterization of these mutants would help distinguish between different possible mechanisms of suppression.
In both yeast and mammals, glycogen biosynthesis is under complex regulation. In mammals, where glycogen serves as a key energy store and for maintenance of blood glucose levels, the reasons for this regulation are obvious. In yeast, the accumulation of glycogen at the end of logarithmic growth would implicate the carbohydrate as having a role in survival in stationary phase or sporulation. However, glycogen synthase mutants sporulate well, have no growth defect, and survive heat shock stress (8). We revisited this issue using a cocultivation strategy, where wild-type and mutant strains with identical auxotrophies were cultured together in medium containing either glucose or acetate as a carbon source. Under both conditions, strains with low (gsy2::HIS3) and high (GSY2-E590K) levels of glycogen were rapidly overgrown by the wild-type strain (Fig. 6). This result provides a solid indication that glycogen levels must be tightly regulated, since as little as a 2-fold increase or a 10-fold decrease in glycogen is enough to dramatically reduce fitness levels. Although we do not know at present the physiological defects responsible for the reduced fitness of the GSY2 mutants, we have observed reduced viability of both gsy2::HIS3 and GSY2-E590K strains, a result which could account for the differences in fitness. Our results provide a means to study the basis for the requirement for the tightly regulated control of glycogen accumulation.
| |
ACKNOWLEDGMENTS |
|---|
We thank Lucy Robinson for comments on the manuscript and Peter Roach for strains, plasmids, and communication of results prior to publication.
This work was supported by National Institutes of Health grant GM-477899 and a predoctoral NSF fellowship to C.A.
| |
FOOTNOTES |
|---|
* Corresponding author. Present address: Department of Biochemistry and Molecular Biology, Louisiana State University Health Sciences Center, 1501 Kings Highway, Shreveport, LA 71130. Phone: (318) 675-7769. Fax: (318) 675-5180. E-mail: ktatch{at}lsuhsc.edu.
Present address: Department of Developmental Cell and Molecular
Biology, Duke University, Durham, NC 27708.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Cannon, J. F.,
R. Gitan, and K. Tatchell.
1990.
Yeast cAMP-dependent protein kinase regulatory subunit mutations display a variety of phenotypes.
J. Biol. Chem.
265:11897-11904 |
| 2. | Cannon, J. F., J. R. Pringle, A. Fiechter, and M. Khalil. 1994. Characterization of glycogen-deficient glc mutants of Saccharomyces cerevisiae. Genetics 136:485-503[Abstract]. |
| 3. |
Cannon, J. F., and K. Tatchell.
1987.
Characterization of Saccharomyces cerevisiae genes encoding subunits of cyclic AMP-dependent protein kinase.
Mol. Cell. Biol.
7:2653-2663 |
| 4. | Cheng, C., D. Huang, and P. J. Roach. 1997. Yeast PIG genes: PIG1 encodes a putative type 1 phosphatase subunit that interacts with the yeast glycogen synthase Gsy2p. Yeast 13:1-8[CrossRef][Medline]. |
| 5. | Cheng, C., J. Mu, I. Farkas, D. Huang, M. G. Goebl, and P. J. Roach. 1995. Requirement of the self-glucosylating initiator proteins Glg1p and Glg2p for glycogen accumulation in Saccharomyces cerevisiae. Mol. Cell. Biol. 15:6632-6640[Abstract]. |
| 6. | Chester, V. E. 1968. Heritable glycogen-storage deficiency in yeast and its induction by ultra-violet light. J. Gen. Microbiol. 51:49-56[Medline]. |
| 7. |
Farkas, I.,
T. A. Hardy,
A. A. DePaoli-Roach, and P. J. Roach.
1990.
Isolation of the GSY1 gene encoding yeast glycogen synthase and evidence for the existence of a second gene.
J. Biol. Chem.
265:20879-20886 |
| 8. |
Farkas, I.,
T. A. Hardy,
M. G. Goebl, and P. J. Roach.
1991.
Two glycogen synthase isoforms in Saccharomyces cerevisiae are coded by distinct genes that are differentially controlled.
J. Biol. Chem.
266:15602-15607 |
| 9. |
François, J.,
D. L. Higgins,
F. Chang, and K. Tatchell.
1991.
Inhibition of glycogen synthesis in Saccharomyces cerevisiae by the mating pheromone -factor.
J. Biol. Chem.
266:6174-6180 |
| 10. | François, J., M. E. Villanueva, and H.-G. Hers. 1988. The control of glycogen metabolism in yeast. 1. Interconversion in vivo of glycogen synthase and glycogen phosphorylase induced by glucose, a nitrogen source, or uncouplers. Eur. J. Biochem. 174:551-559[Medline]. |
| 11. | François, J. M., S. Thompson-Jaeger, J. Skroch, U. Zellenka, W. Spevak, and K. Tatchell. 1992. GAC1 may encode a regulatory subunit for protein phosphatase type 1 in Saccharomyces cerevisiae. EMBO J. 11:87-96[Medline]. |
| 12. | Frederick, D. L., and K. Tatchell. 1996. The REG2 gene of Saccharomyces cerevisiae encodes a type 1 protein phosphatase-binding protein that functions with Reg1p and the Snf1p protein kinase to regulate growth. Mol. Cell. Biol. 16:2922-2931[Abstract]. |
| 13. |
Gonzalez, F. A.,
D. L. Raden, and R. J. Davis.
1991.
Identification of substrate recognition determinants for human ERK1 and ERK2 protein kinases.
J. Biol. Chem.
266:22159-22163 |
| 14. | Guthrie, C., and G. R. Fink (ed.). 1991. Methods in enzymology, vol. 194. Guide to yeast genetics and molecular biology. Academic Press, Inc., San Diego, Calif. |
| 15. |
Hardy, T. A.,
D. Huang, and P. J. Roach.
1994.
Interactions between cAMP-dependent and SNF1 protein kinases in the control of glycogen accumulation in Saccharomyces cerevisiae.
J. Biol. Chem.
269:27907-27913 |
| 16. |
Hardy, T. A., and P. J. Roach.
1993.
Control of yeast glycogen synthase-2 by COOH-terminal phosphorylation.
J. Biol. Chem.
268:23799-23805 |
| 17. | Huang, D., K. T. Chun, M. G. Goebl, and P. J. Roach. 1996. Genetic interactions between REG1/HEX2 and GLC7, the gene encoding the protein phosphatase type 1 catalytic subunit in Saccharomyces cerevisiae. Genetics 143:119-127[Abstract]. |
| 18. | Huang, D., I. Farkas, and P. J. Roach. 1996. Pho85p, a cyclin-dependent protein kinase, and the Snf1p protein kinase act antagonistically to control glycogen accumulation in Saccharomyces cerevisiae. Mol. Cell. Biol. 16:4357-4365[Abstract]. |
| 19. |
Huang, D.,
J. Moffat,
W. A. Wilson,
L. Moore,
C. Cheng,
P. J. Roach, and B. Andrews.
1998.
Cyclin partners determine Pho85 protein kinase substrate specificity in vitro and in vivo: control of glycogen biosynthesis by Pcl8 and Pcl10.
Mol. Cell. Biol.
18:3289-3299 |
| 20. |
Huang, D.,
W. A. Wilson, and P. J. Roach.
1997.
Glucose-6-P control of glycogen synthase phosphorylation in yeast.
J. Biol. Chem.
272:22495-22501 |
| 21. |
Huang, K. P., and E. Cabib.
1974.
Yeast glycogen synthetase in the glucose 6-phosphate-dependent form.
J. Biol. Chem.
249:3851-3857 |
| 22. |
Hwang, P. K.,
S. Tugendriech, and R. J. Fletterick.
1989.
Molecular analysis of GPH1, the gene encoding glycogen phosphorylase in Saccharomyces cerevisiae.
Mol. Cell. Biol.
9:1659-1666 |
| 23. |
Lillie, S. H., and J. R. Pringle.
1980.
Reserve carbohydrate metabolism in Saccharomyces cerevisiae: responses to nutrient limitation.
J. Bacteriol.
143:1384-1394 |
| 24. | Ni, H. T., and D. C. LaPorte. 1995. Response of a yeast glycogen synthase gene to stress. Mol. Microbiol. 16:1197-1205[CrossRef][Medline]. |
| 25. | Parrou, J. L., M. A. Teste, and J. Francois. 1997. Effects of various types of stress on the metabolism of reserve carbohydrates in Saccharomyces cerevisiae: genetic evidence for a stress-induced recycling of glycogen and trehalose. Microbiology 143:1891-1900[Abstract]. |
| 26. |
Pederson, B. A.,
C. Cheng,
W. A. Wilson, and P. J. Roach.
2000.
Regulation of glycogen synthase: identification of residues involved in regulation by the allosteric ligand glucose-6-P and by phosphorylation.
J. Biol. Chem.
275:27753-27761 |
| 27. |
Peng, Z.-Y.,
R. J. Trumbly, and E. M. Reimann.
1990.
Purification and characterization of glycogen synthase from a glycogen-deficient strain of Saccharomyces cerevisiae.
J. Biol. Chem.
265:13871-13877 |
| 28. | Roach, P. J. 1990. Control of glycogen synthase by hierarchal protein phosphorylation. FASEB J. 4:2961-2968[Abstract]. |
| 29. | Rose, M. D., F. Winston, and P. Hieter. 1990. Methods in yeast genetics. A laboratory course manual. Cold Spring Harbor Laboratory Press, Plainview, N.Y. |
| 30. |
Rothman-Denes, L., and E. Cabib.
1970.
Two forms of yeast glycogen synthetase and their role in glycogen accumulation.
Proc. Natl. Acad. Sci. USA
66:967-974 |
| 31. |
Rowen, D. W.,
M. Meinke, and D. C. LaPorte.
1992.
GLC3 and GHA1 of Saccharomyces cerevisiae are allelic and encode the glycogen branching enzyme.
Mol. Cell. Biol.
12:22-29 |
| 32. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 33. |
Sikorksi, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27 |
| 34. | Songyang, Z., K. P. Lu, Y. T. Kwon, L. H. Tsai, O. Filhol, C. Cochet, D. A. Brickey, T. R. Soderling, C. Bartleson, D. J. Graves, A. J. DeMaggio, M. F. Hoekstra, J. Blenis, T. Hunter, and L. C. Cantley. 1996. A structural basis for substrate specificities of protein Ser/Thr kinases: primary sequence preference of casein kinases I and II, NIMA, phosphorylase kinase, calmodulin-dependent kinase II, CDK5, and Erk1. Mol. Cell. Biol. 16:6486-6493[Abstract]. |
| 35. |
Stuart, J. S.,
D. L. Frederick,
C. M. Varner, and K. Tatchell.
1994.
The mutant type 1 protein phosphatase encoded by glc7-1 from Saccharomyces cerevisiae fails to interact productively with the GAC1-encoded regulatory subunit.
Mol. Cell. Biol.
14:896-905 |
| 36. | Thomas, J. A., K. K. Schlender, and J. Larner. 1968. A rapid filter paper assay for UDPglucose-glycogen glucosyltransferase, including an improved biosynthesis of UDP-14C-glucose. Anal. Biochem. 25:486-499[CrossRef][Medline]. |
| 37. |
Thon, V. J.,
C. Vigneron-Lesens,
T. Marianne-Pepin,
J. Montreuil,
A. Decq,
C. Rachez,
S. G. Ball, and J. F. Cannon.
1992.
Coordinate regulation of glycogen metabolism in the yeast Saccharomyces cerevisiae.
J. Biol. Chem.
267:15224-15228 |
| 38. | Timblin, B. K., K. Tatchell, and L. W. Bergman. 1996. Deletion of the gene encoding the cyclin-dependent protein kinase PHO85 alters glycogen metabolism in Saccharomyces cerevisiae. Genetics 143:57-66[Abstract]. |
| 39. |
Wilson, W. A.,
A. M. Mahrenholz, and P. J. Roach.
1999.
Substrate targeting of the yeast cyclin-dependent kinase Pho85p by the cyclin Pcl10p.
Mol. Cell. Biol.
19:7020-7030 |
| 40. |
Yang, R.,
K. T. Chun, and R. C. Wek.
1998.
Mitochondrial respiratory mutants in yeast inhibit glycogen accumulation by blocking activation of glycogen synthase.
J. Biol. Chem.
273:31337-31344 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Appl. Environ. Microbiol. | Infect. Immun. | Eukaryot. Cell |
|---|---|---|
| Mol. Cell. Biol. | J. Virol. | Microbiol. Mol. Biol. Rev. |
| ALL ASM JOURNALS |