Previous Article | Next Article 
Journal of Bacteriology, February 2001, p. 997-1011, Vol. 183, No. 3
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.3.997-1011.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Chlorocatechols Substituted at Positions 4 and 5 Are Substrates
of the Broad-Spectrum Chlorocatechol 1,2-Dioxygenase of
Pseudomonas chlororaphis RW71
Thomas
Potrawfke,
Jean
Armengaud,
and
Rolf-Michael
Wittich*
Division of Microbiology, GBF
German
Research Centre for Biotechnology, D-38124 Braunschweig, Germany
Received 7 June 2000/Accepted 4 November 2000
 |
ABSTRACT |
The nucleotide sequence of a 10,528-bp region comprising the
chlorocatechol pathway gene cluster tetRtetCDEF of the
1,2,3,4-tetrachlorobenzene via the tetrachlorocatechol-mineralizing
bacterium Pseudomonas chlororaphis RW71 (T. Potrawfke,
K. N. Timmis, and R.-M. Wittich, Appl. Environ. Microbiol.
64:3798-3806, 1998) was analyzed. The chlorocatechol
1,2-dioxygenase gene tetC was cloned and overexpressed in
Escherichia coli. The recombinant gene product was
purified, and the
,
-homodimeric TetC was characterized. Electron
paramagnetic resonance measurements confirmed the presence of
a high-spin-state Fe(III) atom per monomer in the holoprotein. The
productive transformation by purified TetC of chlorocatechols bearing
chlorine atoms in positions 4 and 5 provided strong evidence for a
significantly broadened substrate spectrum of this dioxygenase compared
with other chlorocatechol dioxygenases. The conversion of 4,5-dichloro- or tetrachlorocatechol, in the presence of catechol, displayed strong
competitive inhibition of catechol turnover. 3-Chlorocatechol, however, was simultaneously transformed, with a rate similar to that of the 4,5-halogenated catechols, indicating similar specificity constants. These novel characteristics of TetC thus differ
significantly from results obtained from hitherto analyzed catechol
1,2-dioxygenases and chlorocatechol 1,2-dioxygenases.
 |
INTRODUCTION |
Vast amounts of toxic chemicals have
been released into the ecosphere in the last five decades
(46). Substitution for hydrogen of normally readily
biodegradable hydrocarbons with xenobiotic structural elements, such as
halogens or nitro or sulfo groups, led to a significantly reduced or
retarded microbial breakdown (1a) and, consequently, to
the concomitant accumulation in the environment and the food chain.
Therefore, halogenated pesticides and other halogenated aliphatics and
aromatics are a major environmental concern.
Genetic analysis of bacterial catabolic loci encoding degradation of
haloaromatic compounds, such as chlorinated benzenes, clearly
underlined the role of incorporation and rearrangement of preexisting
genetic material by transposition and other genetic events in the
assembly of new catabolic capacities (29, 63, 64, 72).
Recruitment of mobile genetic elements allows adaptation to the
degradation of recalcitrant xenobiotic compounds and enhances the
ability of bacteria to conquer new ecological niches for further evolution by a faster divergence of gene sequences.
The so-called modified ortho cleavage pathway is a central
oxidative bacterial pathway that channels chlorocatechols, derived from
the degradation of chlorinated benzoic acids, phenoxyacetic acids,
phenols, benzenes, and other aromatics into the energy-generating tricarboxylic acid pathway (67). Gene clusters of the
modified ortho cleavage pathway, clcRABD(E)
(13, 21), tfdR(T)CDEF (47), and tcbRCDEF (65), have been shown to be
evolutionarily related, as reflected by their conserved organization
(56). The isolation of bacteria with catabolic
transposable elements of almost identical cistronic organization
indicates that global dissemination of genes encoding these
chlorocatechol-degrading enzymes generally occurs.
These chlorocatechols represent key chemical structures, originating
from the bacterial degradation of chlorobenzenes, chlorophenols, chlorobenzoates, and other chlorinated aromatics upon initial dioxygenation and dehydrogenation, and are further metabolized by
either ortho or meta cleavage (24).
Addition of molecular oxygen and subsequent cleavage between two
adjacent hydroxyl groups has been shown to proceed through nonheme
Fe(III)-dependent metalloenzymes, classified as intradiol dioxygenases
(67). Protocatechuate 3,4-dioxygenase (25,
33), hydroxyquinol 1,2-dioxygenase (3, 13),
catechol 1,2-dioxygenases (type I enzymes) (27, 38, 40),
and chlorocatechol 1,2-dioxygenases (type II enzymes, of the so-called
modified ortho pathway) (12, 21, 47, 68) have
been extensively characterized. These investigations resulted in
distinct information on kinetic features and respective substrate
specificities as well as some structural information on catechol
1,2-dioxygenase (18, 60) and protocatechuate
3,4-dioxygenase (42, 43). The high-resolution crystal
structure of protocatechuate 3,4-dioxygenase revealed two histidine and
two tyrosine residues involved in the binding of the catalytic ferric
iron (42, 62). These residues are conserved in all
investigated intradiol dioxygenases. The iron atom in the
pentacoordinated active center of this enzyme remains in the high-spin
Fe(III) state during catalysis, as in enzyme-inhibitor complexes
investigated so far. More detailed structural information deduced from
analysis of the crystal structure of catechol 1,2-dioxygenase, and
especially of chlorocatechol 1,2-dioxygenase, however, is scarce. X-ray
absorption measurements have provided the first insights into the
recognition of chemical structures by ortho-cleaving dioxygenases (7). The turnover of different substrates and recognition of key structures are assumed to be modulated through interactions of specific residues of the polypeptide with the substrate, not by the iron-coordinating ligands (7). The
substrate specificities and affinities of hitherto characterized
chlorocatechol 1,2-dioxygenases towards (highly) chlorinated catechols
differ considerably, although most of these enzymes share relatively high sequence similarities (51).
Pseudomonas chlororaphis RW71 is the first microorganism
shown to mineralize 1,2,3,4-tetrachlorobenzene via a
4,5-substituted chlorocatechol, (3,4,5,6-)tetrachlorocatechol.
Biochemical analysis of the potential of this strain revealed
unusual capacities, such as conversion not only of highly chlorinated
catechols but also of 2,3,5-trichloromaleylacetate, a pathway product
for which conversion has never been reported (49). In the
present study, the tet operon from P. chlororaphis RW71 which specifies for enzymes that productively
mineralize highly chlorinated catechols has been cloned and sequenced.
The biochemical and spectroscopic characterization of recombinant TetC,
the first catabolic enzyme of this operon, is also presented.
Experimental data provide unequivocal evidence that 4,5-dichloro-,
3,4,5-trichloro-, and tetrachlorocatechol are productively converted by
this enzyme. These chemicals were previously regarded as strong
inhibitors of ortho-cleaving dioxygenases and found to have
high recalcitrance towards aerobic bacterial catabolism (9, 16,
63).
 |
MATERIALS AND METHODS |
Strains, culture conditions, and general DNA techniques.
Bacterial strains used in this study were P. chlororaphis
RW71 (49), Escherichia coli DH5
(Clontech),
and E. coli BL21(DE3)(pLysS). Plasmids were pET9a (Novagen)
and pBluescript II KS(+) and pCR-Script AMP SK(+) (Stratagene).
P. chlororaphis RW71 was grown in mineral salts medium with
1,2,3,4-tetrachlorobenzene as the only carbon and energy source, as
previously described (49). Liquid cultures were grown in
baffled round-bottom flasks on a rotary shaker at 120 rpm at 28°C.
Solid media contained 1% (wt/vol) purified agar (Oxoid). E. coli strains were grown at 37°C on Luria-Bertani (LB) medium
containing the appropriate antibiotics. Standard techniques and DNA
manipulations were carried out as described by Sambrook et al.
(52). Oligonucleotide synthesis, DNA probe labeling, Southern blotting, colony lift hybridization, DNA elution from agarose
gels, nucleotide sequencing, and sequence analysis were done
essentially as described previously (3, 4). Plasmid DNA
for sequencing was extracted with the Plasmid Max Kit (Qiagen) as
recommended by the supplier. The accession number of the entire sequence is AJ271325 in the EMBL/DDBJ/GenBank database, and that of
tetC is AJ132716.
Cloning of two overlapping DNA fragments encoding the
tet operon.
For cloning of the chlorocatechol
pathway genes, two probes were generated by PCR amplification using
total DNA of RW71 extracted by means of a Qiagen Genomic DNA
kit. A 745-bp fragment coding for a cycloisomerase was obtained using
the degenerate primers TP2 (GTGCASMAGCAGAGCTA) and TP6
(TTGCAMAGCTTCAGCGA) as previously described for the
detection of chlorocatechol degradation genes (48). A
second probe coding for an 887-bp fragment within the genes of the
dienelactone hydrolase and the maleylacetate reductase was amplified by
using the oligonucleotides TP31 (CGCGGTGATCGGCTATTGCCTG) and
TP32 (CCCTCAACCGCGTGCGCGATCG) priming the chlorocatechol
pathway operon tcbRCDEF (65, 66). Both
probes were sequenced in order to confirm the similarity to known
homologues. Southern blots of either BamHI- or
KpnI-digested total DNA of RW71 were hybridized under
stringent conditions with the two PCR-amplified probes. Positive 9-kb
BamHI and 8-kb KpnI fragments were revealed by
both probes. For construction of a partial gene library, total DNA of
RW71 was digested with the above-described restriction enzymes and
electrophoretically separated on a 0.7% agarose gel. Slices containing
DNA fragments of 8 to 11 kb for the BamHI digest and of 7 to
9 kb for the KpnI digest were excised from the gel. The DNA
was electroeluted and cloned into pBluescript II KS(+), cleaved with
either BamHI or KpnI, and dephosphorylated with
calf intestine phosphatase. The two partial gene libraries obtained in
E. coli DH5
cells were spread onto LB plates containing
1.0 mM isopropyl-
-D-thiogalactopyranoside (IPTG),
0.004% (wt/vol)
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside, and 0.1 mg of ampicillin/ml. Colony hybridization with the two probes allowed
selection of positive clones. The plasmids, pTP18 and pTP19,
corresponding to the 9-kb BamHI and 8-kb KpnI
fragments in pBluescript II KS(+), were mapped with various restriction enzymes and sequenced on both strands. The sequence analysis of the two
cloned fragments from pTP18 and pTP19 revealed a 4.75-kb overlap
between the two fragments.
Generation of the expression vector pTP20.
The gene
tetC of strain RW71 was PCR amplified using the
oligonucleotides TP74 (GCCCCATATGAACGAACGAGTGAAGC) and
TP75 (GCGCAGATCTCATGCGTGCTCCCGGGG) with plasmid pTP19 as the
template. These two primers contained a 5' extension of 7 bp with
NdeI and BglII restriction sites, respectively.
PCR was performed according to the standard procedure, except that
proofreading Pfu polymerase (Boehringer Mannheim) was used
and 5% (vol/vol) dimethyl sulfoxide was added. Fragments of the
expected size were excised after resolution of PCR products on 1.5%
agarose gels, purified, and cloned into pCR-Script AMP SK(+),
generating plasmid pTP15. The integrity of the sequence information of
the 756-bp insert was checked, and the fragment was excised from
pTP15 by restriction with NdeI and BglII.
Purification on agarose gel and ligation with pET9a, previously
digested with NdeI and BamHI, resulted in the
expression plasmid pTP20.
Purification of recombinant TetC.
E. coli cells
containing pTP20 were grown at 37°C in LB medium containing 50 µM
kanamycin until an absorbance at 600 nm of 1.0 was reached. Upon
induction by 1 mM IPTG, the medium was supplemented with 0.1 mM
FeCl3 to prevent excess accumulation of apodioxygenase. Cells were grown for three additional hours at 30°C and then
harvested by centrifugation (10 min; 4°C; 10,000 × g). The cell pellet was washed with 33 mM Tris-HCl, pH 8.0, and
stored at
70°C. For further processing, cells were thawed on ice,
resuspended in 20 ml of 33 mM Tris-HCl, pH 8.0 (9), and
broken by two passages through a chilled French pressure cell (Aminco,
Silver Spring, Md.) at 10,000 lb/in2. All further
purification steps were carried out at 4°C. A protocol for
purification of TetC was designed as a three-step procedure avoiding
high ammonium sulfate concentrations and including a fast-flow
Pharmacia DEAE Sepharose column, a HiLoad 16/60 (Superdex 200) gel
filtration column from Pharmacia, and a Ceramic Hyper DF column
(BioSepra SA, Gergy Saint Christophe, France). The crude extract was
centrifuged at 18,000 × g for 30 min, and the
supernatant was applied on the DEAE column equilibrated with 50 mM
Tris-HCl buffer, pH 8.0. Protein was eluted with a linear gradient of 0 to 700 mM NaCl in this buffer. The brownish fractions containing the
desired activity were combined, concentrated, and desalted on an Amicon
filtration unit with a 10,000-Da exclusion membrane. Gel filtration was
performed with the above-described Tris-HCl buffer, containing 0.1 M
NaCl, at a reduced flow rate of 0.5 ml/min. The Ceramic Hyper DF column
was equilibrated with 50 mM Tris-HCl, pH 8.0, and the protein applied
was eluted with a linear gradient of NaCl. Samples were pooled and
desalted. Eventually, a Mono-P column (HR5/20) from Pharmacia which
resolves pI differences of 0.02 pH unit was used for further
purification. Equibration of the column was performed using 25 mM
Tris-acetate buffer (pH 8.3). For resolution, a pH range of 8 to 5 was
chosen by mixing Polybuffer 96 (30%) with Polybuffer 74 (70%) from
Pharmacia and adjusting the pH at 5.0 with acetate. Highly purified
protein from the Ceramic Hyper DF column was loaded and eluted with a
linear flow of 0.5 ml/min for approximately 8 column volumes. The
eluted protein was fractionated for further treatment, consisting of
polybuffer removal by gel filtration, and concentrated.
Analytical methods.
The apparent subunit molecular mass of
the polypeptide and the purity of fractions were determined by sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) under
denaturing conditions with 12% (wt/vol) polyacrylamide according to
the method of Laemmli (30). SDS-PAGE was performed using
an SE200 small vertical slab-gel unit (Hoefer Pharmacia). Gels were
stained overnight with a commercial Coomassie blue solution (Roti-Blue;
Roth) with a sensitivity comparable to that of silver staining,
allowing detection of less than 30 ng of protein. The apparent
molecular weight of the holoenzyme was determined by gel filtration on
a calibrated Superdex 200 column (Pharmacia) eluted at a flow rate of
0.5 ml/min with 50 mM Tris-HCl, pH 8.0, containing 100 mM NaCl.
Standards for calibration were from Bio-Rad.
The exact molecular masses of polypeptides were determined by
electrospray ionization tandem mass spectrometry on a Finnigan MAT TSQ
700 triple quadrupole mass spectrometer equipped with an electrospray
ion source (Finnigan MAT Corp., San José, Calif.). Desalted
samples were dissolved in acetonitrile to approximately 10 pmol/ml and
injected at a flow rate of 1 ml/min. A voltage of 5.5 kV was applied to
the electrospray needle. The theoretical average mass of monomeric TetC
including the initial methionine was calculated by means of the program
PAWS (R. C. Beavis, New York University/Skirball Institute),
taking into consideration the statistical isotope distribution.
The pI of the enzyme was determined under nondenaturing conditions,
using the Pharmacia Phast system for isoelectric focusing,
according to
the protocol of the manufacturer. An isoelectric
focusing kit was used
as the standard marker. The same system
was applied for electrophoretic
titration curve analysis over
a pH range of 3 to 9. All gels were
stained with a commercial
silver staining kit from
Pharmacia.
For N-terminal sequencing, the protein was transferred to a
microcentrifuge vial, dried in a Speed Vac, redissolved in 50%
acetonitrile, applied to a Bioprene-treated, precycled glass fiber
filter, and sequenced by automated Edman degradation with an Applied
Biosystems sequencer (pulsed-liquid; model 473A) with on-line
high-performance liquid chromatography (HPLC) detection of
phenylthiohydantoin-derivatized
amino
acids.
EPR and UV-visible spectroscopy.
Electron paramagnetic
resonance (EPR) spectra were recorded on a Varian E 109 spectrometer
equipped with a helium flow cryostat (ESR 900; Oxford Instruments).
Spin concentrations were determined by double integration of the
signals and compared to a reference of multiple iron concentrations.
UV-visible absorption spectra were recorded on an HP8452A diode array
spectrophotometer (Hewlett-Packard), the cuvette holder of which was
connected to an anaerobic glove box through optic fibers and adapters
(Spectrofip 8452; Photonetics). The raw data were corrected with a
cubic spline fit using the program Kaleidagraph (Synergy Software,
Inc.).
Enzyme assays and kinetic measurements.
Protein
concentrations were determined by the method of Bradford with bovine
serum albumin as a standard (6). All enzyme assays were
performed at 25°C with a spectrophotometer (UV 2100; Shimadzu Corp.,
Kyoto, Japan) as described previously (49). Specific
activities are expressed as units per milligram of protein; 1 U is
defined as 1 µmol of substrate transformed per min. The extinction
coefficients for chloromuconates reported by Dorn and Knackmuss
(16) and Sander et al. (54) were used for the
determination of catechol 1,2-dioxygenase (C120; EC 1.13.11.1) activity
and that of its derivatives. Slow reactions were monitored by HPLC. Kinetic data were analyzed with the ENZPACK computer software (P. A. Williams, ENZPACK manual, Elsevier-Biosoft Cambridge, United Kingdom). Considerations of interaction of substrates with proteins in
regard to mechanisms of inhibition followed previously published outlines (20).
Transformation experiments with chlorocatechols of the
4,5-halogenation type.
For turnover experiments, 0.1 to 1 mM
concentrations of 4,5-dichloro-, 3,4,5-trichloro-, or
tetrachlorocatechol were incubated with purified protein (10.6 to 53 µg) in 1 ml of 33 mM Tris-HCl buffer (pH 8.0) for 12 h. Samples
from these assays were analyzed by HPLC as described previously
(49). The net elution volumes of metabolites by a 36%
methanol-H2O solvent system were 3.4 min for
2,3,5-trichlorodienelactone and 9.1 min for
3,4-dichloro-cis,cis-muconic acid. Conversion of
tetrachlorocatechol to the corresponding tetrachloromuconic acid was
detectable as its cyclization product, 2,3,5-trichlorodienelactone, only after the sample was acidified to pH 1.5. This allows the prevention of on-column cycloisomerization caused by the acidic conditions used for separation by HPLC (49). The
structural identity was confirmed by gas chromatography-mass
spectrometry (GC-MS) analysis of the respective products after
extraction and derivatization of samples from enzyme assays as
described earlier (49). Quantification of
3,4,5-trichlorocatechol transformation was performed by substrate
depletion analysis, due to instability of the corresponding
chloromuconic acid under conditions of separation by HPLC.
Insertion of Fe(III) into apodioxygenase.
Experimental
removal of Fe(III) from the catalytic center of TetC was carried out
through chromatography of this polypeptide on a Mono-P column
(Pharmacia) as described above and subsequent gel filtration, also as
described above. Experiments for reconstitution of the activity of apo
TetC were performed with protein concentrations of 10 to 27 µg/ml in
33 mM Tris-HCl buffer (pH 8.0) containing 0.1 or 0.2 mM Fe(III) in the
presence of different concentrations of ammonium sulfate (0.5 to 2.0 M)
and with 3-chlorocatechol as a substrate. Different incubation
temperatures were tested (25 to 40°C), as were different incubation
times (1 to 20 min) at appropriate intervals.
Chemicals.
Tetrachlorocatechol and 3,4,5-trichlorocatechol
were purchased from Aldrich (Steinheim, Germany) and Promochem (Wesel,
Germany), respectively. 3-Chloro-, 4-chloro-, 3,5-dichloro-,
3,6-dichloro-, 4,5-dichloro-, and 3,4,6-trichlorocatechol were
kindly provided by H.-A. Arfmann (GBF). Stock solutions of
chlorocatechols were prepared in dimethyl sulfoxide. All chemicals used
in this study were of the highest commercially available grade.
 |
RESULTS AND DISCUSSION |
Genetic organization of the tet cluster.
From
total DNA extracted from P. chlororaphis RW71, a region
encoding a cycloisomerase and other chlorocatechol degradation genes was cloned and sequenced (Fig. 1).
Among the six open reading frames (ORFs) detected on the 8.1-kb
KpnI fragment of plasmid pTP19, five ORFs were assigned by a
homology search to the chlorocatechol operon genes and named
tetRtetCDEF (Fig. 1). The gene tetR, encoding a
regulatory protein (transcriptional activator), is divergently transcribed from the genes specifying the chlorocatechol
1,2-dioxygenase (tetC), the chloromuconate cycloisomerase
(tetD), the ORFH, to which no function was assigned, the
chlorodienelactone hydrolase (tetE), and the
chloromaleylacetate reductase (tetF). The chlorocatechol operon tet identified in RW71 is therefore organized
identically to the corresponding clusters of pP51
(68), pNH91 (41), pAC27 (21),
pJP4 (14, 31) and, to a lesser extent, pEST4011
(28). An additional ORF was detected on the 8.7-kb
BamHI fragment (pTP18) and termed ORFP. It was identified
about 1.1 kb downstream of tetF and appeared to be
divergently transcribed. A similar structural element was recently
reported at the same position on pNH91, a chlorocatechol pathway
catabolic plasmid from Alcaligenes eutrophus (41). Comparison of the amino acid sequence specified by
ORFP with sequences available in databases indicated some similarities with cellular transporter systems, possibly responsible for the uptake
of branched-chain amino acids (1, 26). The
1,519-bp region upstream of ORFP and the 1,454-bp region
downstream of tetR did not show any significant homology to
published sequences.

View larger version (9K):
[in this window]
[in a new window]
|
FIG. 1.
Genetic organization of the catabolic tet
operon and its environment. The tetRCDEF genes and
the open reading frame, ORFP, from plasmids pTP18 and pTP19 are
schematically presented. The arrows show the location and direction of
transcription. The upper line indicates the lengths of sequenced DNA
fragments in front of and behind the degradative gene cluster.
|
|
Detailed analyses revealed that plasmids pTP18 and pNH91 share an
almost identical 2,087-bp region downstream of
tetF and
cbnD, respectively, with the exception of a 28-bp insert
specific
to pTP18 between
tetF and ORFP (Fig.
1). Downstream
of this 2,087-bp
region, the
cbn locus ends with a
sequence encoding the insertion
element IS
1600. No such
structure was found on the remaining 1,293
bp sequenced from pTP18. The
same nucleotide sequence was located
2 kb upstream of
cbnR
on pNH91, forming the chlorocatechol catabolic
transposon
Tn
5707 with an overall size of 15 kb (
41).
Comparable
structural elements were not reported from the flanking
regions
of the corresponding chlorocatechol operon structures
of pP51,
beyond
tcbF. The extended analysis of the flanking
regions of
the chlorocatechol operon on pJP4 of
Ralstonia
eutropha JMP134
has also shown an insertion sequence, ISJP4,
flanking the truncated
regulatory genes
tfdT(I)
and
tfdK(II) (
32). A much larger
conjugative
element of 105 kb of the 3-chlorobenzoate-degrading strain
Pseudomonas sp. B13, carrying the chlorocatechol pathway
genes, has been reported
by Ravatn et al. (
50). Although
they are not identified on pTP18
and pTP19, the existence of such
mobilizing elements cannot be
definitively excluded, since many
catabolic sequences are located
on transposon structures
(
61). The catabolic potential for
1,2,3,4-tetrachlorocatechol
mineralization was found to be highly
unstable in strain RW71
(
49), suggesting localization of
this genetic information on
a plasmid: PCR analysis of total DNA
extracted from strains of
cured phenotype, using oligonucleotide pairs
TP2-TP6 and TP31-TP32,
did not detect the presence of any
chlorocatechol operon genes.
The loss of the initial
chlorobenzene dioxygenase and
cis-chlorobenzene
dihydrodiol
dehydrogenase system cannot be ruled out: such not
very stable genes
were already found on transposon Tn
5280 of pP51
from
Pseudomonas sp. strain P51 (
64,
69) and may be
present
on unstable or transmissible transposon structures in
RW71.
Phylogenetic relationship between (chloro-)catechol catabolic genes
and enzymes.
The sequences of the genes specified by the
tet operon share a high degree of similarity with
those encoded by the operons tcb and cbn
of plasmids pP51 and pNH9, respectively (Table
1). On the amino acid level, identities
are superior to 99% for the regulator protein, the chloromuconate
cycloisomerase, the chlorodienelactone hydrolase, and the maleylacetate
reductase. The identity of the intracistronic ORF is also significantly
high, and only the chlorocatechol 1,2-dioxygenase, TetC, exhibits
slightly reduced identity (95%) with TcbC from Pseudomonas
sp. strain P51. The sequences of the enzymes specified by the
operons tet, tcb, and cbn show
relatively low similarities with those of the type II enzymes
(14, 57): from 52 to 57% for the transcriptional
activators, from 58 to 68% for the chlorocatechol 1,2-dioxygenases,
from 76 to 84% for the chloromuconate cycloisomerases, from 52 to 53%
for the chlorodienelactone hydrolases, and from 55 to 59% for the
chloromaleylacetate reductases. Similarities with genes encoding the
catechol pathway (type I pathway) (8) of gram-negative and
even of gram-positive bacteria (19) are in the range of
only 30 to 40%. These three levels of similarity described above allow
a clear discrimination of the different (chloro-)catechol
catabolic enzymes into several groups: the tcb,
cbn, and tet catabolic operons may be
distinguished from the classical type I (cat) and type II
(clc and tfd). Possibly we have to add to the
above group of sequences those of
the 1,2,4-trichloro- and 1,2,4,5-tetrachlorobenzene-degrading strains
Burkholderia (Pseudomonas) sp. strain PS12 and
Acidovorax (Pseudomonas) sp. strain PS14
(54): the sequence of the N-terminal amino acids of the
chlorocatechol 1,2-dioxygenase of PS14 (28 amino acids) is identical to
those of CbnA, TcbC, and TetC (63). Accordingly,
similarities to ClcA and TfdC are below 55%. The 14 N-terminal amino
acids of the chloromuconate cycloisomerase of PS14 (63)
share a relatively high degree of similarity with TfdD of pJP4
(74%) and ClcB of pAC27 (83%), but this sequence is again much closer
to those of both TetD of strain RW71 and CbnD of strain NH9 (>97%)
and fully identical to that of TcbD of P51. Strains PS12 and PS14 share
many of their catabolic features with strain RW71. This is possibly due
to the fact that all three isolates were obtained from the same source,
a chlorophenoxy herbicide and lindane production site where surplus
waste isomers had been dumped (54).
General biochemical characterization of recombinant TetC.
From plasmid pTP19 containing an 8.1-kb DNA fragment from
P. chlororaphis RW71, the gene tetC was PCR
amplified and inserted into the T7-based overexpression system pET9a.
The resulting plasmid, pTP20, was introduced into E. coli
strain BL21(DE3)(pLysS) cells. Supplementing the medium with 0.1 mM
Fe(III) was found to significantly increase the production of
holodioxygenase, since the specific activity of the crude extract,
reproducibly, was then threefold higher. The purification resulted in
an almost homogeneous preparation. The recombinant TetC migrated on
this SDS-12% PAGE as a single band of 30 kDa (Fig.
2). About 10 to 15 mg of purified
recombinant protein/liter of wet cells was obtained, equivalent to a
20% yield at a purification factor of 2.5.

View larger version (99K):
[in this window]
[in a new window]
|
FIG. 2.
SDS-PAGE analysis of purification of TetC. Crude extract
from uninduced cells of E. coli BL21(DE3)(pLys S)
harboring pTP20 are shown in lane 1; extracts from IPTG-induced cells
are shown in lane 2. Lanes 3 to 5 show results from the purification:
lane 3, fraction from DEAE chromatography; lane 4, fraction from gel
filtration; lane 5, fraction from Ceramic Hyper DF column
chromatography. Lane M, protein standards in kilodaltons. Approximately
1.5 µg of protein was loaded in each of lanes 3 to 5.
|
|
The N-terminal amino acid sequence of the purified protein was
determined by Edman degradation and found to be fully identical
to the
sequence of the polypeptide specified by
tetC and
tcbC (
65) and to the chlorocatechol
1,2-dioxygenase of 1,2,4,5-tetrachlorobenzene-degrading
Acidovorax sp. strain PS14 (
63). The average
molecular mass
of the TetC monomer obtained by electrospray ionization
tandem
mass spectrometry (27,474 Da) appears to be in full agreement
with the theoretical value of the polypeptide, including the initial
methionine. The apparent molecular mass of 67.5 ± 3 kDa
determined
by gel filtration indicated that the purified holoenzyme
behaves
in these experimental conditions as a
homodimer.
The isoelectric point of the holoenzyme was determined experimentally
to be 5.8. Titration curve analyses (IEF) of freshly
purified TetC were
performed on polyacrylamide gels run under
nondenaturing conditions, in
order to confirm the homogeneity
of the preparation. Four dominant
bands were observed, although
the polypeptide content was homogeneous
according to SDS-PAGE
and mass spectrometric analysis. In light of
these results, an
additional chromatofocusing step for further
purification of TetC,
followed by removal of polybuffer by means of gel
filtration,
was carried out. During this step the protein lost its
characteristic
reddish color and became inactive, as only ca. 0.1% of
the initial
activity was remaining. Constituents of the amphoteric
buffer
system seemed to inhibit the enzyme by chelating and removing
the Fe(III) ion from the active site. Whereas this fraction of
inactive
TetC lacking its ferric iron could not be crystallized,
reddish-brown
crystals of TetC were obtained in a glycine-NaOH
buffer (pH 9.1) with
sodium formate as the precipitant, using
the purest active
fraction, corresponding to lane 5 of Fig.
2.
In the following
isoelectric focusing titration of such a crystal
dissolved in water,
only a single major band was detected, and
when the gel was highly
overloaded in order to visualize impurities,
only a single, weakly
contaminating band was visible. The major
band should represent the
catalytically active holodioxygenase.
Another single band at a
different position in a focusing gel
was obtained from colorless,
catalytically inactive TetC from
the above-described chromatofocusing
procedure. The heterogeneous
pattern of four major bands mentioned
above is, therefore, assumed
to be composed of monomeric and dimeric
apo- and
holodioxygenases.
Measurement of the iron content of recombinant TetC and attempts at
reconstitution of the holoenzyme.
Earlier determinations of the
iron content of several catechol 1,2-dioxygenases and chlorocatechol
1,2-dioxygenases did not clarify if one iron ion was present in each
monomer or one single iron atom was bound at the interface or only in
one monomer per holoenzyme. Ratios per homodimer of one iron atom
(9, 36, 37, 55), two iron atoms (8, 39, 45),
or from 0.6 to 0.89 iron atom (5, 60) were reported.
Quantitation of the iron content of different TetC preparations was
carried out by means of EPR spectroscopy, the isotropy at maximal
rhombicity allowing for the detection of small quantities of bound
ferric iron by comparison with a standard (22). Assuming
from the isoelectric focusing analysis that less than one third of the
protein sample was in a holoform in the first two samples, the iron
content measured was close to 0.9 iron atom per monomer. For another
sample exhibiting a 1.3-fold higher specific activity for
3-chlorocatechol, a signal consistent with 1.1 iron atoms per monomer
was measured. Unspecific binding of additional iron on the protein
surface may have led to this minute overestimation.
Previously reported reconstitution experiments on intradiol
apodioxygenases had indicated that ferrous iron could be incorporated
into the enzyme and then oxidized to the active ferric form
(
39),
a mechanistic study not confirmed up to now.
Zaborina et al. (
73)
have reported reconstitution of 40%
of the activity of the intradiol-cleaving
6-chlorohydroxyquinol
1,2-dioxygenase from
Streptomyces rochei 303 by the
addition of Fe(II) in a time-dependent reaction after
the initial
activity had been completely inhibited by the chelator
Tiron at a
0.1 mM concentration. Attempts at insertion of Fe(II)
and Fe(III) into
the active site of the apodioxygenase were carried
out with the
apoprotein obtained by means of MonoP chromatography.
Different
parameters were checked, such as Fe(II), Fe(III), and
ammonium
sulfate concentrations, the incubation temperature, and
the
incubation time. Reconstitution of holoTetC was monitored
through
measurement of 3-chlorocatechol dioxygenation activity,
but even in the
best conditions [incubation of apo-TetC with 0.1
mM Fe(III) and 1.3 M
ammonium sulfate], no reactivation of more
than 2% of the maximal
activity of the holoenzyme preparation
was
obtained.
Kinetic properties of recombinant TetC.
Chlorocatechols of the
4,5-halogenation type have been classified as high-affinity inhibitors
for diverse (chloro-)catechol 1,2-dioxygenases (9, 16, 23, 58,
63). Ki values for 4,5-dichlorocatechol
and tetrachlorocatechol were 30 and 5 nM, respectively, for the
dioxygenase of the chlorobenzoate-degrading strain
Pseudomonas putida AC27 (9) and 4 and 108 nM
for the dioxygenase of Acidovorax (formerly
Pseudomonas) sp. strain PS14 (63). The latter
enzyme was shown to be competitively inhibited by 4,5-dichloro- and
3,4,5-trichlorocatechol but uncompetitively inhibited by
tetrachlorocatechol, with catechol as the substrate.
(i) Spectrum of substrates cleaved by TetC.
Specific
activities and kinetic parameters of recombinant TetC were determined
for the whole range of chlorinated catechols (Table
2). The ratio of specific activities for
3-chlorocatechol to those for catechol for TetC (3.16) is about 50%
higher than that of the chlorocatechol 1,2-dioxygenase from
Burkholderia (formerly Pseudomonas) sp. strain
PS12 (2.17) (54) and much higher than those of the others
so far described in the literature (reviewed in reference
51). From results shown in Table 2 it is evident that
3,5-dichlorocatechol is the preferred substrate, followed by
3-chlorocatechol, as indicated by high values for the ratio kcat/Km. For the
4,5-halogenated chlorocatechols, exact Michaelis-Menten constants
during long-term HPLC-based depletion measurements could not be
determined. They have to be assumed to be in the lower micromolar
range. Consequently, no specificity constants were calculated,
but they should be similar to that for 3-chlorocatechol, since there
was no inhibition of 3-chlorocatechol turnover in their presence.
The specificity constant for the TetC preparation with
3,5-dichlorocatechol is threefold higher than that reported for the
so-called 3,5-dichlorocatechol 1,2-dioxygenase of
Burkholderia (formerly
Pseudomonas)
cepacia strain CSV90 (
5). It should
be
threefold higher for the pure TetC holoenzyme. The enzyme of
Pseudomonas chlororaphis RW71 exhibits a significantly
broader
substrate tolerance compared to the substrate pattern of other
enzymes (
51), such as that of the already mentioned strain
PS12
(
54) or of
Pseudomonas sp. strain P51
(
65).
(ii) 4,5-substituted chlorocatechols are transformed by TetC.
The major part of the above-cited literature reported that
chlorocatechols of the 4,5-substitution pattern were not productively transformed by (chloro-)catechol dioxygenases. It was shown recently that strain RW71 degrades 1,2,3,4-tetrachlorobenzene via
tetrachlorocatechol (49). This obvious contradiction,
therefore, needs to be elucidated in more detail. Spectral changes
during conversion of 4,5-dichloro-, 3,4,5-trichloro-, and
tetrachlorocatechol, respectively, were monitored in the UV range (230 to 350 nm; plots not shown). Overlay spectra displaying prolonged
transformation of the three compounds were recorded and revealed new
maxima at 268 nm for 3,4-dichloromuconate, at 273 nm for
2,3,4-trichloromuconate, and at 275 nm for tetrachloromuconate, in
accordance with the typical increase of absorption for (chloro-)muconic acids (15, 53). The products from these conversions were
resolved by reverse-phase HPLC. Acidified samples were extracted with
ethyl acetate and methylated for structure elucidation by GC-MS.
Interpretation of results from fragmentation revealed dimethylated
3,4-dichloromuconic acid, dimethyl 2,3,4-trichloromuconate (Fig.
3), and dimethyl tetrachloromuconate,
respectively. The molecular ion of dimethylated 3,4-dichloromuconate
(m/z = 239) is of very low intensity (0.1%); loss of
one carboxymethoxy group from the molecular ion forms the base peak at
m/z = 179. The peak observed at m/z = 203 is formed due to the loss of a first chlorine (Fig. 3A). The mass spectrum of the dimethylester of 2,3,4-trichloromuconic acid (Fig. 3B)
indicates the loss of chlorine from the molecular peak at m/z = 272 (0.3%), resulting in the signal at
m/z = 237. The signal at m/z = 213 represents the loss of one carboxymethoxy group (m/z = 59) from the molecular ion and corresponds to the theoretical value for
a trichlorinated substance; the one at m/z = 237 is that of a dichlorinated structure. The general cis,cis
configuration is assumed for all muconates. The product from the
conversion of tetrachlorocatechol has already been characterized
(49). Traces of these chloromuconates had already been
identified in transformation experiments with crude cell extracts of
Burkholderia (formerly Pseudomonas) sp. strain
PS12 (53). The novelty of TetC is a substrate pattern that
includes the chlorocatechols with chlorine atoms at positions 4 and 5 and their productive transformation in the cascade of the
chlorocatechol pathway, allowing RW71 to grow at the expense of
1,2,3,4-tetrachlorobenzene. The 4,5-halogenated chlorocatechols
have previously been shown to be transformed by other organisms
or their corresponding enzymes at extremely low rates at high
concentrations of enzyme only (11, 46, 53, 55).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 3.
Identification of products from transformation of
4,5-substituted chlorocatechols. Characteristic fragmentation pattern
from GC-MS analysis of methylated extracts from conversion of
4,5-dichlorocatechol and 3,4,5-trichlorocatechol by recombinant TetC
are depicted. 70 eV mass spectra of 3,4-dichloromuconic acid
dimethylester (A) and 2,3,4-trichloromuconic acid dimethylester (B) are
shown. Rel., relative.
|
|
In order to determine the consistency of the catalytic activity of TetC
over a prolonged period of time, conversions by recombinant
TetC of
0.19 mM solutions of 4,5-dichloro-, 3,4,5-trichloro-,
and
tetrachlorocatechol were followed by HPLC analysis for 420
min
(Fig.
4). Depletion of
tetrachlorocatechol was completed after
200 min, and
4,5-dichlorocatechol was transformed within 420 min,
whereas 39% of
the initial concentration of 3,4,5-trichlorocatechol
was still detected
after this time span. Further slow conversion
until complete depletion
was noticed when measured upon overnight
incubation. At a protein
concentration in this assay of 21.2 µg/ml,
which corresponds to 1 µM, the turnover efficiency of the enzyme
with these three substrates
was determined to be relatively low,
corresponding to a rate of about 2 to 3% of the turnover rates
of the other chlorocatechols. Initial
specific transformation
rates were relatively stable over the first 60 min and were 70,
42, and 78 mU per mg of protein for
4,5-dichlorocatechol, 3,4,5-trichlorocatechol,
and tetrachlorocatechol,
respectively. Interestingly, conversion
rates showed a sudden decrease
after 1 h, probably due to the
formation of highly stable enzyme
product complexes of small dissociation
constants, formerly identified
as the rate-limiting step of substrate
turnover, by catechol
1,2-dioxygenase (
71) and protocatechuate
3,4-dioxygenase
(
10,
11,
70). On the other hand, inactivation
of the
biocatalyst under the test conditions in the presence of
an excess of
the phenolic substrates cannot be ruled out.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 4.
Kinetics of transformation of 4,5-substituted
chlorocatechols. The time course of the conversion by purified TetC
of 0.2 mM 4,5-dichlorocatechol ( ), 3,4,5-trichlorocatechol ( ),
and tetrachlorocatechol ( ) at 21.2 µg of protein per ml is
shown.
|
|
Therefore, more detailed transformation assays were performed over
12 h with up to 1 mM concentrations of 4,5-halogenated
catechols.
With a high concentration of substrate, such as 0.4
mM, the addition of
21 µg of protein per ml led to a 30% decrease
in the substrate
concentration. However, at concentrations of
0.2 mM or below,
substrates were productively transformed (Fig.
5A to
C). Further, we could clearly demonstrate
with the substrate
3,4,5-trichlorocatechol that the ratio of substrate
to enzyme
is crucial (Fig.
5B), providing evidence for inactivation by
the
substrate. Control experiments revealed that none of these
substrates
have been absorbed onto glass surfaces or transformed in the
absence
of TetC. Similar observations for other 1,2-dioxygenases have
not yet been reported, and therefore these results cannot be compared
with those from other studies. In terms of amenability of this
enzyme
to applications, however, such parameters appear important.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 5.
Concentration-dependent effects on the efficiency of
TetC. Depletion of halocatechols and formation of halomuconates at
incubations of various concentrations of 4,5-dichlorocatechol
(4,5-DCCat) (A), 3,4,5-trichlorocatechol (3,4,5-TCCat) (B), and
tetrachlorocatechol (TeCCat) (C) by TetC are shown. Initial and
residual concentrations were determined after 12 h by HPLC.
Tetrachloromuconic acid formation was monitored by its
cycloisomerization product, 2,3,5- trichlorodienelactone, which
was formed after acidification of the assay. Transformation of
3,4,5-trichlorocatechol was followed by substrate depletion because of
the high level of instability of its corresponding product,
2,3,4-trichloromuconic acid. Protein amounts displayed are rounded to
whole numbers.
|
|
(iii) Inhibitory features.
In order to elucidate aspects of
the inhibitory features of 4,5-dihalogenated catechols on the
conversion of catechol and its lower chlorinated derivatives,
transformation experiments with a mixture of catechol and
3-chlorocatechol, 4,5-dichlorocatechol, or tetrachlorocatechol were
performed. These may provide deeper insight into the process of
transformation than simple Ki determinations. Results shown in Fig. 6A clearly
indicate that the conversion of catechol was completely inhibited until
depletion of tetrachlorocatechol was exhaustive. This inhibition was
clearly competitive. However, when tetrachlorocatechol and
3-chlorocatechol were simultaneously offered to TetC, the two compounds
were converted at similar rates. Interestingly, the conversion of the
latter compound was slightly slower than that of the former (Fig. 6C).
Although there was some inactivation of TetC after 2 h, visible
through a sharp decline of the rate of 4,5-dichlorocatechol turnover
into 3,4-dichloromuconate, catechol was not significantly transformed
into muconate (Fig. 6B). This, however, proceeded upon overnight
incubation, after complete turnover of 4,5-dichlorocatechol (not
shown). Similar to the results described for tetrachlorocatechol,
the transformation of 3-chloro- and 4,5-dichlorocatechol
proceeded almost in parallel, with simultaneous production of both
corresponding chloromuconates (Fig. 6D). The formation of
corresponding (chloro-)muconate was confirmed in all these
experiments, except for tetrachloromuconate, which cycloisomerizes
during analysis by HPLC. The inhibitory features described for TetC
have never been reported for all hitherto known (chloro-)catechol
dioxygenases.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 6.
Effects of 4,5-substituted halocatechols on conversion
of catechol and 3-chlorocatechol. Transformation by TetC (21.2 µg of
protein per ml) of 0.1 mM catechol is shown in the presence of
equimolar concentrations of tetrachlorocatechol (A) and
4,5-dichlorocatechol (B). Muconate was detected as its corresponding
dienelactone. Transformation of 0.1 mM 3-chlorocatechol was in the
presence of equimolar concentrations of tetrachlorocatechol (C) and
4,5-dichlorocatechol (D). Concentrations of catechol ( ),
3-chlorocatechol ( ), 4,5-dichlorocatechol ( ), tetrachlorocatechol
( ), muconic acid ( ), 2-chloromuconic acid (+), and
3,4-dichloromuconic acid ( ) are shown.
|
|
(iiii) Stability of TetC over time.
The stability of the
enzyme was monitored. A loss of 40% of the initial activity was
detected when recombinant TetC was stored at 4°C. Storage at 20°C
over the same period of time resulted in a loss of activity of 93%.
Aliquots of the protein stored for 1 week at
70°C and for a long
period, about 5 months, showed no measurable loss of specific activity
after thawing and after subsequent storage on ice within 12 h.
Spectroscopic properties of recombinant TetC in the presence of its
substrates.
The catalytic properties of TetC, featuring productive
breakdown of 4,5-dihalogenated catechols, deserve a closer view at the
active site. The absorption spectra of TetC were measured in the
presence of these substrates, as were its EPR parameters. Such
investigations had been performed earlier with the type II catechol
1,2-dioxygenase of P. putida AC27 but with catechol as the substrate only (9). Halogenated catechols and
particularly those considered as strong inhibitors of this class of
enzymes should be tested, therefore, with TetC.
The electronic absorption spectra of the native enzyme and the
enzyme-substrate complexes maintained under anaerobic conditions
are
shown in Fig.
7. The broad absorption
spectrum of TetC with
a maximum of 444 nm is typical for a ligand to
Fe(III) charge-transfer
transition due to tyrosinate coordination (Fig.
7A) (
9). The
addition of 3-chlorocatechol to the
protein incubated in an anaerobic
environment resulted in an
increase of its absorbance and led
to a red shift of its initial
absorption maximum to 506 nm (Fig.
7B). Successive dilution of the
anaerobic reaction mixture with
air-saturated buffer resulted in an
increasing absorption at 260
nm, the absorption maximum of the reaction
product, 2-chloromuconic
acid. Depletion of 3-chlorocatechol, however,
did not result in
the expected clear back-shift to its initial
absorption spectrum.
The addition of 0.2 mM tetrachlorocatechol to the
relatively high
concentration, 0.1 mM, of TetC (Fig.
7C) shifted the
maximum absorption
to 560 nm, but with significantly reduced intensity.
Successive
dilution with air-saturated buffer then backshifted the
maximum
absorption to the initial maximum of the protein, indicative of
complete transformation of the substrate. The experimental complex
of TetC with 4,5-dichlorocatechol showed a maximum absorption
at 524 nm
(Fig.
7D). No change of the absorption spectrum was
recorded during
addition of air-saturated buffer, although some
slow transformation of
this substrate had been detected as described
above by
spectrophotometrical tests and HPLC analysis. It seems
probable that
residual substrate was still bound to the active
center of the enzyme,
confirming the strong inhibitory character
of 4,5-dichlorocatechol. Not
only sterical but also electronic
features with regard to inhibition of
ortho-cleaving enzymes have
to be taken into account, and
4,5-dichlorocatechol should better
fit into the active site cavity of
TetC than the more bulky substrate
tetrachlorocatechol. An excellent
and detailed study on inhibitory
complexes with protocatechuate
3,4-dioxygenase has been published
recently (
44), with
halogenated substitutes of protocatechuate
being the most potent
inhibitors.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 7.
Electronic absorption spectra of TetC. (A) The
absorption of a preparation of purified enzyme in 33 mM Tris-HCl
buffer-50 mM NaCl (pH 8.0) was recorded at room temperature. The dimer
solution (curve numbers are in parentheses) was 0.3 mM
(1), 0.1 mM (2), and 0.01 mM
(3). (B) Electronic absorption spectra of 0.1 mM dimeric
polypeptide TetC (1) and the enzyme-substrate complex with
0.1 mM 3-chlorocatechol in 33 mM Tris-HCl-50 mM NaCl (2).
The addition of 100 µl of air-saturated buffer resulted in curve 3, and a fourfold dilution with buffer resulted in curve 4. (C) Absorption
spectra of the enzyme (1) and the enzyme-substrate complex
(2) with 0.2 mM tetrachlorocatechol. Spectra upon addition
of 200 µl (3) and 400 µl (4) of
air-saturated buffer are shown. (D) Native enzyme (1) and
the enzyme-substrate complex (2) in the presence of 0.1 mM
4,5-dichlorocatechol. Spectra upon addition of 50 µl
(3), 100 µl (4), and 200 µl
(5) of air-saturated buffer are shown. All absorption
spectra of enzyme-substrate complexes were anaerobically recorded at a
concentration of 0.1 mM dimeric polypeptide.
|
|
Further, EPR spectroscopic studies of the recombinant TetC dioxygenase
were carried out in the presence of tetrachlorocatechol
in order to
partially characterize the environment of the Fe(III)
ligands (Fig.
8). The sharp symmetrical electron spin
resonance
signal recorded for TetC without the substrate at 4.3 G (Fig.
8A) is in full agreement with high-spin Fe(III) in a rhombic
environment
as previously found for other intradiol dioxygenases
(
8,
9).
Weak resonances centering at 9.8 G were observed
outside the plotted
range. The EPR analysis of the same sample
maintained in an argon
atmosphere immediately after addition of an
excess of tetrachlorocatechol
revealed different
g values
(Fig.
8B). The signal obtained for
TetC is anisotropic with all
possible
g values from a particular
Kramer's doublet: the
system showed three different
g values:
gx = 4.27,
gy = 4.2, and
gz = 4.4. The low-field
signal at 9.8
G broadened during the experiment and finally
disappeared.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 8.
EPR spectra of native TetC. Spectra were recorded in the
absence (A) and in the presence (B) of 1.0 mM tetrachlorocatechol. The
concentration of the protein sample was made 0.3 mM by anaerobic
dilution in 50 mM Tris-HCl, pH 8.0. The substrate solution was made
anaerobic prior to addition and was added to the protein under argon
flow. The protein was immediately frozen in liquid nitrogen and
analyzed. Both spectra were recorded at 10 K, with a microwave
frequency of 9,654 MHz, a microwave power of 0.1 mW, and a modulation
amplitude of 10 G. The strength of the magnetic field is expressed in
gauss (G).
|
|
Spectroscopic investigations on Fe(III) catecholate complexes indicated
that the active-site iron should remain in the Fe(III)
oxidation state
during the whole catalytic cycle (
17). The multidentate
ligands influence the physical properties of the metal complex:
electron-donating substituents of enzyme substrates foster an
increase
in catalytic activity, whereas electron-withdrawing groups,
like the
four chlorines of tetrachlorocatechol, decrease the dioxygen
attack by
forming a stable complex. Crystals of this compound
with incorporated
tetrachlorocatechol were shown to exhibit an
asymmetrically chelated
tetrachlorocatecholate ligand (
17).
Apparently, the iron
content of the protein is not alone responsible
for the differences in
activity. Stabilizing effects through iron-catecholate
complexes
associated with conformational changes, or adverse effects
(inactivation by denaturing agents was accelerated by catechol),
were
mentioned in earlier studies on intradiol dioxygenases
(
39).
In order to elucidate the chelating attack of
chlorocatechols
of the 4,5-substitution type on the central catalytic
iron atom
leading to the inhibition of this enzyme, a possibility
already
discussed earlier (
9), a preparation of TetC (ca.
1 µM) was
incubated with an excess of tetrachlorocatechol (1 mM). A
pinkish-violet
color was formed, which had been observed earlier in
some of the
growth experiments performed with strain RW71
(
49). This was
possibly due to the inefficient induction
of the expression of
chlorocatechol pathway genes by the product of the
TetC reaction,
tetrachloromuconic acid, in the necessarily productive
triggering
by the transcriptional activator, TetR. In our
experiments, the
UV-visible spectrum of the tetrachlorocatechol-enzyme
[iron(III)]
complex proved to be identical with that obtained with
ferric
iron in the presence of 4,5-halogenated catechols, especially
with tetrachlorocatechol. We found that the central ferric iron
atom of
recombinant TetC was removed from the active site of the
holoenzyme in
the presence of 1 mM tetrachlorocatechol. This observation
was
unambiguously proved by filtration of the solution through
a
10,000-Da exclusion membrane and subsequent control of
compartmentation
of the polypeptide through protein determinations.
Unfortunately,
we were not able to apply this assay for the
quantitative titration
of the overall iron content of
TetC.
Conclusions.
The catechol and chlorocatechol
1,2-dioxygenases are Fe(III)-containing dioxygenases. Based
on their substrate ranges, they are historically distinguished as type
I and type II enzymes, respectively. Type I represents enzymes that
primarily convert catechol, whereas type II enzymes are induced during
growth with (low-halogenated) chloromuconates. The type II enzymes have
a wider substrate range and transform chlorinated catechols more rapidly than catechol. However, they are strongly inhibited by halocatechols simultaneously substituted in positions 4 and 5. Phylogenetic trees of ortho-cleaving dioxygenases have been
published recently (3, 19). Based on sequence homologies,
five subgroups may be distinguished within the chlorocatechol
1,2-dioxygenase family. This sequence distinction might be correlated
with substrate specificities. Indeed, very few sequence changes, only 3 out of 260 amino acids, were shown to significantly contribute to
alterations of the substrate preference of a chlorocatechol
1,2-dioxygenase (35). However, for such a functional
comparison, the available experimental data for all members of this
group are not sufficient, since the respective investigations did not
comprise the testing of all relevant substrates. In the present study,
TetC from P. chlororaphis RW71 was shown to exhibit a
broader substrate range than classical type II dioxygenases and to be
distinguished from these enzymes by its ability to productively convert
4,5-substituted chlorocatechols. For a functional comparison of
this type of dioxygenase, a type III enzyme could be proposed, with
TetC being the archetype, differentiating the chlorocatechol
dioxygenases able to convert 4,5-substituted chlorocatechols.
Additional experimental data on TcbC and CbnA are required and may
confirm a high similarity of substrate range among these enzymes,
possibly with those of strains PS12 and PS14 (63).
In order to better understand why catechol and chlorocatechol
1,2-dioxygenases exhibit such a diverse range of substrate preferences,
three-dimensional structures of representatives of the different
types
described above should be compared. A more specific focus
on the active
site is required. For this purpose, the crystallization
and
three-dimensional structure resolution of recombinant TetC
are
currently under investigation. The specificity for the turnover
of
chlorocatechols of a high degree of halogenation and for substrates
with halogen substituents at positions 4 and 5 of the catecholic
ring
system makes this group of enzymes at least significant among
the
already well-characterized catechol 1,2-dioxygenases and chlorocatechol
1,2-dioxygenases (
51,
57). The subgroup partially
characterized
in this work thus may represent a novel alternative for
the degradation
of highly halogenated diphenolic compounds which are
also mineralized
through the chlorohydroxyhydroquinone pathway. The
discussed reaction
sequences are compared in Fig.
9 which, therefore, must be preliminary
at present. It is not fully clear to which of the three branches
those
pathways for the mineralization of 3,4-dichloro- and 3,
6-dichlorocatechol (
51,
59,
68) have to be assigned,
because
of the lack of experimental data. On the basis of specificity
constants, the enzymes characterized by Broderick and
O'Halloran
(
9) and Maltseva et al.
(
34) group with the classical type
II pyrocatechase of
Pseudomonas sp. strain B13 (
16). All of
those
enzymes have 4-chlorocatechol as the preferred substrate
and are
evolutionarily distant from the proposed type III group.
Consequently,
some further work needs to be dedicated to the comparative
experimental
confirmation of the biochemical properties of all
these enzymes, e.g.,
their expected high turnover rates and high
affinities for
polyhalogenated intermediates in the pathways for
the degradation of
polyhalocatechols. Apart from the halocatechols,
these intermediary
substrates are not commercially available and
have to be produced
biologically with the help of the corresponding
enzymes. It is evident
that the potentially different types of
transcriptional activators
especially may exhibit very high selectivity
for the triggering
compounds or show different and/or overlapping
broad ranges of
substrate tolerance. These polypeptides are assumed
to
discriminate between the individual structures of inducers,
the
monochloromuconic acids, and the more highly chlorinated homologues.
It
is quite probable that this is also true for the much more
highly
halogenated muconates in the breakdown of polychlorocatechols
and,
therefore, the specificity of transcriptional activation
of these
operons should be further investigated. Finally, our
results
suggest using strong caution in the interpretation of
data derived from
enzyme kinetics on wild-type and recombinant
catechol 1,2-dioxygenases,
especially with respect to the homogeneity
of the preparation.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 9.
Comparison of catabolic pathways. Degradative sequences
are shown for the mineralization of catechol (type I enzymes),
monochloro- and 3,5-dichlorocatechol(s) (type II enzymes), and the
polychlorocatechols (possibly type III enzymes), possibly not being
fully dehalogenated through the type II pathway sequence.
|
|
 |
ACKNOWLEDGMENTS |
Many thanks to Y. Jouanneau (CEA
Grenoble, Grenoble, France) for
enabling a short stay in his laboratory, providing the possibility to
record absorption spectra under strictly anaerobic conditions. We thank
J. Gaillard (CEA
Grenoble) for recording the EPR spectra and are
grateful for his enthusiastic discussions. We thank F. Halgand
(CNRS-Institut de Chimie des Substances Naturelles, Gif/Yvette, France)
for recording mass spectra of TetC and for the discussions on the
iron-to-subunit ratio of TetC. We are indebted to H.-J. Hecht and
S. Weissflog (GBF) for collaboration in initial crystallization attempts, to H.-A. Arfmann for synthesizing halocatechols, and to
K. N. Timmis for providing bench space.
This work was mainly supported by the Deutsche Forschungsgemeinschaft
(grants Wi 1226/2-1 and 1226/2-2).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: PD TU-BS,
Holbeinstrasse 24, D-38106 Braunschweig, Germany. Phone and fax:
49-(0)531-34 01 44. E-mail:
rolf-michael.wittich{at}t-online.de.
Present address: BioWhittaker Europe, Parc Industriel de
Petit-Rechain, B-4800 Verviers, Belgium.
Present address: Institut de Biologie Structurale, IBS-LSMP,
F-38027 Grenoble Cedex 1, France.
 |
REFERENCES |
| 1.
|
Adams, M. D.,
L. M. Wagner,
T. J. Graddis,
R. Landick,
T. K. Antonucci,
A. L. Gibson, and D. L. Oxender.
1990.
Nucleotide sequence and genetic characterization reveal six essential genes for the LIV-1 and LS transport systems of Escherichia coli.
J. Biol. Chem.
265:11436-11443[Abstract/Free Full Text].
|
| 1a.
|
Alexander, M.
1981.
Biodegradation of chemicals of environmental concern.
Science
211:132-138[Abstract/Free Full Text].
|
| 2.
|
Altschul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402[Abstract/Free Full Text].
|
| 3.
|
Armengaud, J.,
K. N. Timmis, and R.-M. Wittich.
1999.
A functional 4-hydroxysalicylate/hydroxyquinol degradative pathway gene cluster is linked to the initial dibenzo-p-dioxin pathway genes in Sphingomonas sp. strain RW1.
J. Bacteriol.
181:3452-3461[Abstract/Free Full Text].
|
| 4.
|
Beil, S.,
B. Happe,
K. N. Timmis, and D. H. Pieper.
1997.
Genetic and biochemical characterization of the broad spectrum chlorobenzene dioxygenase from Burkholderia sp. strain PS12 dechlorination of 1,2,4,5-tetrachlorobenzene.
Eur. J. Biochem.
247:190-199[Medline].
|
| 5.
|
Bhat, M. A.,
T. Ishida,
K. Horiike,
C. S. Vaidyanathan, and M. Nozaki.
1993.
Purification of 3,5-dichlorocatechol 1,2-dioxygenase, a nonheme iron dioxygenase and a key enzyme in the biodegradation of a herbicide, 2,4-dichlorophenoxyacetic acid (2,4-D), from Pseudomonas cepacia CSV90.
Arch. Biochem. Biophys.
300:738-746[CrossRef][Medline].
|
| 6.
|
Bradford, M. M.
1976.
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal. Biochem.
72:248-254[CrossRef][Medline].
|
| 7.
|
Briganti, F.,
S. Mangani,
L. Pedocci,
A. Scozzafava,
L. A. Golovleva,
A. P. Jadan, and L. P. Solyanikova.
1998.
XAS characterization of the active sites of novel intradiol ring-cleaving dioxygenases: hydroxyquinol and chlorocatechol dioxygenases.
FEBS Lett.
433:58-62[CrossRef][Medline].
|
| 8.
|
Briganti, F.,
E. Pessione,
C. Giunta, and A. Scozzafava.
1997.
Purification, biochemical properties and substrate specificity of a catechol 1,2-dioxygenase from a phenol degrading Acinetobacter radioresistens.
FEBS Lett.
416:61-64[CrossRef][Medline].
|
| 9.
|
Broderick, J. B., and T. O'Halloran.
1991.
Overproduction, purification, and characterization of chlorocatechol dioxygenase, a non-heme iron dioxygenase with broad substrate tolerance.
Biochemistry
30:7349-7358[CrossRef][Medline].
|
| 10.
|
Bull, C., and D. Ballou.
1981.
Purification and properties of protocatechuate 3,4-dioxygenase from Pseudomonas putida: a new iron to subunit stoichiometry.
J. Biol. Chem.
256:12673-12680[Abstract/Free Full Text].
|
| 11.
|
Bull, C.,
D. P. Ballou, and S. Otsuka.
1981.
The reaction of oxygen with protocatechuate 3,4-dioxygenase from Pseudomonas putida: characterization of a new oxygenated intermediate.
J. Biol. Chem.
256:12681-12686[Abstract/Free Full Text].
|
| 12.
|
Chatterjee, D. K.,
S. T. Kellogg,
S. Hamada, and A. M. Chakrabarty.
1981.
Plasmid specifying total degradation of 3-chlorobenzoate by a modified ortho pathway.
J. Bacteriol.
146:639-646[Abstract/Free Full Text].
|
| 13.
|
Daubaras, D. L.,
C. D. Hershberger,
K. Kitano, and A. M. Chakrabarty.
1995.
Sequence analysis of a gene cluster involved in metabolism of 2,4,5-trichlorophenoxyacetic acid by Burkholderia cepacia AC1100.
Appl. Environ. Microbiol.
61:1279-1289[Abstract].
|
| 14.
|
Don, R. H.,
A. J. Weightman,
H.-J. Knackmuss, and K. N. Timmis.
1985.
Transposon mutagenesis and cloning analysis of the pathways for degradation of 2,4-dichlorophenoxyacetic acid and 3-chlorobenzoate in Alcaligenes eutrophus JMP134(pJP4).
J. Bacteriol.
161:85-90[Abstract/Free Full Text].
|
| 15.
|
Dorn, E., and H.-J. Knackmuss.
1978.
Chemical structure and biodegradability of halogenated aromatic compounds: two catechol 1,2-dioxygenases from a 3-chlorobenzoate-grown pseudomonad.
Biochem. J.
174:73-84[Medline].
|
| 16.
|
Dorn, E., and H.-J. Knackmuss.
1978.
Chemical structure and biodegradability of halogenated aromatic compounds: substituent effects on 1,2-dioxygenation of catechol.
Biochem. J.
174:85-94[Medline].
|
| 17.
|
Duda, M.,
M. Pascaly, and B. Krebs.
1997.
A highly reactive functional model for catechol 1,2-dioxygenase: reactivity studies of iron (III) catecholate complexes of bis((2-pyridyl)methyl)((1-methylimidazol-2-yl)methyl) amine.
Chem. Commun.
1997:835-836[CrossRef].
|
| 18.
|
Earhart, C. A.,
M. D. Hall,
I. Michaud-Soret,
L. Que, Jr., and D. H. Ohlendorf.
1994.
Crystallization of catechol 1,2-dioxygenase from Pseudomonas arvilla C-1.
J. Mol. Biol.
236:377-378[CrossRef][Medline].
|
| 19.
|
Eulberg, D.,
E. M. Kourbatova,
L. A. Golovleva, and M. Schlömann.
1998.
Evolutionary relationship between chlorocatechol catabolic enzymes from Rhodococcus opacus 1CP and their counterparts in proteobacteria: sequence divergence and functional convergence.
J. Bacteriol.
180:1082-1094[Abstract/Free Full Text].
|
| 20.
|
Fersht, A.
1985.
Enzyme structure and mechanism, 2nd ed.
W. H. Freeman and Co., New York, N.Y.
|
| 21.
|
Frantz, B., and A. M. Chakrabarty.
1987.
Organization and nucleotide sequence determination of a gene cluster involved in 3-chlorocatechol degradation.
Proc. Natl. Acad. Sci. USA
84:4460-4464[Abstract/Free Full Text].
|
| 22.
|
Hagen, W. R.
1992.
EPR spectroscopy of iron-sulfur proteins.
Adv. Inorg. Chem.
38:165-216.
|
| 23.
|
Haigler, B. E.,
S. F. Nishino, and J. C. Spain.
1988.
Degradation of 1,2-dichlorobenzene by a Pseudomonas sp.
Appl. Environ. Microbiol.
54:294-301[Abstract/Free Full Text].
|
| 24.
|
Harayama, S., and M. Rekik.
1989.
Bacterial aromatic ring-cleavage enzymes are classified into two different gene families.
J. Biol. Chem.
264:15328-15333[Abstract/Free Full Text].
|
| 25.
|
Hartnett, C.,
E. L. Neidle,
K.-L. Ngai, and L. N. Ornston.
1990.
DNA sequences of genes encoding Acinetobacter calcoaceticus protocatechuate 3,4-dioxygenase: evidence indicating shuffling of genes and of DNA sequences within genes during their evolutionary divergence.
J. Bacteriol.
172:956-966[Abstract/Free Full Text].
|
| 26.
|
Hoshino, T., and K. Kose.
1990.
Cloning, nucleotide sequences, and identification of products of the Pseudomonas aeruginosa PAO bra genes, which encode the high-affinity branched-chain amino acid transport system.
J. Bacteriol.
172:5531-5539[Abstract/Free Full Text].
|
| 27.
|
Kivisaar, M.,
L. Kasak, and A. Nurk.
1991.
Sequence of the plasmid-encoded catechol 1,2-dioxygenase expressing gene, pheB, of phenol-degrading Pseudomonas sp. strain EST1001.
Gene
98:15-20[CrossRef][Medline].
|
| 28.
|
Koiv, V.,
R. Marits, and A. Heinaru.
1996.
Sequence analysis of the 2,4-dichlorophenol hydroxylase gene tfdB and 3,5-dichlorocatechol 1,2-dioxygenase gene tfdC of 2,4-dichlorophenoxyacetic acid degrading plasmid pEST4011.
Gene
174:293-297[CrossRef][Medline].
|
| 29.
|
Kukor, J. J.,
R. H. Olsen, and J.-S. Siak.
1989.
Recruitment of a chromosomally encoded maleylacetate reductase for degradation of 2,4-dichlorophenoxyacetic acid by plasmid pJP4.
J. Bacteriol.
171:3385-3390[Abstract/Free Full Text].
|
| 30.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[CrossRef][Medline].
|
| 31.
|
Leveau, J. H. J., and J. R. van der Meer.
1996.
The tfdR gene product can successfully take over the role of the insertion element-inactivated TfdT protein as a transcriptional activator of the tfdCDEF gene cluster, which encodes chlorocatechol degradation in Ralstonia eutropha JMP134(pJP4).
J. Bacteriol.
178:6824-6832[Abstract/Free Full Text].
|
| 32.
|
Leveau, J. H. J., and J. R. van der Meer.
1997.
Genetic characterization of insertion sequence ISJP4 on plasmid pJP4 from Ralstonia eutropha JMP134.
Gene
202:103-114[CrossRef][Medline].
|
| 33.
|
Lipscomb, J. D., and A. M. Orville.
1992.
Mechanistic aspects of dihydroxybenzoate dioxygenases, p. 243-298.
In
H. Sigel, and A. Sigel (ed.), Metal ions in biological systems, vol. 28. Marcel Dekker, Inc., New York, N.Y.
|
| 34.
|
Maltseva, O. V.,
I. P. Solyanikova, and L. A. Golovleva.
1994.
Chlorocatechol 1,2-dioxygenase from Rhodococcus erythropolis 1CP. Kinetic and immunochemical comparison with analogous enzymes from gram-negative strains.
Eur. J. Biochem.
226:1053-1061[Medline].
|
| 35.
|
Miguez, C. B.,
C. W. Greer, and J. M. Ingram.
1993.
Purification and properties of chlorocatechol 1,2-dioxygenase from Alcaligenes denitrificans BRI6011.
Can. J. Microbiol.
39:1-5.
|
| 36.
|
Nakai, C.,
K. Horiike,
S. Kuramitsu,
H. Kagamiyama, and M. Nozaki.
1990.
Three isoenzymes of catechol 1,2-dioxygenase (pyrocatechase),  ,  , and  , from Pseudomonas arvilla C-1.
J. Biol. Chem.
265:660-665[Abstract/Free Full Text].
|
| 37.
|
Nakai, C.,
T. Nakazawa, and M. Nozaki.
1988.
Purification and properties of catechol 1,2-dioxygenase (pyrocatechase) from Pseudomonas putida mt-2 in comparison with that from Pseudomonas arvilla C-1.
Arch. Biochem. Biophys.
267:701-713[CrossRef][Medline].
|
| 38.
|
Nakai, C.,
H. Uyeyma,
H. Kagamiyama,
T. Nakazawa,
S. Inouye,
F. Kishi,
A. Nakazawa, and M. Nozaki.
1995.
Cloning, DNA sequencing, and amino acid sequencing of catechol 1,2-dioxygenases (pyrocatechase) from Pseudomonas putida mt-2 and Pseudomonas arvilla C-1.
Arch. Biochem. Biophys.
321:353-362[CrossRef][Medline].
|
| 39.
|
Nakazawa, T.,
M. Nozaki, and O. Hayaishi.
1969.
Studies on pyrocatechase.
J. Biol. Chem.
244:119-125[Abstract/Free Full Text].
|
| 40.
|
Neidle, E. L.,
C. Hartnett,
S. Bonitz, and L. N. Ornston.
1988.
DNA sequence of the Acinetobacter calcoaceticus catechol 1,2-dioxygenase I structural gene catA: evidence for evolutionary divergence of intradiol dioxygenases of DNA sequence repetitions.
J. Bacteriol.
170:4874-4880[Abstract/Free Full Text].
|
| 41.
|
Ogawa, N., and K. Miyashita.
1999.
The chlorocatechol-catabolic transposon Tn5707 of Alcaligenes eutrophus NH9, carrying a gene cluster highly homologous to that in the 1,2,4-trichlorobenzene-degrading bacterium Pseudomonas sp. strain P51, confers the ability to grow on 3-chlorobenzoate.
Appl. Environ. Microbiol.
65:724-731[Abstract/Free Full Text].
|
| 42.
|
Ohlendorf, D. H.,
J. D. Lipscomb, and P. C. Weber.
1988.
Structure and assembly of protocatechuate 3,4-dioxygenase.
Nature
336:403-405[CrossRef][Medline].
|
| 43.
|
Ohlendorf, D. H.,
A. M. Orville, and J. D. Lipscomb.
1994.
Structure of protocatechuate 3,4-dioxygenase from Pseudomonas aeruginosa at 2.15 Å resolution.
J. Mol. Biol.
244:586-608[CrossRef][Medline].
|
| 44.
|
Orville, A. M.,
N. Elango,
J. D. Lipscomb, and D. H. Ohlendorf.
1997.
Structures of competitive inhibitor complexes of protocatechuate 3,4-dioxygenase: multiple exogenous ligand binding orientations within the active site.
Biochemistry
36:10039-10051[CrossRef][Medline].
|
| 45.
|
Patel, R. N.,
C. T. Hou,
A. Felix, and M. O. Lillard.
1976.
Catechol 1,2-dioxygenase from Acinetobacter calcoaceticus: purification and properties.
J. Bacteriol.
127:536-544[Abstract/Free Full Text].
|
| 46.
|
Pearson, C. R.
1982.
Halogenated aromatics, p. 86-116.
In
O. Hutzinger (ed.), The handbook of environmental chemistry anthropogenic compounds. Springer Verlag, New York, N.Y.
|
| 47.
|
Perkins, E. J.,
M. P. Gordon,
O. Caceres, and P. F. Lurquin.
1990.
Organization and sequence analysis of the 2,4-dichlorophenol hydroxylase and dichlorocatechol oxidative operons of plasmid pJP4.
J. Bacteriol.
172:2351-2359[Abstract/Free Full Text].
|
| 48.
|
Potrawfke, T.,
T.-H. Löhnert,
K. N. Timmis, and R.-M. Wittich.
1998.
Mineralization of low-chlorinated biphenyls by Burkholderia sp. strain LB400 and by a two-membered consortium upon directed interspecies transfer of chlorocatechol pathway genes.
Appl. Microbiol. Biotechnol.
50:440-446[CrossRef].
|
| 49.
|
Potrawfke, T.,
K. N. Timmis, and R.-M. Wittich.
1998.
Degradation of 1,2,3,4-tetrachlorobenzene by Pseudomonas chlororaphis RW71.
Appl. Environ. Microbiol.
64:3798-3806[Abstract/Free Full Text].
|
| 50.
|
Ravatn, R.,
S. Studer,
D. Springael,
A. J. B. Zehnder, and J. R. van der Meer.
1998.
Chromosomal integration, tandem amplification, and deamplification in Pseudomonas putida F1 of a 105-kilobase genetic element containing the chlorocatechol degradative genes from Pseudomonas sp. strain B13.
J. Bacteriol.
180:4360-4369[Abstract/Free Full Text].
|
| 51.
|
Reineke, W.
1998.
Development of hybrid strains for the mineralization of chloroaromatics by patchwork assembly.
Annu. Rev. Microbiol.
52:287-331[CrossRef][Medline].
|
| 52.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 53.
|
Sander, P.
1991.
Bakterieller Abbau halogenierter Benzole. Ph.D. thesis.
University of Hamburg, Hamburg, Germany.
|
| 54.
|
Sander, P.,
R.-M. Wittich,
P. Fortnagel,
H. Wilkes, and W. Francke.
1991.
Degradation of 1,2,4-trichloro- and 1,2,4,5-tetrachlorobenzene by Pseudomonas strains.
Appl. Environ. Microbiol.
57:1430-1440[Abstract/Free Full Text].
|
| 55.
|
Sauret-Ignaci, G.,
J. Gagnon,
C. Béguin,
M. Barelle,
Y. Markowicz,
J. Pelmont, and A. Toussaint.
1996.
Characterization of a chromosomally encoded catechol 1,2-dioxygenase (E. C. 1.13.11.1) from Alcaligenes eutrophus CH34.
Arch. Microbiol.
166:42-50[CrossRef][Medline].
|
| 56.
|
Schlömann, M.
1994.
Evolution of chlorocatechol catabolic pathways.
Biodegradation
5:301-320[CrossRef][Medline].
|
| 57.
|
Schlömann, M.,
D. H. Pieper, and H.-J. Knackmuss.
1990.
Enzymes of haloaromatics degradation: variations of Alcaligenes on a theme by Pseudomonas, p. 185-196.
In
S. Silver, A. M. Chakrabarty, B. Iglewski, and S. Kaplan (ed.), Pseudomonas: biotransformations, pathogenesis, and evolving biotechnology. American Society for Microbiology, Washington, D.C.
|
| 58.
|
Sommer, C., and H. Görisch.
1997.
Enzymology of the degradation of (di) chlorobenzenes by Xanthobacter flavus 14pl.
Arch. Microbiol.
167:384-391[CrossRef][Medline].
|
| 59.
|
Spain, J. C.
1990.
Metabolic pathways for biodegradation of chlorobenzenes, p. 197-206.
In
S. Silver, A. M. Chakrabarty, B. Iglewski, and S. Kaplan (ed.), Pseudomonas: biotransformations, pathogenesis, and evolving biotechnology. American Society for Microbiology, Washington, D.C.
|
| 60.
|
Strachan, P. D.,
A. A. Freer, and C. A. Fewson.
1998.
Purification and characterization of catechol 1,2-dioxygenase from Rhodococcus rhodochrous NCIMB 13259 and cloning and sequencing of its catA gene.
Biochem. J.
333:741-747.
|
| 61.
|
Tan, H.-M.
1999.
Bacterial catabolic transposons.
Appl. Microbiol. Biotechnol.
51:1-12[CrossRef][Medline].
|
| 62.
|
True, A. E.,
A. M. Orville,
L. L. Pearce, and J. D. Lipscomb.
1990.
An EXAFS study of the interaction of substrate with the ferric active site of protocatechuate 3,4-dioxygenase.
Biochemistry
29:10847-10854[CrossRef][Medline].
|
| 63.
|
Uhde, H.
1998.
Aufreinigung und Charakterisierung der Chlorcatechol 1,2-dioxygenase und der Chlormuconatcycloisomerase aus Acidovorax sp. PS14. Ph.D. dissertation.
University of Hamburg, Hamburg, Germany.
|
| 64.
|
van der Meer, J. R.
1997.
Evolution of novel metabolic pathways for the degradation of chloroaromatic compounds.
Antonie van Leeuwenhoek
71:159-178[CrossRef][Medline].
|
| 65.
|
van der Meer, J. R.,
R. I. L. Eggen,
A. J. B. Zehnder, and W. M. de Vos.
1991.
Sequence analysis of the Pseudomonas sp. strain P51 tcb gene cluster, which encodes metabolism of chlorinated catechols: evidence for specialization of catechol 1,2-dioxygenases for chlorinated substrates.
J. Bacteriol.
173:2425-2434[Abstract/Free Full Text].
|
| 66.
|
van der Meer, J. R.,
A. C. J. Frijters,
J. H. J. Leveau,
R. I. L. Eggen,
A. J. B. Zehnder, and W. M. de Vos.
1991.
Characterization of the Pseudomonas sp. strain P51 gene tcbR, a LysR-type transcriptional activator of the tcbCDEF chlorocatechol oxidative operon, and analysis of the regulatory region.
J. Bacteriol.
173:3700-3708[Abstract/Free Full Text].
|
| 67.
|
van der Meer, J. R.,
S. Harayama,
A. J. B. Zehnder, and W. M. de Vos.
1992.
Molecular mechanisms of genetic adaptation to xenobiotic compounds.
Microbiol. Rev.
56:677-694[Abstract/Free Full Text].
|
| 68.
|
van der Meer, J. R.,
A. R. W. van Nerven,
E. J. de Vries,
W. M. de Vos, and A. J. B. Zehnder.
1991.
Cloning and characterization of plasmid-encoded genes for the degradation of 1,2-dichloro-, 1,4-dichloro-, and 1,2,4-trichlorobenzene of Pseudomonas sp. strain P51.
J. Bacteriol.
173:6-15[Abstract/Free Full Text].
|
| 69.
|
van der Meer, J. R.,
A. J. B. Zehnder, and W. M. de Vos.
1991.
Identification of a novel composite transposable element, Tn5280, carrying chlorobenzene dioxygenase genes of Pseudomonas sp. strain P51.
J. Bacteriol.
173:7077-7083[Abstract/Free Full Text].
|
| 70.
|
Walsh, T. A., and D. P. Ballou.
1983.
Halogenated protocatechuates as substrates for protocatechuate dioxygenase from Pseudomonas cepacia.
J. Biol. Chem.
258:14413-14421[Abstract/Free Full Text].
|
| 71.
|
Walsh, T. A.,
D. P. Ballou,
R. Mayer, and L. Que, Jr.
1983.
Rapid reaction studies on the oxygenation reactions of catechol dioxygenase.
J. Biol. Chem.
258:14422-14427[Abstract/Free Full Text].
|
| 72.
|
Wyndham, R. C.,
A. E. Cashore,
C. H. Nakatsu, and M. C. Peel.
1994.
Catabolic transposons.
Biodegradation
5:323-334[CrossRef][Medline].
|
| 73.
|
Zaborina, O.,
M. Latus,
J. Eberspächer,
L. A. Golovleva, and F. Lingens.
1995.
Purification and characterization of 6-chlorohydroxyquinol 1,2-dioxygenase from Streptomyces rochei 303: comparison with an analogous enzyme from Azotobacter sp. strain GP1.
J. Bacteriol.
177:229-234[Abstract/Free Full Text].
|
Journal of Bacteriology, February 2001, p. 997-1011, Vol. 183, No. 3
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.3.997-1011.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Camara, B., Bielecki, P., Kaminski, F., dos Santos, V. M., Plumeier, I., Nikodem, P., Pieper, D. H.
(2007). A Gene Cluster Involved in Degradation of Substituted Salicylates via ortho Cleavage in Pseudomonas sp. Strain MT1 Encodes Enzymes Specifically Adapted for Transformation of 4-Methylcatechol and 3-Methylmuconate. J. Bacteriol.
189: 1664-1674
[Abstract]
[Full Text]
-
Wittich, R.-M., Wolff, P.
(2007). Growth of the genetically engineered strain Cupriavidus necator RW112 with chlorobenzoates and technical chlorobiphenyls. Microbiology
153: 186-195
[Abstract]
[Full Text]
-
Liu, S., Ogawa, N., Senda, T., Hasebe, A., Miyashita, K.
(2005). Amino Acids in Positions 48, 52, and 73 Differentiate the Substrate Specificities of the Highly Homologous Chlorocatechol 1,2-Dioxygenases CbnA and TcbC. J. Bacteriol.
187: 5427-5436
[Abstract]
[Full Text]
-
Pollmann, K., Wray, V., Pieper, D. H.
(2005). Chloromethylmuconolactones as Critical Metabolites in the Degradation of Chloromethylcatechols: Recalcitrance of 2-Chlorotoluene. J. Bacteriol.
187: 2332-2340
[Abstract]
[Full Text]
-
Ferraroni, M., Solyanikova, I. P., Kolomytseva, M. P., Scozzafava, A., Golovleva, L., Briganti, F.
(2004). Crystal Structure of 4-Chlorocatechol 1,2-Dioxygenase from the Chlorophenol-utilizing Gram-positive Rhodococcus opacus 1CP. J. Biol. Chem.
279: 27646-27655
[Abstract]
[Full Text]
-
Nikodem, P., Hecht, V., Schlomann, M., Pieper, D. H.
(2003). New Bacterial Pathway for 4- and 5-Chlorosalicylate Degradation via 4-Chlorocatechol and Maleylacetate in Pseudomonas sp. Strain MT1. J. Bacteriol.
185: 6790-6800
[Abstract]
[Full Text]
-
Solyanikova, I. P., Moiseeva, O. V., Boeren, S., Boersma, M. G., Kolomytseva, M. P., Vervoort, J., Rietjens, I. M. C. M., Golovleva, L. A., van Berkel, W. J. H.
(2003). Conversion of 2-Fluoromuconate to cis-Dienelactone by Purified Enzymes of Rhodococcus opacus 1cp. Appl. Environ. Microbiol.
69: 5636-5642
[Abstract]
[Full Text]
-
Hoffmann, D., Kleinsteuber, S., Muller, R. H., Babel, W.
(2003). A transposon encoding the complete 2,4-dichlorophenoxyacetic acid degradation pathway in the alkalitolerant strain Delftia acidovorans P4a. Microbiology
149: 2545-2556
[Abstract]
[Full Text]
-
Suzuki, K., Ichimura, A., Ogawa, N., Hasebe, A., Miyashita, K.
(2002). Differential Expression of Two Catechol 1,2-Dioxygenases in Burkholderia sp. Strain TH2. J. Bacteriol.
184: 5714-5722
[Abstract]
[Full Text]