Previous Article | Next Article 
Journal of Bacteriology, February 2001, p. 821-829, Vol. 183, No. 3
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.3.821-829.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Hyperactive Glycogen Synthase Mutants of
Saccharomyces cerevisiae Suppress the glc7-1
Protein Phosphatase Mutant
Catherine
Anderson
and
Kelly
Tatchell*
Department of Microbiology, North Carolina
State University, Raleigh, North Carolina 27695
Received 11 September 2000/Accepted 1 November 2000
 |
ABSTRACT |
A yeast glc7-1 mutant expressing a variant of protein
phosphatase type 1 fails to accumulate glycogen. This defect is
associated with hyperphosphorylated and inactive glycogen synthase,
consistent with Glc7p acting directly to dephosphorylate and activate
glycogen synthase. To characterize the glycogen synthesis defect of
this mutant in more detail, we isolated 26 pseudorevertants of the glc7-1 mutant. All pseudoreversion events were due to
missense mutations in GSY2, the gene encoding the major
isoform of glycogen synthase. A majority of the mutations responsible
for the suppression were in the 3' end of the gene, corresponding to
the phosphorylated COOH terminus of Gsy2p. Phosphorylation of the
mutant proteins was reduced, suggesting that they are poor substrates
for glycogen synthase kinases. Suppressor mutations outside this domain
did not decrease the phosphorylation of the resulting proteins,
indicating that these proteins are immune to the regulatory effects of
phosphorylation. Since no growth defect has been observed for strains
with altered glycogen levels, the relative levels of fitness of
GSY2 mutants that fail to accumulate glycogen and that
hyperaccumulate glycogen were assayed by cocultivation experiments. A
wild-type strain outcompeted both hypo- and hyperaccumulating strains,
suggesting that glycogen levels contribute substantially to the fitness
of yeast.
 |
INTRODUCTION |
The wide distribution of the storage
carbohydrate glycogen in nature suggests that it plays important
physiological roles. Indeed, genetic, biochemical, and physiological
analyses of mammals indicate that glycogen metabolism plays an
essential role in energy homeostasis. As one might expect, the
synthesis and degradation of glycogen are regulated by multiple
signaling pathways. Glycogen also accumulates in fungi; in the budding
yeast Saccharomyces cerevisiae, where the pathway has been
studied in detail, the metabolism of glycogen is remarkably similar to
that in mammals. Most of the enzymatic components (glycogenin, glycogen
synthase, phosphorylase, and branching enzyme) are conserved in yeast
and mammals (5, 7, 8, 22, 31, 37), but the signaling pathways that regulate glycogen synthase have diverged. In mammals, glycogen metabolism is under hormonal control, whereas in yeast, it is
controlled largely by nutrients. Yeast cells normally accumulate glycogen near the end of log-phase growth, due to a decrease in the
levels of nutrients such as glucose, phosphate, nitrogen, and sulfate
(23). This accumulation is due in part to the increased expression of genes whose products act in the pathway (15, 24, 25, 31) and in part to post translational regulatory mechanisms (10, 16, 21, 27, 30). At least for glucose, the
accumulation of glycogen does not seem dependent on the absolute amount
present; rather, glycogen accumulates when approximately half the
glucose is consumed (23). Although many of the key
regulators have been identified, the basic mechanism that controls this
accumulation is unknown.
Glycogen synthase is regulated at the level of gene expression and by
posttranscriptional mechanisms. mRNA levels for the major isoform of
glycogen synthase (GSY2 mRNA) increase as cells approach
stationary phase when grown in glucose-containing medium (15, 24,
25). Gsy2p is also phosphorylated and negatively regulated by
phosphorylation at its COOH terminus (16). Glycogen synthase can be fully activated by glucose-6-phosphate (G6P), even in
the fully phosphorylated state (26). Therefore, the ratio
of glycogen synthase activities assayed in the absence and presence of
G6P (activity ratio) provides a convenient means of assessing the
phosphorylation state of the protein. Mammalian glycogen synthase is
phosphorylated at its NH2 and COOH termini (28). In contrast, yeast glycogen synthase is
phosphorylated only at its COOH terminus. A deletion variant of Gsy2p
lacking amino acid residues after amino acid (aa) 643 has a very high activity ratio and is not phosphorylated in vivo (16).
Other Gsy2p variants that contain alanine substitutions for Ser-650 (S650A), Ser-654 (S654A), or Thr-667 (T667A) also have high activity ratios, suggesting that these residues are the major sites of phosphorylation (16).
Biochemical characterization of glycogen synthase kinase in yeast has
revealed at least two distinct activities (18), one of
which is cyclin-dependent kinase Pho85p activity. Null mutations in the
genes encoding the catalytic subunit, PHO85 (18,
38), or two of its many cyclin subunits, PCL8 and
PCL10 (19), result in the hyperaccumulation of
glycogen. Pho85p-Pcl10p can phosphorylate Gsy2p in vitro (19,
39). However, Gsy2p variants that lack Ser-654 and Thr-667 are
no longer Pho85p-Pcl10p substrates, suggesting that Pho85p
phosphorylates Gsy2p at these two sites while another, as-yet-unidentified kinase phosphorylates Gsy2p at Ser-650. Further evidence indicates that at least one other kinase is involved in
down-regulating Gsy2p. Yang et al. (40) have recently
found that a block to respiration inhibits glycogen accumulation by increasing the phosphorylation state of glycogen synthase. The activity
ratio of glycogen synthase is very low in respiration-deficient mutants, and GSY2 mutants that lack any one of the three key
phosphorylation sites (Ser-650, Ser-654, or Thr-667) accumulate
glycogen in a respiration-deficient background. However, the loss of
Pho85 kinase does not restore glycogen accumulation to
respiration-deficient cells, indicating that another protein kinase is
responsible for the effect.
On the reverse side of the regulatory pathway, protein phosphatase type
1 is responsible for dephosphorylating and activating glycogen
synthase. Some mutations in GLC7, which encodes the
catalytic subunit of protein phosphatase type 1, result in a failure to accumulate glycogen due to retention of glycogen synthase in the inactive, phosphorylated form (11, 27). The phosphatase
directly responsible for activating glycogen synthase is thought to be composed of Glc7p and the regulatory subunit Gac1p. Gac1p binds to both
Glc7p and glycogen synthase through separate domains and appears to act
as a scaffold to target the substrate to the phosphatase (X. Wu, H. Hart, C. Cheng, P. J. Roach, and K. Tatchell, submitted for
publication). The related protein Pig1p, first identified in a screen
for glycogen synthase binding proteins, may have a role similar to that
of Gac1p. The low levels of glycogen in a gac1 mutant are
reduced further by deletion of PIG1 (4). The glycogen deficiency of glc7-1 or gac1 mutants can
be suppressed either by elimination of the phosphorylation sites in
Gsy2p (16) or by inactivation of Pho85p-Pcl8p and
Pho85p-Pcl10p kinase (19), furthering the idea that the
Glc7-Gac1p phosphatase reverses the phosphorylation and inactivation of
Gsy2p by Pho85p-Pcl8p or Pho85p-Pcl10p.
To further the understanding of glycogen metabolism, we have isolated
revertants of glc7-1 (glycogen defect) mutants. All mutants
isolated in this screen are defective in the major isoform of glycogen
synthase, Gsy2p, and all suppress the glc7-1 mutation by
increasing the activity of glycogen synthase. The mutations in some
suppressors are located in the region known to encode the
phosphorylated COOH terminus. However, other mutants alter portions of
the protein not previously known to have a regulatory role. In
addition, we demonstrate for the first time the importance of glycogen
accumulation by showing that levels of glycogen play an important role
in overall fitness. Strains that accumulate too much or too little
glycogen are rapidly outcompeted by wild-type strains.
 |
MATERIALS AND METHODS |
Strains and media.
Crosses were performed and analyzed by
standard yeast genetic practices (14). Petite strains were
generated by treatment with ethidium bromide as described previously
(14). Hyperactive GSY2 mutants were crossed to
strains containing snf1, bcy1, or gac1
mutations (Table 1). The resultant
diploids were allowed to sporulate, and double mutants were identified
by tetrad analysis. Isolates were confirmed by backcrossing to the
parental strain and examining meiotic progeny from this cross. Strains
CV182 and CV218 were derived from a strain kindly provided by Peter
Roach (8) by three serial backcrosses to KT1113. All other
strains were derivatives of JC482 (3). Ethyl
methanesulfonate mutagenesis of strain KT1118 was performed as
described previously (14). Since spontaneous suppressors
were infrequent, cells were mutagenized to approximately 99% killing
and plated on either 1% yeast extract-2% peptone-2% dextrose
medium (YPD) or synthetic medium (2% glucose and 0.67% yeast nitrogen
base without amino acids, supplemented with required amino acids) at 30 °C for screening. All strains accumulated more glycogen on synthetic
medium, and all subsequent screens were performed with this medium.
Suppression of the glc7-1 glycogen defect was scored
qualitatively by inverting freshly grown plates over iodine crystals
for 30 to 60 s. Increased glycogen accumulation results in darker
brown staining. Putative suppressor mutants were backcrossed three
times to the parental strain (glc7-1) and retested for
glycogen accumulation. Mutants with suppressors that segregated in a
Mendelian fashion were then backcrossed three times to the wild-type
strain (KT1113). These suppressor mutants in the wild-type strain
background were crossed to a gsy2::HIS3 strain
(CV218), and suppressors were scored for linkage of the hyperaccumulation of glycogen to HIS3. All suppressors were
linked, indicating that the suppressors were located in or near
GSY2.
Reduction of glucose and/or other medium constituents due to
autoclaving resulted in a significant increase in glycogen
accumulation.
For this reason, assays to compare the effects of
GLC7,
glc7-1,
gac1,
snf1,
and
rho
were performed with filter-sterilized media.
Solid
media contained 2% agar. Strains were typically grown at
30°C.
Sporulation was performed on 1% yeast extract-2% peptone-2%
potassium acetate medium (YPA) for 3 days at 24°C or longer if
required. Although strains homozygous for
glc7-1 will not
sporulate
on traditional sporulation medium, it was found that
sufficient,
although poor, sporulation could be achieved on YPA after 5
days.
Quantitative analysis.
Glycogen assays were performed as
described previously (9). Cell numbers were determined by
direct counts with a hemacytometer. Glycogen synthase activity assays
were performed as described previously (36). Yeast strains
were inoculated at 2 × 106 cells per ml and grown at
30°C until late-log or early-stationary phase, approximately 12 h. Protein extracts were made as described below. Yeast extract (30 µl) was combined with 60 µl of synthase assay mixture
(36) in duplicate and incubated for 10 min at 30°C. A
75-µl sample of the reaction mixture was spotted on Whatman 31 ET
paper, which was immediately placed in 66% ethanol kept at 4°C. The
paper samples were washed twice in cold ethanol, twice in ethanol at
room temperature, and once in acetone; then, they were dried and placed
into scintillation vials, and counts were determined. Background counts
were determined by spotting 60 µl of assay mixture (no protein) on
Whatman paper, which was then treated with experimental samples.
Plasmid construction and sequencing.
Standard methods
(32) were used for plasmid generation, identification, and
amplification. Unless otherwise stated, all digestions and ligations
were performed using enzymes obtained from New England Biolabs.
pBluescript with a 3.8-kb SalI fragment containing
GSY2 was kindly provided by Peter Roach (8).
The 3.8-kb SalI fragment from this plasmid was subcloned
into the SalI site of YEp351 (pCV58). pCV58 was digested
with NdeI to excise a 2.8-kb fragment of GSY2 and
religated to produce pCV59. This plasmid was digested with
NdeI, and the resulting linearized plasmid was transformed
into the suppressor strains to gap repair the mutant GSY2
genes. The gap-repaired plasmids were isolated from yeast
(29), transformed into CV130, and assayed for the ability to suppress the glycogen accumulation defect of glc7-1. To
localize the mutation responsible for suppression, pCV58 was digested
with XhoI and KpnI (excision of a 1.7-kb
fragment), KpnI and SacI (excision of a 0.7-kb
fragment), or XhoI and SacI (excision of a 2.4-kb fragment); the restriction fragments containing portions of
GSY2 were replaced with the same fragments from the
suppressor-containing GSY2 genes. These plasmids were
transformed into CV130 and assayed for glc7-1 suppression.
Sequence analysis was performed using a Sequenase 2.0 kit (U.S.
Biochemicals) to identify the mutation or mutations present in this region.
To construct a six-histidine-tagged wild-type
GSY2 gene, two
PCR products were generated. The first consisted of the
GSY2 promoter, the ATG, and a sequence encoding a nine-amino acid tag
(RGSHHHHHH) directly after the ATG and followed by an
XmaI/
EcoRI
site at the 3' end (primers 5'
GTCGACCTGCAGGTCAACGGATCACAAA 3'
and 5'
AAGTTTTGACTACCTCAGAGAAAAATTTTGATGAGAGGTTCGCATCATCATCATCATCATTTCCCGGGAATTCTG
3'). The other product consisted of the entire coding region of
GSY2 with an
XmaI site added at the 5' and 3'
ends by PCR (primers
5' ATTTTCCCGGGGATGTCCCGTGACCTAC 3' and
5' TCCCCCGGGGGACGCCTCGAAATGTCGTATGTC
3'). These products
were cloned into pBluescript (0.8-kb
Sau3A/
EcoRI
promoter fragment into
BamHI/
EcoRI and 2.2-kb
XmaI coding fragment
into
XmaI). The promoter
fragment and part of the multicloning
site of pBluescript were excised
with
EagI and
XhoI and ligated
into the
EagI/
XhoI sites of pRS316 (
33). The
2.2-kb
XmaI fragment
containing the coding region was then
ligated into this plasmid
to create pCV116. The 2.6-kb
EcoRI/
SalI fragment of wild-type
GSY2
and the gap-repaired mutants was then inserted into an
EcoRI/
XhoI
fragment of pCV116, replacing all but
0.4 kb of the PCR-generated
coding region to create plasmids pCV117
GSY2, pCV117 GSY2-G264R,
and so forth, which were then
transformed into CV218 (
gsy2::HIS3).
Protein extracts.
Yeast cells were inoculated into selective
minimal media and grown at 30°C with shaking until the cultures
reached late log phase. Cells (7.5 × 108) were
harvested, washed with breaking buffer (100 mM Tris, 200 mM NaCl, 1 mM
EDTA, 5% glycerol [pH 7.0]), and resuspended in 0.25 ml of cold
breaking buffer containing 1 mM phenylmethylsulfonyl fluoride and a
1/150 dilution of a protease inhibitor cocktail consisting of 5 mg each
of chymostatin, leupeptin, antipain, and pepstatin in 20 ml of 50%
ethanol. Cells were broken using a Mini-BeadBeater (Biospec Products)
(four repetitions at a setting of 50 for 20 s). Samples were
placed in an ice bath for a minimum of 1 min between repetitions.
Breaking buffer (0.25 ml) with protease inhibitors (see above) was
added to each sample, samples were centrifuged at 4°C for 2 min at
3,800 × g, and the supernatant was used immediately or
stored at
80°C.
Immunoblot analysis.
Protein concentrations of cell extracts
were determined using the bicinchoninic acid protein assay (Pierce)
with bovine serum albumin as a standard. Protein loading dye (0.6 M
Tris [pH 6.8], 10% glycerol, 2% sodium dodecyl sulfate [SDS], 5%
2-mercaptoethanol, 0.05% bromphenol blue) was added, and samples were
heated to 80°C for 4 min. Equal concentrations of total protein were
loaded in each well of an SDS-7.5% polyacrylamide gel, which was run
at 200 V for approximately 45 min. The gel was rinsed in transfer buffer (25 mM Tris, 192 mM glycine, 20% methanol) and transferred to
nitrocellulose for 1 h at 100 V using a Bio-Rad Mini Trans-Blot apparatus. The membrane was blocked for 2 h in 5% nonfat milk in
TBS (10 mM Tris-HCl [pH 7.5], 150 mM NaCl) and then incubated with a
1/1,000 dilution of primary antibody (RGS
His antibody; Qiagen) in
antibody binding solution (TBS with 1.5% bovine serum albumin and
1.5% nonfat milk) for 2 h. The membrane was washed twice with 20 mM Tris-HCl [pH 7.5]-500 mM NaCl-0.1% Tween 20- 0.4% Triton
X-100 and once with TBS, 10 min each wash. The membrane was incubated
with a 1/8,000 dilution of goat anti-mouse peroxidase-conjugated secondary antibody (Sigma) in antibody binding solution for 1 h
and then washed as described above. Detection was performed using an
Amersham ECL kit in accordance with the manufacturer's instructions.
Purification of His-tagged proteins.
His-tagged proteins
were purified with Ni-nitrilotriacetic acid (NTA)- agarose (Qiagen)
using a batch procedure. Cell extracts were added to Ni-NTA-agarose
beads, incubated at room temperature for 30 min, and then washed three
times with buffer C (8 M urea, 0.1 M NaH2PO4,
0.01 M Tris [pH 6.3]). Purified protein was eluted with buffer C (pH
6.03) containing 100 mM EDTA. Immunoblotting was performed as described
above, except that equal volumes of eluate rather than equal amounts of
protein were loaded. As the amount of purified protein did not approach
the binding capacity of the resin, the amount of purified protein in
the eluate reflects the amount of the His-tagged protein in the cell extract.
32P labeling.
Strains from fresh overnight
cultures were inoculated at 2 × 106 cells/ml into 50 ml of selective medium. After 12 h of incubation at 140 rpm and
30°C, 109 cells were pelleted, washed with water, and
resuspended in 10 ml of low-phosphate medium. Low-phosphate medium was
prepared by combining 3.3 g of yeast nitrogen base without amino
acids, 5 ml of 1 M MgSO4, and 5 ml of concentrated
NH4OH in 450 ml of distilled H2O. Precipitated
phosphate was allowed to settle, the resultant supernatant was filtered
through a 0.22-µm- pore-size cellulose acetate filter, and the pH of
the medium was adjusted to 5.8 with concentrated HCl. Appropriate amino
acids were added to sustain growth. After 3 h of incubation, 0.1 mCi of 32P (as orthophosphate) was added. The culture was
incubated for 1 h, at which point cells were harvested and broken
as described above with the following exception: phosphatase inhibitors
were added to the breaking buffer-protease inhibitor mixture. After cells were broken, purification was performed as described above and
the purified protein was electrophoresed by SDS-polyacrylamide gel
electrophoresis (PAGE). Protein was transferred to nitrocellulose as
for the immunoblot protocol, and the blot was exposed to film overnight
to detect 32P incorporation. Phosphorimaging was performed
to quantitate radioactivity in the Gsy2p bands. To quantitate protein,
the blot was incubated in 7 ml of phosphatase buffer (50 mM Tris-HCl
[pH 8.0], 1 mM MgCl2, 0.1 mM ZnCl2)
containing 70 U of alkaline phosphatase. This step removed
32P from the nitrocellulose and allowed detection by
immunoblotting, which was performed as described above.
 |
RESULTS |
Isolation and genetic analysis of suppressors of glc7-1
mutants.
Strains containing glc7-1 (R73C) accumulate
only 10% of the glycogen levels found in wild-type strains
(2). Glycogen synthase from these strains is in the
phosphorylated, G6P-dependent form (11, 27). To further
dissect the regulatory pathway required for the activation of glycogen
synthase, we mutagenized a MATa glc7-1
strain (KT1118) with ethyl methanesulfonate as described in Materials
and Methods and screened 30,000 colonies for revertants that
accumulated glycogen by using the iodine staining method (6). Twenty-nine revertants were backcrossed three times
to a MAT
glc7-1 strain (KT1119), and
suppressors which did not mate or sporulate, which stained a
bluish-purplish color with iodine (indicating a defect typically found
in mutants with mutations in the glycogen branching enzyme) (31,
37), or which had phenotypes that did not segregate 2:2 in
meiotic progeny were discarded. Twenty-six of the 29 mutants survived
this preliminary screen and were characterized in greater detail.
Tetrad analysis of crosses between the revertants and a wild-type
GLC7 strain revealed that each suppressor segregated
independently
of
GLC7 and induced a hyperglycogen phenotype
in a wild-type
GLC7 background. Diploid strains constructed
by mating the revertants
to a
glc7-1 strain accumulated more
glycogen than a homozygous
glc7-1 strain but accumulated
less a than a diploid strain homozygous
for a suppressor, indicating
that each revertant was semidominant.
To determine if the suppressors
were genetically linked, we performed
tetrad analysis of
glc7-1/glc7-1 diploid strains constructed by
mating two
different suppressor strains. If suppressors are in
different loci, the
low-glycogen
glc7-1 phenotype should reappear
in some spore
clones; if they are tightly linked, all spores should
display the
hyperglycogen phenotype of one of the parent strains.
All spore clones
from crosses between different revertants retained
the high-glycogen
phenotype, indicating that all suppressors are
tightly linked. To help
determine which locus was mutated in the
revertants, each
suppressor in a wild-type
GLC7 background was
crossed to
gac1::URA3 (KT1141) and
gsy2::HIS3 (CV218) strains.
These mutants
represented two of the most logical suppressor classes.
No linkage was
observed with
gac1::URA3. However, linkage was
observed between each suppressor and the
gsy2::HIS3 disruption.
In every case, the two
histidine auxotrophic spore clones from
each tetrad accumulated
higher-than-normal levels of glycogen
and the histidine prototrophs
failed to accumulate
glycogen.
Cloning and sequencing of suppressors.
Since the suppressors
resided in or near GSY2, the NdeI fragment of
GSY2, which encodes all but the final four amino acid residues of Gsy2p, was cloned by gap repair from each mutant as described in Materials and Methods. Plasmids were transformed into the
glc7-1 strain (CV129) to determine if the GSY2
gene recovered from the mutant strain would suppress the
glc7-1 phenotype. Transformants containing each of the
recovered GSY2 genes accumulated glycogen, indicating that
the mutation responsible for the suppression resided within the
NdeI fragment. Wild-type GSY2 in YEp351 is unable
to restore glycogen accumulation to the glc7-1 strain. To
more accurately localize the suppressor mutations, internal
XhoI/SacI, XhoI/KpnI, and
KpnI/SacI fragments of wild-type GSY2
in YEp351 (pCV58) were exchanged with the identical fragments from each
of the mutant plasmids (Fig. 1). The
presence of the suppressor in each of these subclones was identified by
assaying glycogen levels in CV129 transformants. The DNA sequence was
determined for each restriction fragment from the gap-repaired plasmids
that complemented the glc7-1 defect. The sequence was also
determined for the SacI/NdeI fragment from every
suppressor clone because we were unable to test for the presence of the
suppressor in this fragment.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 1.
Locations of mutations in GSY2 that suppress
the glycogen defect of glc7-1. (A) Overall locations of the
suppressor mutations in GSY2. The arrow corresponds to the
GSY2 coding sequence. The arrowhead corresponds to the 3'
end of GSY2. The NdeI/NdeI DNA
fragment used to gap repair each GSY2 allele and the DNA
restriction endonuclease fragments used to locate each allele are
indicated below the restriction map. (B) Locations of suppressor
mutations in the COOH-terminal region of Gsy2p. The boxed residues,
S650, S654, and T667, correspond to proposed sites of phosphorylation
(16).
|
|
The 12 unique mutations identified from the 26 suppressors are listed
in Table
2, and the locations of these
mutations in
the
GSY2 gene are presented in Fig.
1A. Only a
single mutation
was found in each of the suppressors. Each mutant was
named for
the predicted change in the sequence of the gene product.
GSY2-G264R,
GSY2-G264E,
GSY2-G298D,
GSY2-P648L, and
GSY2-P668T mutations were
all
recovered multiple times. For each of these five mutations,
at least
one of the duplicates was isolated independently from
a separate
mutagenesis experiment. The 12 mutations were located
in three regions
of
GSY2. Three were located near the middle of
the gene,
three were located more distal, and the remaining six
were located in
the known COOH-terminal regulatory region. The
six
NH
2-terminal mutations lay in the portion of Gsy2p that is
closely related to mammalian glycogen synthase. Residues G298,
E590,
and S593, which are altered in
GSY2-G298D,
GSY2-E590K, and
GSY2-S593F mutants, correspond to
identical residues in human
liver and muscle glycogen synthase. In
contrast, the residues
altered in the six most COOH-terminal mutants
are not similar
to residues found in this region of mammalian glycogen
synthase.
This region contains the amino acid residues that are
phosphorylated
in vivo (
16).
Glycogen accumulation in suppressor strains.
To investigate
how the GSY2 mutations alter glycogen synthesis, we first
assayed glycogen levels throughout the growth curve of the wild type
and selected GSY2 mutants that were grown in batch culture.
Glycogen stores are normally low in exponential phase, begin to
increase as the cultures approach stationary phase, peak during
late-log/early-stationary phase, and drop after 12 h in stationary
phase. The three suppressors that we tested accumulated higher levels
of glycogen at each time point but showed basically the same overall
pattern of accumulation (Fig. 2). This
similarity is not unexpected because genes involved in glycogen
metabolism are known to be under transcriptional control (15,
25), which we would predict would not be altered in our
GSY2 mutants. We note that glycogen levels are very
sensitive to the method used to prepare the media (see Materials and
Methods). All subsequent data were gathered from cells grown in
filter-sterilized media.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 2.
Glycogen accumulation in yeast strains grown in batch
cultures. Strains were inoculated into synthetic medium at 2 × 106 cells/ml (see Materials and Methods). At the indicated
times, cell numbers were determined with a hemacytometer (filled
symbols), and glycogen levels per 107 cells were assayed
and expressed as micrograms of glucose (open symbols).
|
|
We next assayed glycogen levels of each suppressor mutant in
glc7-1,
GLC7, and
gac1::URA3
backgrounds at cell densities (2.3
× 10
8 to 3 × 10
8 cells/ml) at which strains accumulate maximum levels of
glycogen.
As shown in Fig.
3,
glc7-1 mutants accumulated less than 10% the
glycogen
accumulated by wild-type strains (

µg of glucose per
10
7 cells). For a given
GSY2 mutant, glycogen
levels were usually
higher in a wild-type background than in
a
glc7-1 background.
The exceptions were
GSY2-P668L and
GSY2-P688T mutants, whose
mutations
caused the accumulation of the same levels in both
backgrounds.
This result suggests that most mutant proteins are not
completely
deregulated and require Glc7p to become fully active.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 3.
Glycogen accumulation for GSY2 and 12 glc7-1 suppressors in wild-type (wt), glc7-1, and
gac1 backgrounds. Cultures were inoculated into synthetic
medium at 2 × 106 cells/ml, cells were harvested
12 h later at densities of 2 × 107 to 3 × 107 cells/ml.
|
|
GAC1 encodes a regulatory subunit of Glc7p necessary for the
activation of glycogen synthase (
11). The subunit contains
separate binding domains for Glc7p and glycogen synthase and appears
to
act in a manner similar to that of the mammalian glycogen targeting
subunits (Wu et al., submitted). We assayed the ability of the
GSY2 mutations to suppress the glycogen defect found in
gacI strains.
As shown in Fig.
3, all
GSY2
suppressor mutations increased glycogen
levels in a
gac1
mutant, in many cases to the level found for
the suppressor in a
wild-type background. Most
GSY2 mutations
suppressed the
glycogen defect of a
gac1 mutant better than that
of a
glc7-1 mutant. This result is consistent with the
observation
that
glc7-1 strains are usually more deficient
in the ability
to accumulate glycogen than are
gac1 strains,
possibly because
of the partially redundant activity of Pig1p
(
4).
Effects of GSY2 mutations on regulatory mutations
affecting glycogen accumulation.
In addition to Pho85p, two
additional protein kinases have been shown to regulate the activity of
glycogen synthase. Snf1p, closely related to the mammalian
AMP-dependent protein kinase, is a positive regulator of glycogen
synthesis. snf1 mutants fail to accumulate glycogen, in part
because of a defect in the accumulation of GSY2 mRNA and in
part because of a defect in the activation of glycogen synthase
(15). This latter defect may be due to reduced levels of
G6P accumulating in snf1 mutants (20). In contrast, cyclic AMP (cAMP)-dependent protein kinase has a negative role in the regulation of glycogen synthase. Cells with constitutively active cAMP-dependent protein kinase activity, due to defects in the
cAMP binding inhibitory subunit Bcy1p, express very low levels of
GSY2 mRNA and may have an altered Gsy2p phosphorylation state (15).
As shown in Fig.
4, our
GSY2
mutations were able to suppress the glycogen defect of
snf1
mutants, with the exception of
GSY2-S593F and
G669D. Surprisingly,
snf1 GSY2-G653L and
snf1 GSY2-P668L mutants
accumulated much higher levels of
glycogen than any other mutant
we tested. In contrast to the results
for
snf1 mutants, none of
our
GSY2 mutations was
able to suppress the glycogen defect of
bcy1 mutants (data
not shown), consistent with previous work indicating
that
cAMP-dependent protein kinase acts on the glycogen biosynthetic
pathway, largely at the level of mRNA synthesis (
11,
15).

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 4.
Glycogen accumulation for GSY2 and 12 glc7-1 suppressors in snf1 and
rho backgrounds. Cultures were inoculated into
synthetic medium at 2 × 106 cells/ml, and cells were
harvested 12 h later at densities of 2 × 107 to
3 × 107 cells/ml.
|
|
Chester (
6) noted that respiration-deficient yeast mutants
fail to accumulate glycogen. More recently, Yang et al.
(
40)
found that this defect can be suppressed in
GSY2 mutants whose
products cannot be phosphorylated.
Surprisingly, mutation of
PHO85,
which encodes one of the
kinases responsible for phosphorylating
and inactivating glycogen
synthase, does not rescue the defect,
suggesting that another kinase
may be responsible for the inhibition
of glycogen synthase in
respiration-deficient strains. We tested
our collection of
GSY2 mutants for suppression of this defect.
As shown in
Fig.
4, all
GSY2 suppressors at least partially alleviated
the glycogen defect. Interestingly, several of the suppressors
produced
a "ring" phenotype in qualitative plate assays, where
the outer
edge of the culture stained much darker than the center
(data not
shown). This result suggests that for these mutants,
only rapidly
growing cells or cells with access to the highest
levels of nutrients
accumulated excess glycogen. Hyperaccumulation
was also observed in
qualitative assays when the suppressors in
a Rho
+
background were grown anaerobically, indicating that these mutants
do
not require oxygen for increased glycogen accumulation (data
not
shown).
Abundance, phosphate incorporation, and activity of mutant Gsy2p
enzymes.
Although the overexpression of wild-type Gsy2p does not
raise glycogen levels in either a wild-type or a glc7-1
mutant background, we nevertheless assayed the levels of Gsy2 proteins
in our mutants to eliminate the possibility that protein abundance was
affecting the glycogen phenotype. To facilitate the assay of Gsy2
protein levels, the sequence encoding RSH6 was inserted
after the NH2-terminal methionine codon for efficient
protein purification and detection. The six-histidine-tagged genes were
cloned into a CEN plasmid that allowed expression from the native
GSY2 promoter, and plasmids containing six different
GSY2 mutations were transformed into a
gsy2::HIS3 strain (CV218) to assay for the ability
of the tagged genes to complement the gsy2::HIS3
disruption. Transformants containing six-histidine-tagged and untagged
GSY2 genes accumulated similar levels of glycogen,
indicating that the introduction of the six-histidine- tag at the
NH2 terminus does not reduce activity. Protein extracts were collected from late-log cultures, at the point at which glycogen levels were at a maximum. Six-histidine-tagged Gsy2 proteins were purified on Ni-NTA-agarose from equal amounts of total protein, separated by SDS-PAGE, transferred to nitrocellulose, and detected using an antibody against the six-histidine tag. As shown in Fig. 5A, mutant protein concentrations
were equal to or lower than wild-type protein levels.
Ni-NTA-purified protein levels were assessed because of the
relatively low level of enzyme in total extracts. However,
immunoblotting was performed using total extracts, and similar results
were obtained (data not shown). Thus, increased glycogen levels in the
mutants were not due to increased Gsy2p abundance.

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 5.
Gsy2p expression and phosphorylation. (A) Immunoblot of
extracts prepared from wild-type and Gsy2 suppressor variants grown to
late-log phase. Equal concentrations of total protein were loaded into
each lane, except for the first and second lanes, which contained 1.5 and 0.5 times the amounts loaded in the other lanes, respectively.
Numbers below each lane indicate relative Gsy2 protein levels,
normalized to that of the wild-type protein, as determined by
densitometry of the immunoblot. (B) Immunoblot and autoradiogram of
cells labeled with 32P. Yeast strains were 32P
labeled, cell extracts were prepared, and six-histidine-tagged,
affinity-purified protein was electrophoresed by SDS-PAGE as described
in Materials and Methods. Gsy2p present in each immunoprecipitate was
assayed by immunoblotting, and the level of phosphorylation was
determined by autoradiography. The numbers below each lane indicate the
ratio of 32P incorporation in mutant proteins to that in
total Gsy2 protein, normalized to wild-type Gsy2p levels.
|
|
Glycogen synthase assays were performed with the mutant proteins to
determine if suppression ability correlated with increased
protein
activity. Assays were performed in the presence and absence
of G6P to
measure total and active glycogen synthase activities,
respectively.
All mutants examined exhibited an increased activity
ratio (Table
3).
To assay for phosphate incorporation into wild-type Gsy2p and mutant
Gsy2p, a
glc7-1 gsy2::HIS3 strain was transformed
with
plasmids containing the six-histidine-tagged
GSY2
genes. Transformants
were labeled with
32P (as
orthophosphate) as described in Materials and Methods. The
purified
six-histidine-tagged Gsy2 proteins were subjected to
SDS-PAGE and
transferred to nitrocellulose, and
32P incorporation into
Gsy2p was assayed by autoradiography (Fig.
5B). Gsy2p levels were
assayed by immunoblot analysis after treatment
with alkaline
phosphatase. As shown by the relative incorporation
of
32P
into each mutant Gsy2 protein (Fig.
5B), each Gsy2p variant
tested
incorporated
32P. Variants with mutations in the
phosphorylated domain, Gsy2-S654L
and Gsy2-P668T, incorporated less
32P than wild-type Gsy2p, whereas Gsy2-G264R and Gsy2-E590K
incorporated
higher levels of
32P than the wild-type
protein.
Relative fitness of glycogen synthase mutants.
Although yeast
cells have evolved a complex mechanism for the regulation of glycogen
synthesis, little is known about the physiological role for this
storage carbohydrate. The elimination of both GSY1 and
GSY2 has been reported to have no effect on growth rate or
heat shock resistance and to confer only a slight defect in sporulation
(8). To provide a more sensitive assay for defects caused
by altered levels of glycogen, we cocultivated a wild-type strain with
either a gsy2::HIS3 mutant or a
GSY2-E590K mutant. These congenic strains had identical
nutritional requirements and showed no difference in exponential growth
rates when cultured separately (data not shown). In each cocultivation
experiment, the two strains were inoculated into fresh medium at a
concentration of 2 × 104 cells/mI, and cultures were
allowed to grow for 3 days before reinoculation into fresh medium.
After 3 days, samples were diluted with fresh medium to a concentration
of 2 × 104 cells/ml and incubated for an additional 3 days. This regimen was repeated twice. After each 3-day period, the
ratio of the numbers of cells of the strains in the culture was
determined using glycogen accumulation to score the two genotypes. As
shown in Fig. 6A, after 12 days of growth
in glucose-containing medium, greater than 95% of the cells in both
cultures were wild type. In acetate-containing medium,
gsy2::HIS3 and GSY2-E590K strains were
also less fit than the wild type, although the
gsy2::HIS3 strain showed higher fitness in
acetate-containing medium than in glucose-containing medium.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 6.
Competition between wild-type and GSY2
mutants in synthetic complete medium and acetate-containing medium.
Wild-type and either GSY2-E950K or
gsy2::HIS3 strains were inoculated at
104 cells/ml into synthetic complete medium (A) or
acetate-containing medium (B) and allowed to grow for 3 days at 30°C.
Cultures were subcultured into fresh medium at 2 × 104 cells/ml and allowed to grow for another 3 days. This
regimen was repeated twice. For each dilution, a culture sample was
placed on solid YPD and colonies were allowed to grow. The ratio of
wild-type to mutant GSY2 on the plate was determined by
iodine staining. Each point represents of the average of at least two
independent experiments.
|
|
The relatively rapid overgrowth of the wild-type strain in these
experiments indicates that both decreased glycogen and increased
glycogen levels lead to reduced fitness of the population. In
principle, these differences in competition can be attributed
to
differences in growth rate, cell viability, or rate of outgrowth
from
stationary phase. We have not observed any differences in
the doubling
times of these strains in log phase or in the rate
of outgrowth from
stationary phase, but we have observed reduced
viability of both the
gsy2::HIS3 and the
GSY2-E590K strains.
The
percentage of viable wild-type cells in cultures after 3 days
of
growth in synthetic glucose-containing medium was 93%, whereas
those
of the
gsy2::HIS3 and
GSY2-E590K
strains were 71 and 79%,
respectively. These differences could account
for at least some
of the competitive disadvantages of the
GSY2 mutants and demonstrate
for the first time the
importance of the regulation of glycogen
metabolism in
yeast.
 |
DISCUSSION |
In a screen for revertants that restored glycogen accumulation to
a glc7-1 strain, we identified 12 unique mutations in
GSY2. All 12 probably act by altering the activity of
glycogen synthase, because none of the GSY2 mutants tested
showed an increase in protein levels, as assayed by immunoblot
analysis. In addition, overexpression of the wild-type GSY2
gene does not suppress the glc7-1 phenotype, indicating that
the concentration of glycogen synthase in the cell is not normally rate
limiting for glycogen biosynthesis. Although there is no direct
biochemical evidence in vitro that Glc7p is the phosphatase that
activates glycogen synthase, the results presented here strengthen this
hypothesis. It is surprising that no other genes were identified in our
screen because mutations in REG1 (17) and
PHO85 (18, 38) have also been shown to suppress
the glc7-1 mutation. However, the exclusion of slowly
growing colonies from our screen would have eliminated reg1
and pho85, since both show a slow-growth phenotype unrelated to their high level of glycogen accumulation.
We envision three mechanisms by which our mutations in GSY2
could suppress the glc7-1 phenotype. One possibility is that
the mutant proteins are resistant to negative regulation by
phosphorylation, either directly due to reduced phosphorylation or
indirectly due to changes in allosteric effects of phosphorylation on
activity. Another possibility is that mutants could be more sensitive
to positive regulation, either by becoming better substrates for phosphatase activity or by becoming more sensitive to the activating effect of G6P. A third possibility is that the suppressors act by
increasing the activity of the encoded enzyme without changing its
regulation. Six out of 12 GSY2 mutations identified in this screen probably act via the first mechanism. These are located at or
near the proposed phosphorylation sites (Fig. 1B). One of the six
directly alters phosphorylation site Ser-654, while the others alter
residues one or two residues away from the phosphorylation sites.
Pho85p, together with its cyclin subunits Pcl8p and Pcl10p, comprises
one of the kinases that phosphorylates Gsy2p at S654 and T667
(19, 39). The precise consensus site has not been determined for this activity, but the consensus sequence around these
two sites is S/T-P-X-D-L. Two GSY2 mutations,
GSY2-P668T and GSY2P688L, altered one of these
prolines, supporting the above consensus recognition motif. The fact
that GSY2-G669D also suppressed glc7-1 could
indicate that the identity of the amino acid residue after the proline
is also restricted for Pho85p-Pcl10p recognition.
The kinase responsible for phosphorylating S650 is not known, but the
fact that GSY2-P648L suppresses glc7-1 leads to
the prediction that the consensus recognition motif for this kinase contains a proline at the
2 position. It is worth noting that a
proline is present at the
2 position in the sequence recognition motif for the mitogen-activated protein (MAP) kinase Erk1 (13, 34). François et al. (9) found that glycogen
synthesis was inhibited by the mating pathway, a signaling pathway
regulated by the MAP kinase Fus3p. However, to our knowledge there is
no direct evidence that Fus3p can phosphorylate Gsy2p. We do not believe that the other six suppressor mutations alter the
phosphorylation state of Gsy2p, but several of them could cause
insensitivity to the effects of phosphorylation. These mutant proteins
were phosphorylated to a greater extent than the wild-type protein, as
judged by the relative levels of 32P incorporation in vivo.
A detailed biochemical characterization of 22 mutations of
GSY2 revealed two mutants that were totally resistant to
activation by G6P (26). One of these, Gsy2-R586A R588A
R591A, had wild-type activity and was inactivated by
phosphorylation. Another, Gsy2-R579A R580A R582A, showed reduced
sensitivity to phosphorylation. Pederson et al. (26)
proposed that these residues constitute a region of glycogen synthase
that is important for G6P binding and/or changes between different
activity states. It is noteworthy that two of our mutants, GSY2-E590K
and GSY2-S593F, had mutations that lay in or near this region.
Gsy2-E590K had the highest activity in the presence or absence of G6P,
suggesting that this mutant might also be insensitive to the influence
of G6P and C-terminal phosphorylation. A detailed biochemical
characterization of these mutants would help distinguish between
different possible mechanisms of suppression.
In both yeast and mammals, glycogen biosynthesis is under complex
regulation. In mammals, where glycogen serves as a key energy store and
for maintenance of blood glucose levels, the reasons for this
regulation are obvious. In yeast, the accumulation of glycogen at the
end of logarithmic growth would implicate the carbohydrate as having a
role in survival in stationary phase or sporulation. However, glycogen
synthase mutants sporulate well, have no growth defect, and survive
heat shock stress (8). We revisited this issue using a
cocultivation strategy, where wild-type and mutant strains with
identical auxotrophies were cultured together in medium containing
either glucose or acetate as a carbon source. Under both conditions,
strains with low (gsy2::HIS3) and high (GSY2-E590K) levels of glycogen were rapidly overgrown by
the wild-type strain (Fig. 6). This result provides a solid indication that glycogen levels must be tightly regulated, since as little as a
2-fold increase or a 10-fold decrease in glycogen is enough to
dramatically reduce fitness levels. Although we do not know at present
the physiological defects responsible for the reduced fitness of the
GSY2 mutants, we have observed reduced viability of both
gsy2::HIS3 and GSY2-E590K strains, a
result which could account for the differences in fitness. Our results
provide a means to study the basis for the requirement for the tightly
regulated control of glycogen accumulation.
 |
ACKNOWLEDGMENTS |
We thank Lucy Robinson for comments on the manuscript and Peter
Roach for strains, plasmids, and communication of results prior to publication.
This work was supported by National Institutes of Health grant
GM-477899 and a predoctoral NSF fellowship to C.A.
 |
FOOTNOTES |
*
Corresponding author. Present address: Department of
Biochemistry and Molecular Biology, Louisiana State University Health Sciences Center, 1501 Kings Highway, Shreveport, LA 71130. Phone: (318)
675-7769. Fax: (318) 675-5180. E-mail: ktatch{at}lsuhsc.edu.
Present address: Department of Developmental Cell and Molecular
Biology, Duke University, Durham, NC 27708.
 |
REFERENCES |
| 1.
|
Cannon, J. F.,
R. Gitan, and K. Tatchell.
1990.
Yeast cAMP-dependent protein kinase regulatory subunit mutations display a variety of phenotypes.
J. Biol. Chem.
265:11897-11904[Abstract/Free Full Text].
|
| 2.
|
Cannon, J. F.,
J. R. Pringle,
A. Fiechter, and M. Khalil.
1994.
Characterization of glycogen-deficient glc mutants of Saccharomyces cerevisiae.
Genetics
136:485-503[Abstract].
|
| 3.
|
Cannon, J. F., and K. Tatchell.
1987.
Characterization of Saccharomyces cerevisiae genes encoding subunits of cyclic AMP-dependent protein kinase.
Mol. Cell. Biol.
7:2653-2663[Abstract/Free Full Text].
|
| 4.
|
Cheng, C.,
D. Huang, and P. J. Roach.
1997.
Yeast PIG genes: PIG1 encodes a putative type 1 phosphatase subunit that interacts with the yeast glycogen synthase Gsy2p.
Yeast
13:1-8[CrossRef][Medline].
|
| 5.
|
Cheng, C.,
J. Mu,
I. Farkas,
D. Huang,
M. G. Goebl, and P. J. Roach.
1995.
Requirement of the self-glucosylating initiator proteins Glg1p and Glg2p for glycogen accumulation in Saccharomyces cerevisiae.
Mol. Cell. Biol.
15:6632-6640[Abstract].
|
| 6.
|
Chester, V. E.
1968.
Heritable glycogen-storage deficiency in yeast and its induction by ultra-violet light.
J. Gen. Microbiol.
51:49-56[Abstract/Free Full Text].
|
| 7.
|
Farkas, I.,
T. A. Hardy,
A. A. DePaoli-Roach, and P. J. Roach.
1990.
Isolation of the GSY1 gene encoding yeast glycogen synthase and evidence for the existence of a second gene.
J. Biol. Chem.
265:20879-20886[Abstract/Free Full Text].
|
| 8.
|
Farkas, I.,
T. A. Hardy,
M. G. Goebl, and P. J. Roach.
1991.
Two glycogen synthase isoforms in Saccharomyces cerevisiae are coded by distinct genes that are differentially controlled.
J. Biol. Chem.
266:15602-15607[Abstract/Free Full Text].
|
| 9.
|
François, J.,
D. L. Higgins,
F. Chang, and K. Tatchell.
1991.
Inhibition of glycogen synthesis in Saccharomyces cerevisiae by the mating pheromone -factor.
J. Biol. Chem.
266:6174-6180[Abstract/Free Full Text].
|
| 10.
|
François, J.,
M. E. Villanueva, and H.-G. Hers.
1988.
The control of glycogen metabolism in yeast. 1. Interconversion in vivo of glycogen synthase and glycogen phosphorylase induced by glucose, a nitrogen source, or uncouplers.
Eur. J. Biochem.
174:551-559[Medline].
|
| 11.
|
François, J. M.,
S. Thompson-Jaeger,
J. Skroch,
U. Zellenka,
W. Spevak, and K. Tatchell.
1992.
GAC1 may encode a regulatory subunit for protein phosphatase type 1 in Saccharomyces cerevisiae.
EMBO J.
11:87-96[Medline].
|
| 12.
|
Frederick, D. L., and K. Tatchell.
1996.
The REG2 gene of Saccharomyces cerevisiae encodes a type 1 protein phosphatase-binding protein that functions with Reg1p and the Snf1p protein kinase to regulate growth.
Mol. Cell. Biol.
16:2922-2931[Abstract].
|
| 13.
|
Gonzalez, F. A.,
D. L. Raden, and R. J. Davis.
1991.
Identification of substrate recognition determinants for human ERK1 and ERK2 protein kinases.
J. Biol. Chem.
266:22159-22163[Abstract/Free Full Text].
|
| 14.
|
Guthrie, C., and G. R. Fink (ed.).
1991.
Methods in enzymology, vol. 194. Guide to yeast genetics and molecular biology.
Academic Press, Inc., San Diego, Calif.
|
| 15.
|
Hardy, T. A.,
D. Huang, and P. J. Roach.
1994.
Interactions between cAMP-dependent and SNF1 protein kinases in the control of glycogen accumulation in Saccharomyces cerevisiae.
J. Biol. Chem.
269:27907-27913[Abstract/Free Full Text].
|
| 16.
|
Hardy, T. A., and P. J. Roach.
1993.
Control of yeast glycogen synthase-2 by COOH-terminal phosphorylation.
J. Biol. Chem.
268:23799-23805[Abstract/Free Full Text].
|
| 17.
|
Huang, D.,
K. T. Chun,
M. G. Goebl, and P. J. Roach.
1996.
Genetic interactions between REG1/HEX2 and GLC7, the gene encoding the protein phosphatase type 1 catalytic subunit in Saccharomyces cerevisiae.
Genetics
143:119-127[Abstract].
|
| 18.
|
Huang, D.,
I. Farkas, and P. J. Roach.
1996.
Pho85p, a cyclin-dependent protein kinase, and the Snf1p protein kinase act antagonistically to control glycogen accumulation in Saccharomyces cerevisiae.
Mol. Cell. Biol.
16:4357-4365[Abstract].
|
| 19.
|
Huang, D.,
J. Moffat,
W. A. Wilson,
L. Moore,
C. Cheng,
P. J. Roach, and B. Andrews.
1998.
Cyclin partners determine Pho85 protein kinase substrate specificity in vitro and in vivo: control of glycogen biosynthesis by Pcl8 and Pcl10.
Mol. Cell. Biol.
18:3289-3299[Abstract/Free Full Text].
|
| 20.
|
Huang, D.,
W. A. Wilson, and P. J. Roach.
1997.
Glucose-6-P control of glycogen synthase phosphorylation in yeast.
J. Biol. Chem.
272:22495-22501[Abstract/Free Full Text].
|
| 21.
|
Huang, K. P., and E. Cabib.
1974.
Yeast glycogen synthetase in the glucose 6-phosphate-dependent form.
J. Biol. Chem.
249:3851-3857[Abstract/Free Full Text].
|
| 22.
|
Hwang, P. K.,
S. Tugendriech, and R. J. Fletterick.
1989.
Molecular analysis of GPH1, the gene encoding glycogen phosphorylase in Saccharomyces cerevisiae.
Mol. Cell. Biol.
9:1659-1666[Abstract/Free Full Text].
|
| 23.
|
Lillie, S. H., and J. R. Pringle.
1980.
Reserve carbohydrate metabolism in Saccharomyces cerevisiae: responses to nutrient limitation.
J. Bacteriol.
143:1384-1394[Abstract/Free Full Text].
|
| 24.
|
Ni, H. T., and D. C. LaPorte.
1995.
Response of a yeast glycogen synthase gene to stress.
Mol. Microbiol.
16:1197-1205[CrossRef][Medline].
|
| 25.
|
Parrou, J. L.,
M. A. Teste, and J. Francois.
1997.
Effects of various types of stress on the metabolism of reserve carbohydrates in Saccharomyces cerevisiae: genetic evidence for a stress-induced recycling of glycogen and trehalose.
Microbiology
143:1891-1900[Abstract/Free Full Text].
|
| 26.
|
Pederson, B. A.,
C. Cheng,
W. A. Wilson, and P. J. Roach.
2000.
Regulation of glycogen synthase: identification of residues involved in regulation by the allosteric ligand glucose-6-P and by phosphorylation.
J. Biol. Chem.
275:27753-27761[Abstract/Free Full Text].
|
| 27.
|
Peng, Z.-Y.,
R. J. Trumbly, and E. M. Reimann.
1990.
Purification and characterization of glycogen synthase from a glycogen-deficient strain of Saccharomyces cerevisiae.
J. Biol. Chem.
265:13871-13877[Abstract/Free Full Text].
|
| 28.
|
Roach, P. J.
1990.
Control of glycogen synthase by hierarchal protein phosphorylation.
FASEB J.
4:2961-2968[Abstract].
|
| 29.
|
Rose, M. D.,
F. Winston, and P. Hieter.
1990.
Methods in yeast genetics. A laboratory course manual.
Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 30.
|
Rothman-Denes, L., and E. Cabib.
1970.
Two forms of yeast glycogen synthetase and their role in glycogen accumulation.
Proc. Natl. Acad. Sci. USA
66:967-974[Abstract/Free Full Text].
|
| 31.
|
Rowen, D. W.,
M. Meinke, and D. C. LaPorte.
1992.
GLC3 and GHA1 of Saccharomyces cerevisiae are allelic and encode the glycogen branching enzyme.
Mol. Cell. Biol.
12:22-29[Abstract/Free Full Text].
|
| 32.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 33.
|
Sikorksi, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27[Abstract/Free Full Text].
|
| 34.
|
Songyang, Z.,
K. P. Lu,
Y. T. Kwon,
L. H. Tsai,
O. Filhol,
C. Cochet,
D. A. Brickey,
T. R. Soderling,
C. Bartleson,
D. J. Graves,
A. J. DeMaggio,
M. F. Hoekstra,
J. Blenis,
T. Hunter, and L. C. Cantley.
1996.
A structural basis for substrate specificities of protein Ser/Thr kinases: primary sequence preference of casein kinases I and II, NIMA, phosphorylase kinase, calmodulin-dependent kinase II, CDK5, and Erk1.
Mol. Cell. Biol.
16:6486-6493[Abstract].
|
| 35.
|
Stuart, J. S.,
D. L. Frederick,
C. M. Varner, and K. Tatchell.
1994.
The mutant type 1 protein phosphatase encoded by glc7-1 from Saccharomyces cerevisiae fails to interact productively with the GAC1-encoded regulatory subunit.
Mol. Cell. Biol.
14:896-905[Abstract/Free Full Text].
|
| 36.
|
Thomas, J. A.,
K. K. Schlender, and J. Larner.
1968.
A rapid filter paper assay for UDPglucose-glycogen glucosyltransferase, including an improved biosynthesis of UDP-14C-glucose.
Anal. Biochem.
25:486-499[CrossRef][Medline].
|
| 37.
|
Thon, V. J.,
C. Vigneron-Lesens,
T. Marianne-Pepin,
J. Montreuil,
A. Decq,
C. Rachez,
S. G. Ball, and J. F. Cannon.
1992.
Coordinate regulation of glycogen metabolism in the yeast Saccharomyces cerevisiae.
J. Biol. Chem.
267:15224-15228[Abstract/Free Full Text].
|
| 38.
|
Timblin, B. K.,
K. Tatchell, and L. W. Bergman.
1996.
Deletion of the gene encoding the cyclin-dependent protein kinase PHO85 alters glycogen metabolism in Saccharomyces cerevisiae.
Genetics
143:57-66[Abstract].
|
| 39.
|
Wilson, W. A.,
A. M. Mahrenholz, and P. J. Roach.
1999.
Substrate targeting of the yeast cyclin-dependent kinase Pho85p by the cyclin Pcl10p.
Mol. Cell. Biol.
19:7020-7030[Abstract/Free Full Text].
|
| 40.
|
Yang, R.,
K. T. Chun, and R. C. Wek.
1998.
Mitochondrial respiratory mutants in yeast inhibit glycogen accumulation by blocking activation of glycogen synthase.
J. Biol. Chem.
273:31337-31344[Abstract/Free Full Text].
|
Journal of Bacteriology, February 2001, p. 821-829, Vol. 183, No. 3
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.3.821-829.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Pederson, B. A., Wilson, W. A., Roach, P. J.
(2004). Glycogen Synthase Sensitivity to Glucose-6-P Is Important for Controlling Glycogen Accumulation in Saccharomyces cerevisiae. J. Biol. Chem.
279: 13764-13768
[Abstract]
[Full Text]
-
Chang, J. S., Henry, K., Wolf, B. L., Geli, M., Lemmon, S. K.
(2002). Protein Phosphatase-1 Binding to Scd5p Is Important for Regulation of Actin Organization and Endocytosis in Yeast. J. Biol. Chem.
277: 48002-48008
[Abstract]
[Full Text]
-
Williams-Hart, T., Wu, X., Tatchell, K.
(2002). Protein Phosphatase Type 1 Regulates Ion Homeostasis in Saccharomyces cerevisiae. Genetics
160: 1423-1437
[Abstract]
[Full Text]